Natural selection leads to adaptations to __________ in an organism's environment. View Available Hint(s) Hint 1.opened hint Consider the features of the environment that affect organisms' existence. Natural selection leads to adaptations to __________ in an organism's environment. nonliving factors such as temperature and chemicals other living organisms abiotic and biotic factors water for aquatic organisms and the atmosphere for terrestrial organisms

Answers

Answer 1

Answer:

abiotic and biotic factors

Explanation:

According to the evolutionary theory proposed by Darwin, natural selection can be defined as the mechanism by which evolution occurs (i.e., the mechanism by which species change over time). An organism´s environment is comprised of abiotic (e.g., temperature, light, water, etc) and biotic (e.g., microbes, food availability, etc) factors. Adaptations refer to the phenotypic traits that increase the chance of survival and reproduction of an organism in its environment. Organisms better adapted to their environment are selected by natural selection to reproduce and thus perpetuate their genes across generations.


Related Questions

Can you be allergic to peanut oil but not peanuts? Please have a real answer!

Answers

Answer:

it depends

Explanation:

most peanut allergies effect your skin i edviase you check with your doctor

Consider the following chemical reaction: Hb + O2 → HbO2 When this reaction is going from right to left, what process is occurring?

O a. oxygen unloading

O b. cellular respiration

O c. pulmonary ventilation

O d.oxygen loading

Answers

Answer: A, Oxygen Unloading

Help!!
Cells of the skeletal system are specialized in their structure to store minerals. Which of the following is the function of these cells?

Produce chemicals that transmit signals.

Prevent the spread of disease in the organism.

Provide support to the body.

Absorb excess water released by digestion.

Answers

Answer: Provide support to the body.

Explanation:

The skeletal system is a system which is formed by the bones. The bones are important for the structure and function of the body. The bones are connected with the muscles to allow the movement of the body, and they protect the vital organs like heart, lungs, brains, and others. They provide support to the soft tissues, organs, and muscles of the body. They keep the human body upright. The skeletal system provide shape to the body. It provides support by acting as regions of attachment of soft body parts and muscles.

what is the correct answer?

Answers

Answer:

Purple. Phenotype=visual characteristics

Vacuoles are found in plats, animals, and single-celled organisms.
In plants, vacuoles can occupy up to 90% of the cell while in animals, vacuoles are much
smaller and also help store ions and nutrients.
Single-celled organisms that live in aquatic environments like the paramecium, have a
contractive vacuole to maintain homeostasis.
Based on the information given, how does a vacuole help an organism maintain homeostasis?
A. It helps by regulating water amounts within the cell.
B. It helps by keeping a rigid structure at all times,
C. It helps by excreting salt as part of osmosis
D. It helps by controlling the movement of gases into the cell.

Answers

Answer: c

Explanation: because it helps by excreting

I need help with this

Answers

Answer:

what is the name of this website

or the book?

P S Q R The biological levels of organization range from a single organelle all the way up to the biosphere in a highly structured hierarchy. Multicellular organisms are organized from the simplest to most complex: cells, tissues, organs, organ systems, organisms. Evaluate the model above. Select ALL of the statements that accurately depict the examples shown in the model. A) R shows an animal cell. B) O shows types of tissue. P shows organs in the endocrine system. D) P shows an organ system, the digestive system. E) S shows an organ system, the digestive system.​

Answers

Answer: the red thing pretend is blood and blue thing is water you first ta

Explanation:

Answer:

A) R → Q → P → S

Explanation:

I just took the test on USA Test Prep

How does competition limit the amount of individuals in populations?

Answers

Answer:

Due to competition, many animals starve, many become prey, etc.

Explanation:

Petra finds a discolored stain on the carpet at a suspected crime scene. What two presumptive tests might she use to determine if the stain is blood? First, Petra sprays the discolored area with , which returns a glowing blue color. However, she knows that this chemical might also turn blue with other substances that contain iron. Subsequently, she uses , which turns pink, indicating the presence of hemoglobin.

