Write a concise essay on animal-like Protista and pay attention to their classification and their effects on human and their domestic animals and suggest some methods

Answers

Answer 1

Answer:

Animal-like Protists belongs to Kingdom Protista.

Explanation:

Animal-like Protists are those unicellular organisms which have animal characteristics like movement and heterotroph. They are not classified in the kingdom Animalia due to some characteristics such as made up of one cell. Animal-like Protists has a great effect on human and their domestic animals because they cause disease in them. Some animal-like Protists are also act as a decomposer means feed on dead bodies of human and animals and clean our environment so animal-like Protists cause an important effect on both human and animals.


Related Questions

How does the double helix structure of DNA support its role in encoding the genome?
1)The sugar-phosphate backbone provides a template for DNA replication
2)tRNA pairing with the template strand creates proteins encoded by the genome
3)Complementary base-pairing creates a very stable structure
4)Complimentary base pairing allows for easy editing of both strands of DNA

Answers

Answer: Complementary base- pairing creates a very stable structure

Explanation:

The double helix structure of deoxyribonucleic acid (DNA) support its role in encoding a genome because the: 3. Complementary base-pairing creates a very stable structure.

A double helix can be defined as the spiral configuration of the deoxyribonucleic acid (DNA) molecule.

In Biology, a double helix is typically used to describe the molecular structure of a double-stranded deoxyribonucleic acid (DNA) molecule, which comprises two (2) linear strands that are complimentary and run opposite to each other and twist together (anti-parallel).

Hence, the complementary base-pairing in a double-stranded deoxyribonucleic acid (DNA) or double helix structure of deoxyribonucleic acid (DNA) helps to create a very stable structure, which in turn makes it possible to encode a genome.

Read more: https://brainly.com/question/19755749

What might be the consequences of your choice?
• Political:
• Economic:
• Social:

Answers

Answer:

Political: Lobbyists.

Economic:Farmers and industrial companies will significantly reduce their output and reduce local jobs. The companies that sell pesticides and fertilizers to local companies will also suffer losses. Farmers will suffer the most if they are unable to find safer fertilizers and pesticides to use.

Social:After a period of time, water pollutants will reduce to safe levels. This could be a long wait. Poverty may increase in the region due to lost jobs and income.

Explanation:

Please I need Help!!
● Prophase I
● Metaphase I
● Anaphase I
● Telophase I
● Prophase II
● Metaphase II
● Anaphase II
● Telophase II

Answers

Answer:

Its in this order: 3 - 4 - 1 - 6 - 5 - 7 - 2 - 8

Explanation:

I learned this a while ago so I would know

which type of cell does the strainer best model?

Answers

Answer:

D

Sieve tube element, because it has openings that allow materials to pass through its end walls.

Answer:

D. Sieve tube element, because it has openings that allow minerals to pass through its end walls

Explanation:

I'm taking the test right now, I hope this helps

15. Mutations that affect the body cells of an organism are called a. Enzyme mutations b. Gamete mutations c. Somatic mutations O d. Neutral mutations​

Answers

Answer:

C. Somatic

Explanation:

hope it helps ya :D

TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA

Answers

Answer:

I don't know the answer

Explanation:

is is this even a question cos I don't think so.

3.4.3 Lab: Why are cells so small?

Answers

Answer: The important point is that the surface area to the volume ratio gets smaller as the cell gets larger. Thus, if the cell grows beyond a certain limit, not enough material will be able to cross the membrane fast enough to accommodate the increased cellular volume. ... That is why cells are so small.

Explanation: because they can absorb nutrients much more efficiently. Because they are smaller they can efficiently absorb enough food. ... When a cell doubles in size the volume increases much more then the surface area, which is why large cells cannot receive enough food efficiently for their volume. Cells are small because they are more efficient as smaller entities. Information within small cells is transmitted more quickly and efficiently than within larger cells. ... Thus a higher cell surface area-to-volume ratio, i.e., smaller cell size, is desired for most efficient cellular activity.

The cells are so small because their small size allows them to take in food and get rid of the waste.

The cells are the basic structural and functional unit of all organisms on earth except the Viruses. The size of the cell is so little it allows the organism to maximize the ration of surface area to volume. Smaller cells are expected to have greater ratio which promotes more molecules as well as ions to move across the plasma membrane.The small size of the cell facilitate to get the nutrients inside the cell and waste outside the cell quickly. Hence, small size of cell facilitates to get food inside and get rid of waste.

