Why do cells need to transport molecules?

Answers

Answer 1

Answer:

its the cell membrane  

Explanation:

heres gogle support but i also did this in class

What type of materials need to be transported out of the cell?

Water, carbon dioxide, and oxygen are among the few simple molecules that can cross the cell membrane by diffusion (or a type of diffusion known as osmosis ). Diffusion is one principle method of movement of substances within cells, as well as the method for essential small molecules to cross the cell membrane.

Answer 2

Answer:

porque le permite expulsar de su interior los desechos del metabolismo, también el movimiento de sustancias que sintetiza como hormonas.

Explanation:


Related Questions

Which statement best explains how the gases of the atmosphere affect the temperature of Earth?

Answers

The atmosphere today contains more greenhouse gas molecules, so more of the infrared energy emitted by the surface ends up being absorbed by the atmosphere. Since some of the extra energy from a warmer atmosphere radiates back down to the surface, Earth's surface temperature rises.

What is the universe made of

Answers

Answer:

composition

Explanation:

the universe is composed almost completely of dark energy, dark matter , and ordinary matter

Answer: matter , atoms

Explanation:

HELP NEED THIS BY TODAY!
What did Mendel study that lead him to his discovery

Answers

Answer:

A monk, Mendel discovered the basic principles of heredity through experiments in his monastery's garden. His experiments showed that the inheritance of certain traits in pea plants follows particular patterns, subsequently becoming the foundation of modern genetics and leading to the study of heredity.

Explanation:

Answer:

Mendel studied the genetics of pea plants.

Explanation:

Mendel looked at the pea plants in his monastery garden to determine genetics. He found that some plants had white flowers, while some did not, and he used that discovery to determine the genetics of the plants.

How do living organisms return carbon to the atmosphere in the carbon cycle

Answers

Answer:

Carbon enters the atmosphere as carbon dioxide from respiration and combustion. Carbon dioxide is absorbed by producers to make glucose in photosynthesis

Living organisms return carbon to the atmosphere in the carbon cycle by two  process namely respiration and combustion. Carbon dioxide is absorbed by producers to make glucose in photosynthesis.

What is photosynthesis?

A photosynthesis is a biochemical process which occurs in plants, algae, and bacteria, when they are exposed to sunlight. During photosynthesis, water and carbon dioxide join to form sugars and give off oxygen.

Respiration is defined as the inhaling of oxygen and the exhaling of carbon dioxide and combustion is defined as the process in which a substance burns in the presence of Oxygen, produce off heat and light in the process.

For more information regarding carbon cycle, visit:

https://brainly.com/question/10861032

##SPJ2

Which of the following options best depicts the process of protein synthesis?

1. protein → RNA → DNA
2. DNA → amino acid → RNA → protein
3. DNA → RNA → protein
4. RNA → DNA → RNA → protein

Answers

During translation, the genetic code in mRNA is read and used to make a protein. These two processes are summed up by the central dogma of molecular biology: DNA → RNA → Protein.

Fill in the blanks the world banks the word bank is on the picture provided below :)

Answers

Answer:

1 is pioneer species 2 is limiting factor 3 is ecological succession

Explanation:

Answer:

1) pioneer

2) limiting factor

3) ecological succession

When organisms

they increase in size.

Answers

Answer:

The increase in size and changes in shape of a developing organism depend on the increase in the number and size of cells that make up the individual. Increase in cell number occurs by a precise cellular reproductive mechanism called mitosis.

Explanation:

Why would cells from the same organism have different functions?

Answers

Answer:

Explanation: Cells have to fulfill multiple different functions to be able to build complex multicellular organisms. Differently expressed genes lead to different proteins made in the cell, which leads to different morphology, shape or function. ... When this factor cannot be expressed, these cells do not develop at all.

Process performed by plants (producers) using the sun's energy to make their own food.
A. Conduction
B. Photosynthesis
C. Fission
D. Fusion

Answers

Answer: B.Fotosintesis

Explanation:

Answer:

option B

Explanation:

photosynthesis is the correct answer.

plz mark my answer as brainlist plzzzz.

hope this will be helpful to you.