Answers

Answer:

First, Petra sprays the discolored area with  

Fluorescein

, which returns a glowing blue color. However, she knows that this chemical might also turn blue with other substances that contain iron. Subsequently, she uses  

Phenolphthalein

, which turns pink, indicating the presence of hemoglobin.

Answer:

a. luminol b. phenolphthalein

Explanation:

looked it up, luminol turns green and the other one turns pink

What changes occur in taste receptors when the membrane is depolarized during receptor potential A. Voltage-gated Ca2 channels open, triggering the release of neurotransmitter. B. Voltage-gated Cl- channels open, triggering the release of neurotransmitter. C. Voltage-gated Ca2 channels open, inhibiting the release of neurotransmitter. D. Voltage-gated Cl- channels open, inhibiting the release of neurotransmitter.

Answers

Answer:

A. Voltage-gated Ca² channels open, triggering the release of neurotransmitters.

Explanation:

For taste mechanisms to function properly, it is necessary the activation of taste receptors.  

Through the activation of taste receptors, transduction cascades occur, involving ion channels that are located in the apical or lateral membranes. There occurs a subsequent release of chemical neurotransmitters that send signals to the control centers.

Salty and sweet flavors produce the membrane depolarization that results in Ca+ ions´ entrance to the cell. Ca+ initiates the release of neurotransmitters. Afferent gustative neurons receive the message and send it to the control center, the encephalon. After that, gustative cells go back to the initial state, repolarizing.

In the 1860s Gregor Mendel performed numerous dihybrid crosses between pea plants. Dihybrid crosses involve the study of the inheritance patterns related to two different traits. In guinea pigs the allele for black fur (B) is dominant over the allele for brown fur (b), and the allele for short fur (F) is dominant over the allele for long fur (f). What percentage of the offspring from a BbFf x bbff cross would be expected to be heterozygous for both traits

Answers

Answer:

25% of the progeny is expected to be dihybrid, BbFf, expressing Black and short fur

Explanation:

Available data:

the allele for black fur (B) is dominant over the allele for brown fur (b)the allele for short fur (F) is dominant over the allele for long fur (f)Cross: BbFf x bbff

Parentals)            BbFf      x         bbff

Phenotypes) Black/Short    Brown/Long

Gametes)       BF, Bf, bF, bf      bf, bf, bf, bf

Punnett square)      BF         Bf          bF          bf

                      bf    BbFf     Bbff       bbFf       bbff

                      bf    BbFf     Bbff       bbFf       bbff

                      bf    BbFf     Bbff       bbFf       bbff

                      bf    BbFf     Bbff       bbFf       bbff

F1) 4/16 = 1/4 = 25% of the progeny is expected to be dihybrid, BbFf, expressing Black and short fur

    4/16 = 1/4 = 25% of the progeny is expected to be bbFf, expressing Brown and short fur

    4/16 = 1/4 = 25% of the progeny is expected to be Bbff, expressing Black and long fur

    4/16 = 1/4 = 25% of the progeny is expected to be bbff, expressing Brown and Long fur

Answer:

25%

Explanation:

Because i took the test

5 5. Normally, the temperature inside the scrotum is slightly lower than normal body temperature. What do you predict would happen if the temperature inside the scrotum were a few degrees higher than normal body temperature instead? A. Sperm would not be able to travel through the vas deferens. B. Sperm would be stored in the epididymis rather than in the testes. c. Sperm would not be able to develop properly. D. The rate of sperm production would increase,​

Answers

Answer:

C. Sperm would not be able to develop properly.

Explanation:

There is an optimum temperature where sperm production is at its best. An increase or decrease in temperature may affect the quality and quantity of the sperm.

If the temperature inside the "sc-rotum" raises by few degree than normal body temperature, than the "sp-erm" would not be able to develop properly.

What is the function of "sc-rotum"?

A pouch, which is suspended from the groin, and comprising the "tes-tes" and some of the male "s-ex" accessory ducts is known as the "sc-rotum". The prime function of the "sc-rotum" is to maintain the temperature essential for the process of "sper-matogenesis", that is, by situating the testes external of the body cavity.