Learn more about cell:

https://brainly.com/question/3142913

17. Why did cover crops fall out of favor in the 20th century?
O A. Selective herbicides were developed to kill weeds.
O B. Cover crops worsen soil structure.
O C. Cover crops reduce water infiltration into the soil.
O D. Cover crops were no longer beneficial.

Answers

Cover crops reduce water infiltration into the soil

Chromosomes contain large molecules known as
a DNA
b Lacunae
C Mitochondria
d Viron

Answers

Answer:

a DNA

Explanation:

prove me wrong

|•-•|

What boundary is present at the Philippine plate and the Eurasian plate?
A convergent boundary resulting in earthquakes and volcanic activity
B transform boundary resulting in fault lines and shallow earthquakes
C divergent boundary resulting in mid-ocean ridge and creation of new sea floor
D convergent boundary resulting in mid-ocean ridge and widening of ocean basic

Answers

Answer:

D

Explanation:

which of the following are part of the central nervous system?​

Answers

Answer:

The central nervous system is made up of the brain and spinal cord

Explanation:

ion if that's the answer you were looking for but here go.

MARKING PEOPLE AS BRAINLIDT IF CORRCET

True or False: Bone cells contain different DNA than blood cells.

Answers

Answer:

True the bone cells do have different DNA than blood

Explanation:

True.
bone cells and blood cells do different things, hence the different DNA

Which of the following reactions produces the oxygen released by photosynthesis?

Answers

Answer:

6CO2 + 6H2O → C6H12O6 + 6O2+Energy

Explanation:

This means that the reactants, six carbon dioxide molecules, and six water molecules, are converted by light energy captured by chlorophyll (implied by the arrow) into a sugar molecule and six oxygen molecules, the products.

Which statement is best represented by the diagram?
All carbon is in the form of carbon dioxide,

Carbon can exist in many forms, but the total amount of carbon stays the same.

The amount of carbon in the cycle can increase or decrease based on the number of factories present.

Only living things release carbon dioxide into the atmosphere.

Answers

Answer:

All carbon is in the form of carbon dioxide

Please help I will give a brainliest

Answers

Answer:

answer

Explanation:

im not that good w these sorry

18. How has the use of herbicides affected agricultural productivity?
O A. Fewer crops are organic because of the use of Bt toxin.
B. Fewer pesticides are needed because of parasitoids.
O C. Fewer people are needed to weed because of herbicides.
D. Fewer crops are produced because of herbicides.

Answers

Answer:

B. Fewer pesticides are needed because of parasitoids.

Explanation:

Herbicides are chemicals utilized to manage or command unwanted vegetation. Herbicide employment happens most commonly in row-crop cultivation, where they are employed before or throughout seeding to maximize yield productivity by decreasing other vegetation.  Yields have improved considerably, and, in association with tillage, herbicide use decreases erosion, fuel usage, greenhouse gas discharges, and nutrient run-off, and preserves water.

When is carbon dioxide used during photosynthesis?
A. Light- independent reaction
B. Light-dependent reaction
C. Carbon dioxide is made, not used

Answers

Answer:

Pretty sure its b.

Explanation:

Which statement accurately describes renewable

Answers

Answer:

D

Explanation:

PLEASE HELP I WILL MARK BRAINLIEST. Listed in the Item bank are key terms and expressions, each of which is associated with one of the columns. Some terms may display additional information when you click on them. Drag and drop each item into correct column. Order does not matter. PLEASE HELP

Answers

Producer: Grass, trees, algae

Consumer: Birds, cows, humans

Decomposer: Earthworms, fungi, mushrooms

Answer:

Producer: Grass, trees, algae

Consumer: Birds, cows, humans

Decomposer: Earthworms, fungi, mushrooms

Explanation:

Hope This Helps!

Please Mark Me Brainly!

which statement describes what happens to rocky shorelines that absorb energy from ocean waves?

Answers

Answer:

Solid rock break apart

Explanation:

a sedimentary rock formed from clay deposits

Answers

Answer:

is it shale

sorry if that's not right it's kinda confusing how you put the question

Explanation:

(I will give a Brainliest) Can liquid water and steam exist at 100°C?

Answers

Yes It can.

Hope it helps (:

Answer: yes it can!

Explanation: hope you get a good grade!

Which of the following describes a negative feedback loop?

Answers

Answer:

Which of the following describes a negative feedback loop?

Explanation:

where is option ?

Didn’t list the options my guy

1. How can we identify a market for vegetables? Write.
2
How do you get vegetables to the market? Write the procedures in brief.​

Answers

1.