I hit a substance with a hammer and it shatters.It is a

Answers

Answer:

non metal ,so it is brittle in nature

Put "Sympatric Speciation" in a sentence

Answers

Answer:

A 2008 study suggests that sympatric speciation has occurred in Tennessee cave salamanders.

Explanation:

Hope this helps

PLEASE ANSWER ASAPP!! WILL GIVE BRAINLIEST
Match the following peer pressure tactics to the definitions. (unspoken pressure, rejection, insults, and reasoning)

Communicating verbally and nonverbally

Attempting to convince peers to alter their beliefs

Excluding or ignoring

Dressing a certain way or participating in a certain activity

Answers

Answer:

excluding or ignoring= rejection

Dressing a certain way or participating in a certain activity= unspoken pressure

Attempting to convince peers to alter their beliefs= pressure

Communicating verbally and nonverbally= insults (?)

explain how the cells, tissue, and organs within the circulatory system work together to enable it to perform its function of pumping materials around the body and removing waste products such as carbon dioxide.

Answers

Answer:

the body has levels of organization that build on each other.Cells make up tissues,tissues make up organs,and organs make up organs system.

Please help!!!! Grizzly bears and polar bears are very closely related, so much so that they can reproduce to form hybrid offspring. Use your understanding of natural selection to describe how polar bears became a separate classification from the grizzly.

Answers

Scientists believe that at first these bears scavenged seal carcasses that had washed ashore, and gradually began to hunt the seals by waiting at the water's edge as the seals surfaced to breathe. This is believed to be an important step in the evolution of a new bear species, the polar bear

Over time the new polar bears were used to the cold climate and learnt how to fish, they then separated from the grizzly bears, they developed new creatures which would help them survive in one of the most dangerous climate.

Polar bears become separate classification from the grizzly by the natural selection known as divergent and adaptive evolutionary change.

Polar bears and grizzly bears are considered as closed to one another so they can interbreed. They both diverged from one another due to the harsh climate of the Arctic and the ecology of the region.

The changes that took place are camouflaging and pigment-free fur-coat that helped them in order to adapt to the different climates.The genetic mutation leads to such Adaptive changes when the polar bears migrated northwards.The populations living in different climates undergo natural selection that is divergent natural selection and the adaptive evolutionary changes that result in different species.

Learn more about speciation:

https://brainly.com/question/4493180

Which feature of chytrids makes them different from the other types of fungi? the material that strengthens their cell walls the special digestive material they release their use of budding to reproduce their ability to live in dry environments

Answers

Answer:

the material that strengthens their cell walls

Explanation:

Chytrids originate from the kingdom fungi and a division known as Chytridiomycota. They contain a feature of unique characteristics by the presence of the chitin and the cellulose cell wall. The chitin made up the component of their cell wall in fungi but in Chytrids, the cellulose helps to strengthens their cell walls.

Answer:

A. the material that strengthens their cell walls

1. DNA base sequence: GACGATGTAGCATCGACCATTG.
What would the mRNA sequence for this sequence of DNA be?

Answers

CUGCUACAUCGUAGCUGGUAAC

Construct an argumentative paragraph. Do you believe it's ethical or unethical to artificially select traits in plants and or animals? Provide evidenco to suoport your claims. It doesn't matter what side you chose, but I need it asap.​I will give you any mark you want.​

Answers

Answer:

The ethics of artificially inserting traits in animals has been in the practice for years in the form of selective breeding, but should scientists really be editing DNA to the extent they are today? I don't believe they should. Life itself should construct itself without us interfering. Making a brand new plant just because it looks nice doesn't account for many factors, including the fact that it could be harmful to nearby plants if pollinated. In addition, generic engineering costs quite a lot of money, which should be used on other more cost effective methods, such as improving agriculture rather than creating a whole new plant that could harm entire crops. Genetic engineering isn't a necessity and humans should not play God with plant and animal life.

what is the relation between cell cycle disruption and cancer?
I need help!!!?