Within the human "sc-rotum", the temperature is 3.1 degree C lesser than the usual temperature of the body. In case, if the temperature elevates of the "sc-rotum", the degeneration of the germinal epithelium will take place, which will eventually result in sterility. Therefore, for the production of sperms within the testes, a lower temperature is needed, otherwise the development of the "sp-erm" will not take place appropriately.

Thus, the correct answer is option C.

Find out more information about the function of "sc-rotum" here:

https://brainly.com/question/940283

A one-hectare forest community is sampled in early August. The sample yields 12 small trees, 4 types of vines, as well as 17 native shrubs that represent 10 species. What can be estimated from the sample for the shrubs in the forest community?

A. the forest’s productivity

B. the species richness

C. the degree of forest disturbance

D. the stability of the ecosystem

E. the uniformity of species distribution in the ecosystem

Answers

Answer:

The correct answer is - B. the species richness

Explanation:

Species richness determines the numbers of different species are present in an ecological community. It is a numerical value or count of different species present in a particular community.

The given information or data can only be used to estimate the species richness in the particular forest community as there is data available about the number of species presnt in this community.

15. Cells found in plants and animals have similarities but can differ in function. Consider the following two organisms: a corn plant cell (Zea mays) and a camel cell (Bactrianus ferus). What is the best explanation for the difference in the cellular vacuole size between these two biotic organisms?

A. The corn cells' have a small vacuole size because it does not need long term water and
electrolyte storage.

B. The camel cells' have a small vacuole size because it does not need long term water and electrolyte storage.

C. The camel cells' have a small vacuole size because it is not in contact with toxins that need to be removed from the cell.

D. The corn cells' have a large vacuole size because it is in contact with many toxins in the soil which need to be removed from the cell.

Answers

The best explanation for the difference in the cellular vacuole size is option d. The corn cells' have a large vacuole size.

Explanation to the difference in the cellular vacuole size:

When there is the difference in the vacuole size that lies between the two biotic organism so it is due to the corn cells that contain high vacuole since they are in contact with various toxins in the soil that need to be eliminated from the cell.

hence, the correct option is d.

And, the rest of the options are wrong.

Learn more about cell here: https://brainly.com/question/14568392

What are Tectonic Plates made of and what do they do?

Answers

Answer:

They move

Explanation:

Answer:

A tectonic plate (also called lithospheric plate) is a massive, irregularly shaped slab of solid rock, generally composed of both continental and oceanic lithosphere.Plate tectonics move because they are carried along by convection currents in the upper mantle of the planet (the mantle is a slowly flowing layer of rock just below Earth's crust). Hot rock just below the surface rises and when it cools and gets heavy, it sinks again.

Explanation:

Graded for correctness: In humans, the ability to digest lactose beyond childhood is determined by a single gene on chromosome 1. L denotes the allele that gives the ability to digest lactose and l denotes the inability to digest lactose. On chromosome 3 is the gene for widows peak. A denotes the allele for no widows peak and a denotes a widows peak. A woman volunteers to be a participant in a genetic research study. Her genotype is LlAa. A doctor harvests a single egg from her body. The genotype of her egg is LA. How did her chromosomes line up at the metaphase plate during meiosis

Answers

Answer:

Metaphase I:    

Homologous chromosomes are placed in the equatorial planeChromosomes carrying the dominant alleles, L and A, face one of the polesThe homologous chromosomes, carrying the recessive alleles, l and a, face the opposite pole.

Metaphase II:  

Chromosomes carrying the dominant alleles, L and A, are placed in the equatorial planeOne of the chromatid sisters of each chromosome faces one of the polesThe other chromatid sisters of each chromosome face the opposite pole.

You will find the image in the attached files.

Explanation:

During metaphase I, homologous pairs migrate to the equatorial plane. They randomly aline with their kinetochores facing opposite poles. The random arrangement of tetrads is different in every cell going through the meiosis process. There is no equal alinement between two cells. When tetrads aline in the equatorial plane, there is no predetermined order for each of the homologous chromosomes of each tetrad to face one of the poles and then migrate to it while separating. Each of the chromosomes has two possibilities for orientation at the plane. When the new haploid cells are formed, the number of variations in each cell is also different and depends on the chromosomes that form that cell. This random order in the equatorial plane is what introduces variation into the gametes. It is almost impossible that two gametes resulting from meiosis will get the same genetic charge.