Marketing is one of the most important factors in determining the success of any fruit and vegetable farming enterprise. Marketing includes all the operations and decisions made by producers. These decisions range from deter-mining the most marketable crops for production to deciding how to best deliver quality produce to the consumers at a profit. However, contrary to popular belief, marketing does not begin after a crop is produced. Instead, marketing alternatives need to be considered even before production takes place.

2.

Recent environmental and food safety concerns in the United States produce sector have brought about increasing interest in organic fruit and vegetable production as an alternative to traditional fruit and vegetable enterprises. As a result, the production and marketing of organic crops has expanded steadily during the 1980s. However, as more organic producers enter the industry and it becomes more and more competitive, existing producers are forced to become better growers and more effective marketers.

The pigment plants have that they use for photosynthesis is called ————

I don’t want a explanation I just want the answer


Answers

Answer:

chlorophyll is the answer

in what form is carbon found in the atmosphere?

Answers

Answer:

carbon dioxide(CO2)

Methane gas(CH4)

Explanation:

Answer:

CO2

Explanation:

ALOT OF POINTS PLEASE HELP :)

How did humankind discover the presence of DNA?

Answers

Answer:

The real breakthrough in understanding DNA, however, came with the discovery of its structure in 1953. The discovery of the structure of DNA is often credited to James Watson and Francis Crick.

Explanation:

Clever ones this is one for you

If you throw a pebble into a pond, ripples spread out from where it went in. These ripples are waves travelling through the water. The waves move with a transverse motion. The undulations (up and down movement) are at 90° to the direction of travel.​

Answers

Answer:

so please Indicate your question

Help I need helpppppppoo

Answers

meters per second. distance is meters and time is seconds
meters per second I’m right

John had two different colored rabbits that were brothers, one grey rabbit, and one that was white with black spots. Both of these rabbits' parents were only white and black. Explain the terminology and reasoning for these color differences the brothers compared to their parents.

Answers

Answer:

They recombine in the offspring, bringing the total gene count back up to two per trait per animal. This recombination of genetic material from parents into children is why we have such diversity among both people and rabbits.

Explanation:

I majored in Biology

Other Questions
This is correct right? An opportunity cost is thevalue of the best alternative given upvalue of all alternatives given upO value gained by your top choiceNAIS QUESTIONASK FOR HELP Can someone help me please I need help on this PLEASE!! In a survey of 2,200 people who owned a certain type of car, 440 said they would buy that type of car again. What percent of the people surveyed were satisfied with the car?nothing% of the people surveyed were satisfied with the car. please help ill give brainliest ok so the open circle lines are like im pretty sure where u put it and what direction its like the number you put it on is not a solution so where do I put the line and what direction does it go in and which line do I put pleaseee helps theres like 2 more questions What is the domain of the following function? 2C3H7OH + 9O2 --> 6CO2 + 8H2ODetermine the number of grams of CO2 produced from the reaction of 5.55 moles of C3H7OH? a1466 g b16.7 g c367 g d12.2 g e733 gPlease show work if health claims are included on a food label, a _______________________ mustbe included. spanish 2 *problem on the picture*match the image below to the correct statement in spanish newibfibbewbhbhdcwebcwbch James Company has 1,000 shares of $10 par preferred stock, which were issued at par. It also has 25,000 shares of common stock outstanding, and its total stockholders' equity equals $500,000. The book value per common share is: who was deborah and why was she imporant What is a constant?O a variablea number that stands alone with no variableO the number in front of the variableO two terms that look exactly the sameneed help please Can someone help me with question 12A please? Thank you! when you tried to login to server your trail may faild this failure event is recorded in GIVING BRAINLEIST+20 POINTSWhat was one restriction placed on free African Americans?O A. They were responsible for paying for the freedom of their enslavedOB. They had to pay for public services that were free for whiteOC. They were not allowed to participate in antislavery organizations.D. They were forbidden in many states to learn to read and write.relatives.Americans. IF YOU DON"T KNOW WHAT IT MEANS PLZ DON"T ANSWER HMU If z = 1 + StartRoot 3 EndRooti, what is z5? 16 + 16StartRoot 3 EndRoot i 16 + 16StartRoot 3 EndRoot i 16 16StartRoot 3 EndRoot i 16 16StartRoot 3 EndRoot i Ppredict the identity of the precipitate in the below reaction:BaCl2(aq) + K2SO4(aq)