Answers

Cancer is the result of unchecked cell division caused by a breakdown of the mechanisms that regulate the cell cycle. The loss of control begins with a change in the DNA sequence of a gene that codes for one of the regulatory molecules. Faulty instructions lead to a protein that does not function as it should.
Cancer is the result of unchecked cell division caused by a breakdown of the mechanisms that regulate the cell cycle. The loss of control begins with a change in the DNA sequence of a gene that codes for one of the regulatory molecules. Faulty instructions lead to a protein that does not function as it should.

If one DNA strand reads CCGTAATGCAT, what will be the sequence of the complimentary strand?

Answers

The complimentary strand would be GGCATTACGTA

How can you determine the number of bonds an atom can make

Answers

Answer:

The number of bonds for a neutral atom is equal to the number of electrons in the full valence shell (2 or 8 electrons) minus the number of valence electrons. This method works because each covalent bond that an atom forms adds another electron to an atoms valence shell without changing its charge.

PLS HELP ASAP!!!!!!!

Answers

Answer:

3. A and B are true

4. oxygen, photosynthesis, I think oxygen, cellular respiration

Explanation:

Hope this helps! :) I am think all of my answers are correct.

WILL GIVE BRAINLIEST

DNA molecules are the instructions to make what?

-proteins

-carbohydrates

-lipids

-plasmids

Answers

Answer:

A

Explanation:

DNA is used to make mRNA, which is then used alongside tRNA to make a polypeptide chain. This chain folds to make a protein.

Despite his fear of germs, Howard Hughes neglected his own hygiene despite having those around him follow strict cleanliness practices. Hughes had these odd behaviors because __________.
A.
he believed he was unable to escape any infection
B.
he developed obsessive-compulsive disorder at an old age
C.
he thought he would be contaminated from the outside
D.
his paralysis at a young age prevented him from being self-sufficient

Answers

Answer: it’s c he thought he would be contaminated from the outside

Explanation:

I took the test

Howard Hughes neglected his own hygiene despite having those around him follow strict cleanliness practices. Hughes had these odd behaviors because he thought he would be contaminated from the outside.

What is importance of cleanliness?

Cleanliness gives rise to a good character by keeping body, mind, and soul clean and peaceful. The cleanliness only which helps to improve our personality by keeping clean externally and internally.

Thus, option "C" is correct.

To learn more about cleanliness click here;

https://brainly.com/question/4279403

Help!! Please!! I'll name you brainliest!!

Answers

Explanation:

the same as the charge on the ion.+1 +2-2

5. -1

plz mark my answer as brainlist plzzzz you get it helpful ☺️.

Hope this will be helpful to you.

Which answer choice accurately depicts the sequence by which blood moves from the pulmonary vein to the body tissues?

Answers

Answer:

See the answer below

Explanation:

Oxygen-rich blood flows from the lung through the pulmonary vein to the left atrium of the heart. From there, the blood is pumped through the mitral valve to the left ventricle. The contraction of the left side of the heart sends the oxygenated blood out of the left ventricle through the aortic arch to the major arteries designated to carry blood to the major parts of the body. From the arteries, blood moves to the capillaries and then to the various tissues of the body before returning back to the heart through the vein.

Thus, the sequence of flow of blood from the pulmonary vein to the body tissues can be summarized as:

Pulmonary vein -> Left atrium -> Arteries -> Capillaries -> tissues

In a sex linked trait, the recessive phenotype is most often found in males because...

Answers

Answer:

X-linked recessive diseases most often occur in males. Males have only one X chromosome. A single recessive gene on that X chromosome will cause the disease. The Y chromosome is the other half of the XY gene pair in the male.

Explanation:

Why are you learning this stuff anyways.Girl????????

PLEASE ANSWER ALL QUESTIONS! THANKS!

Which of the following statements about salinity is true?
Question 1 options:

Ocean water near areas with low evaporation has higher salinity.


Ocean water in regions with high levels of precipitation has higher salinity.


Ocean water near rivers has a lower salinity.


Ocean water in areas with high humidity has a higher salinity



How are latitude and temperature related?








Question 2 options:

Lower latitudes will have warmer water because it is closer to the equator.


Higher latitudes will have warmer water because it is closer to the equator.


Higher latitudes will have warmer water because it is closer to the poles.