During metaphase II, fibers of the spindle apparatus take chromosomes toward the equatorial cell plane, where they line up. Sister chromatids are holden together until they reach the Anaphase, during which specialized enzymes break the bonds between chromatids and separate them. Each chromatid migrates to one of the poles. In telophase, the new chromosomes are already in the corresponding poles, and the nuclear membrane forms again. Finally, cytokinesis occurs.

In this example, we will assume no crossing-over in the prophase. I will propose the two metaphase stages.

Metaphase I:                                   Pole 1

        Chromosome 1   ---------L----                -----------A---------    Chromosome 3

                                    ----------L----               -----------A---------

Equatorial plane.....................................................................................................  

        Chromosome 1   ---------l----                  -----------a---------    Chromosome 3

                                     ---------l----                  -----------a---------                      

                                                           Pole 2

In this scheme of Metaphase I, homologous chromosomes are already aligned in the equatorial plane. Each homologous chromosome is facing a pole. So, in the superior part of the scheme, we have chromosomes 1 and 2 carrying the dominant alleles L and A. Both chromosomes are facing pole 1. Then, we can recognize the equatorial plane, and on the other side, we find the homologous chromosomes 1 and 2, facing pole 2, and carrying the recessive alleles, l and a.

During anaphase I, homologous chromosomes will separate and migrate to different poles. In this example, we are interested in chromosomes carrying the dominant alleles that migrate to pole 1. LL and AA.

Metaphase II:                                 Pole 1

        Chromatid 1   ---------L----                    -----------A--------  Chromatid 3

Equatorial plane.....................................................................................................  

        Chromatid 1   ----------L----                   -----------A---------  Chromatid 3

                                                         Pole 2

During metaphase II, each chromatid sister carrying the dominant alleles faces a different pole. During anaphase II they separate and migrate again.

The total result of meiosis in this particular cell is the formation of 4 haploid cells -gametes-: LA, LA, la, la

Describe how Mendel performed his pea plant experiments.

Answers

Answer:

Every offspring does not look alike they change with the generations

Explanation:

Lungs, Trachea, Diaphragm, Nose: Which organ system do these belong to?
Circulatory
Excretory
Digestive
Musculoskeletal
Respiratory

Answers

Answer:

Respiratory

Explanation:

they all come together and help with breathing and oxygen :)

Answer: respiratory system

Explanation:

issues of food insecurity in high income countries​

Answers

Not sure i guess people are just insecure to eat in front of people

Explain why only certain substrate can combine with enzymes.
Help me please​

Answers

Answer:

sry i cant i too dubm need points tho

Explanation:

Determine the mRNA and amino acid sequence for the below DNA sequence.

Answers

AUGAGCCCCGCUAGGUUCUC

What is the range for the following set of measurements?
3.1 mL, 2.7 mL, 4.6 mL, 1.9 mL, 8,7 mL

Answers

The range of the set is 6.8,
because 8.7-1.9=6.8

Many closely related species of ducks have different courtship dances that are performed to solidify a pair-bond. If you were to cross individuals from each of these species what would you expect to see in the hybrid offspring if behaviors related to pair-bond formation were completely due to genetics?

Answers

Answer:

I would expect to see a new phenotype in which the new duck hybrid species would express a new mixed courtship dance with the behaviors of both parentals.  

Explanation:

The cross between both parentals, each from different species, might produce a new phenotype that exhibits both parental dances. The new dance might be considered a hybrid of the parental dances.

Genetically speaking, we can think that there is a gene codifying for the courtship behavior in one species and another gene expressing a different courtship behavior in the other species. This cross´ product would be a hybrid species that exhibits a part of both parentals´ behaviors.

Match each idea about evolution to the person or group where it originated from the drop down menu

Answers

Hello. You did not present the ideas about evolution to which the question refers, which makes it impossible for your question to be answered. However, I will try to help you in the best possible way, showing you the main ideas about evolution and the people who originated them.