Lower latitudes will have warmer water because it is closer to the poles


How does salinity vary with freezing and melting?









Question 3 options:

Both freezing and melting decrease salinity.


Both freezing and melting increase salinity.


Freezing decreases salinity, while melting increases salinity.


Freezing increases salinity, while melting decreases salinity.


How does salinity vary with evaporation?









Question 4 options:

When water evaporates, it takes salt with it, increasing its salinity.


When water evaporates, it leaves salt behind, increasing its salinity.


When water evaporates, it leaves salt behind, decreasing its salinity.


When water evaporates, it takes salt with it, decreasing its salinity.

Answers

Answer:

that guys answers are all wrong except for #3

Explanation:

i took the quiz and got 1/4

A friend says that all bacteria are harmful to people list three reasons this statement is incorrect.

Answers

-autotrophic bacteria give off oxygen (O2)
-flavor foods such as vinegar, yogurt, cheese, etc. (pasteurization)
-decomposers (bacteria)- recycle nutrients in food web
-enviromental clean-up- bacteria eat oil from oil spills
0health and medicine- bacteria break down food in your intestines/make

Name one adaptation that allows desert plants to survive with little water?

Answers

Answer:

stomata

Explanation:

This adaptation helps cacti reduce water loss by keeping the hot, dry wind from blowing directly across the stomata. The leaves and stems of many desert plants have a thick, waxy covering.

B cells can divide to form plasma cells. Each plasma cell contains many mitochondria
and an extensive endoplasmic reticulum. Referring to the function of plasma cells in your answer, explain why these features are important adaptations.

Answers

Answer:

Explanation:

The presence of mitochondria  and an extensive endoplasmic reticulum are the features that are important for adaptations of the plasma cell because plasma cells (white blood cells) secrete immune proteins also called antibodies which only formed due to the presence of endoplasmic reticulum whose function is to formed proteins for the cell so that's why plasma cells have large sized endoplasmic reticulum.

Other Questions
can anyone please re-write this thesis for me? like something similar maybe because i am writing about happiness in a definition essay. :) THANK YOU. Describe German aggression toward Britain. What questions do you think remain unanswered in "The Wife's Lament"? the equations are option 1. y= -3x+5option 2. y= -1/3x+5option 3. y= -3x-5option 4. y= 1/3x+5 Please help.............:) Put the following sentence into the simple past tense.Ich frage nur.O Ich frage nurIch fragte nur.O Ich habe nur gefragt.Ich fragen nur. Question 4 of 20A student is performing experiments on a particular substance. Whichstatement is an observation of a chemical property of the substance?A. Its viscosity decreases.B. It boils.C. Electricity passes through it.D. It reacts with acid.SUBMIT Select the expression that is equivalent to 2b+ 5 + 6b 2b 1. Which object has the most kinetic energy? A. Object 1 B. Object 2 C. Object 3 D. Object 4 Explain why a good exercise program should include both aerobic and resistance training I really need someone's help please! Expand- 2.5( - 3+ 4n + 8) A loaded wagon of mass 10,000 kg moving with a speed of 15 m/s strikes a stationary wagon of the same mass making a perfect inelastic collision. What will be the speed of coupled wagons after collision? Tina buys a briefcase online for 62.95. If shipping and handling are an additional 20% of the price, how much shipping and handling will Tina pay? 5/7 times 1/6 ANSWER IN UNDER 2 MINUTS AND ILL MAKE YOU BRAINLIEST What was the goal of Christian missionaries in Africa? porfavooor me ayudan mi tarea de lengua esta en mi perfil porfavor What event, which has happened twice before, happens again to those in the Secret Annex?A. Their cat goes missing.B. A burglar breaks in.C. They run out of food.D. All of their helpers are ill. Help!! Please!! I'll name you brainliest!! PLZ ASWER WORTH BRAINLIEST AND 20 POINTS!!!Match each word to the correct sentence.Look at the questions. 1. What would a good summary of this text look like?2. What do i already know about this topic?3. How can i put what i'm reading in my own words?What is the most appropriate time to ask each question about a text?afterduringbefore