According to Jean-Baptiste organisms evolve as a way of seeking perfection.

According to the ancient Greeks and Romans, all living things are in a constant process of change. This change causes evolution and when a living being evolves it causes the evolution of another living being, since everyone is connected and related.

According to Darwin, evolution occurs over time and through an ancestor. For him All living beings have a common ancestor, which evolved over time and generated new species. Darvin also believes that any characteristic acquired by evolution could be passed on to the descendants.

According to Malthus, living beings generate a number of descendants disproportionate to the resources necessary for their survival and this causes evolution.

Do the benefits seem to outweigh the risks of genetically modifying about the glittering gold seahorse Explain your rationale.

plz help ​

Answers

Answer:

yes it does

Explanation:

1) Read the following paragraph and answer the following questions.
The countries which do not have oil reservoirs in their land, import oil from other countries. But sometimes during transportation of oil through sea routes, accidental oil spill occurs. This oil spilled in the ocean may prove fatal and toxic to aquatic animals. Therefore, removal of this spilled oil is essential for protection of aquatic life. For removing this oil layer, certain microbes like Pseudomonas spp and Alcanivorax borkumensis are used. These microbes have the ability to destroy the pyridines and other toxic chemicals. The hydrocarbonoclastic bacteria (HCB) are able to decompose the hydrocarbons and bring about the reaction of carbons with oxygen resulting in formation of CO​2​ and water. Like oil spills cause damage

to aquatic life, plastic forms the major part of the garbage on the land. Plastics are difficult to degrade as they are made up of PET, by research various species like Vibrio and Ideonella sakaiensis which can degrade PET have been identified. There are certain species of microbes which can decompose rubber from garbage.
a) How are aquatic organisms affected by oil spills in the ocean?
b) Which type of chemical compounds are degraded by microbes used for
clearing oil spills?
c) Name any two species of microbes which can degrade rubber from
garbage.
d) Why should there be a ban on plastic bags?

Answers

Answer: See explanation

Explanation:

a) How are aquatic organisms affected by oil spills in the ocean?

Aquatic organisms are affected by oil spilled as it is fatal and toxic to them. It can cause death, habitat degradation, vulnerability to predators and can also lead to the inability to hatch their eggs.

b) Which type of chemical compounds are degraded by microbes used for

clearing oil spills?

The chemical compound degraded by microbes are clearing oil spills are Pseudomonas spp and Alcanivorax borkumensis.

c) Name any two species of microbes which can degrade rubber from

garbage.

These are Vibrio and Ideonella sakaiensis.

d) Why should there be a ban on plastic bags?

There should be a ban on plastic bags as they're difficult to degrade as they are made up of PET.

Meiosis and Mutations are both sources of/for:
O Genetic Drift
O Polyploidy
O Mutations
Genetic Diversity

Answers

Answer:

genetic drift

please mark as brainlest

The average number of individuals of the same species per unit of area or volume at a given time is the
population's
O carrying capacity,
O birth rate.
O size.
Odensity.
O distribution.
Next >

Answers

Huhhhhhhhhhhhhhhhhhhhhhhhh

3. In the image, which letter represents the enzyme?
a. Letter A
b. Letter B
c. Letter C
d. Letter D

Answers

Answer: The answer is C

Explanation:

The correct option is, (c) Letter C.

What is the enzyme?Proteins called enzymes assist our bodies' chemical reactions move forward more quickly. For several processes, including digestion and liver function, enzymes are crucial. Health issues might result from having too much or too little of a specific enzyme. Healthcare professionals can also use the enzymes in our blood to look for injuries and illnesses.

How do you classify enzymes?

According to the sort of process they catalyze, enzymes are divided into six categories:

Oxidoreductases. Transferases.Hydrolases.Lyases.Ligases.Isomerases.

What are the 7 enzymes?Depending on the type of reaction they catalyze, enzymes can be divided into seven different types. These groups include hydrolases, lyases, isomerases, ligases, translocases, oxidoreductases, transferases, and hydrolases.

What is enzyme structure?Proteins called enzymes are made up of amino acids connected by one or more polypeptide chains. The fundamental structure of a polypeptide chain refers to this arrangement of amino acids. This in turn dictates the enzyme's three-dimensional structure, including the active site's shape.

Learn more about enzyme here:

https://brainly.com/question/1596855

#SPJ2

which are examples of steroids? A. testosterone and trans fats B. cholesterol and phospholipids C. cholesterol and vitamin D D. estrogen and phospholipids

Answers

Answer:

A

Explanation:

because it really is suppose. to make u more stronger tougher and high testosterone.

Other Questions
What happened on March 15 in the year 44 B.C.? Caesar began a civil war. Caesar's enemies killed him. C. The Council of the Plebs met. d. All enslaved people were freed. Please select the best answer from the choices provided Com o C ( Plzzz help its over due) (15 POINTS) Will mark brainiest (auto correct)Choose your favorite characterthe one you could relate to the mostfrom among the four novels discussed in this unit: Louisa May Alcott's Little Women, Lois Lowry's The Giver, Charlotte Brontes Jane Eyre, or John Knowles's A Separate Peace. Write an essay explaining to your audience (teacher and peers) why the character you picked is the most relatable. Be sure to use examples from the novel to support your claims. Your essay should be about 900 words (5 to 6 paragraphs). For maximum safety, an electrician should learnA. all OSHA standards and requirements by heart.B. to perform most tasks with one hand.c. to perform tasks in low light situations.D. every NEC code by heart. Why do the temperatures change over the months?O A. Because the Moon is tilted on its axis, it reflects more sunlight on Earth during different times of Earth's yearly orbit.B. Because the Sun is tilted on its axis, parts of Earth get more sunlight during different times of Earth's yearly orbit.O C. Because Earth is tilted on its axis, the stars reflect more light during different times of the Earth's yearly orbit.D. Because Earth is tilted on its axis, parts of Earth get more hours of sunlight during different times of Earth's yearly orbit. Please Help Find the quadratic!Please show work will give branliest! Explain the three categories of biodiversity. ill mark brainly What did the Soviet Union do in 1949 that madeAmericans nervous? You have an annual salary of $85,063. Your monthly expenses include a $1,555 mortgage payment, a $274 car lease payment, $139 in minimum credit card payments, and a $179 payment on your student loan. Calculate your DTI (debt-to-income) ratio as a PERCENTAGE Which expression represents the length of the spring after Gerard removes some weight? Gerard adds weight to the end of the hanging spring D-- The song stretches to a length of p centimeters. Gerard removes some weight and the song moves up by a 8 E-p) - 9 D-9-- Find the missing length 3 9 c Did the constitution represent everyone in the United States when it was created yes/no why Which emperor defeated Hannibal Cattle drives all led to railheads (cow towns), where the cattle were loaded into freight cars bound for eastern markets. Cowboys were big spenders, which profited businesses, but towns were forced to impose this type of restriction to maintain peace for the local residents.a.dress codesc.gun control ordinancesb.drinking age limitsd.vagrancy codesPlease select the best answer from the choices providedABCD A package of 12 pencils costs $0.96. At this rate, how much would 100 pencils cost?A. $8.35B. $10.80C. $9.60D. $8.00 Is this symmetrical or asymmetrical?Dont guess!I will mark brainliest if its correct! If a volume of an object varies directly with its height and if the volume is 24 while the height is 3 what is k Martin recorded the low temperatures at his house for one week. the temperatures are shown below --7, -3, 4, 1, -2, -8. 7Approximately what was the average low temperature of the week? Shawn is using the article "Skin Care for Teens" from the magazine Essentials of Skin Care in her essay about skin. What is the correct order to list the information in a Works Cited entry according to MLA guidelines? Winters, Kelly. Essentials of Skin Care, "Skin Care For Teens." 20 Feb. 2015, pp. 7071. a reflection across y=2HELP DUE VERY SOON 4. During the 1800s, the development of the free enterprise system in the United States had which effect?A) It encouraged entrepreneurship and technological innovation.B) It pressured the government to enact and impose protective tariffs.C) It led to expanded union membership and improved working conditions.D) It reduced the economic gap between rich and poor.