What is the function of a coenzyme?
1. Binds to the substrate to raise activation energy
2. Inhibits the metabolic pathway of the enzyme
3. Couples with an enzyme to help remove or add electrons in order for the reaction to be catalyzed
4. Is a secondary protein complex that produces ATP

Answers

Answer 1
i believe the answer is c

Related Questions

Which of the following options best depicts the process of protein synthesis?

1. protein → RNA → DNA
2. DNA → amino acid → RNA → protein
3. DNA → RNA → protein
4. RNA → DNA → RNA → protein

Answers

During translation, the genetic code in mRNA is read and used to make a protein. These two processes are summed up by the central dogma of molecular biology: DNA → RNA → Protein.

Please help!!!! Grizzly bears and polar bears are very closely related, so much so that they can reproduce to form hybrid offspring. Use your understanding of natural selection to describe how polar bears became a separate classification from the grizzly.

Answers

Scientists believe that at first these bears scavenged seal carcasses that had washed ashore, and gradually began to hunt the seals by waiting at the water's edge as the seals surfaced to breathe. This is believed to be an important step in the evolution of a new bear species, the polar bear

Over time the new polar bears were used to the cold climate and learnt how to fish, they then separated from the grizzly bears, they developed new creatures which would help them survive in one of the most dangerous climate.

Polar bears become separate classification from the grizzly by the natural selection known as divergent and adaptive evolutionary change.

Polar bears and grizzly bears are considered as closed to one another so they can interbreed. They both diverged from one another due to the harsh climate of the Arctic and the ecology of the region.

The changes that took place are camouflaging and pigment-free fur-coat that helped them in order to adapt to the different climates.The genetic mutation leads to such Adaptive changes when the polar bears migrated northwards.The populations living in different climates undergo natural selection that is divergent natural selection and the adaptive evolutionary changes that result in different species.

Learn more about speciation:

https://brainly.com/question/4493180

Despite his fear of germs, Howard Hughes neglected his own hygiene despite having those around him follow strict cleanliness practices. Hughes had these odd behaviors because __________.
A.
he believed he was unable to escape any infection
B.
he developed obsessive-compulsive disorder at an old age
C.
he thought he would be contaminated from the outside
D.
his paralysis at a young age prevented him from being self-sufficient

Answers

Answer: it’s c he thought he would be contaminated from the outside

Explanation:

I took the test

Howard Hughes neglected his own hygiene despite having those around him follow strict cleanliness practices. Hughes had these odd behaviors because he thought he would be contaminated from the outside.

What is importance of cleanliness?

Cleanliness gives rise to a good character by keeping body, mind, and soul clean and peaceful. The cleanliness only which helps to improve our personality by keeping clean externally and internally.

Thus, option "C" is correct.

To learn more about cleanliness click here;

https://brainly.com/question/4279403

Which feature of chytrids makes them different from the other types of fungi? the material that strengthens their cell walls the special digestive material they release their use of budding to reproduce their ability to live in dry environments

Answers

Answer:

the material that strengthens their cell walls

Explanation:

Chytrids originate from the kingdom fungi and a division known as Chytridiomycota. They contain a feature of unique characteristics by the presence of the chitin and the cellulose cell wall. The chitin made up the component of their cell wall in fungi but in Chytrids, the cellulose helps to strengthens their cell walls.

Answer:

A. the material that strengthens their cell walls

Virtual Lab
Active
Create a dichotomous key.
O
Magnifying Glass
Drag your question here.
Legs
Wings
Antennae
Stinget
Claws
Please help

Answers

Answer:

WHAT ARE YOU TRYING TO ASK BRO

HELP NEED THIS BY TODAY!
What did Mendel study that lead him to his discovery

Answers

Answer:

A monk, Mendel discovered the basic principles of heredity through experiments in his monastery's garden. His experiments showed that the inheritance of certain traits in pea plants follows particular patterns, subsequently becoming the foundation of modern genetics and leading to the study of heredity.

Explanation:

Answer:

Mendel studied the genetics of pea plants.

Explanation:

Mendel looked at the pea plants in his monastery garden to determine genetics. He found that some plants had white flowers, while some did not, and he used that discovery to determine the genetics of the plants.

A friend says that all bacteria are harmful to people list three reasons this statement is incorrect.

Answers

-autotrophic bacteria give off oxygen (O2)
-flavor foods such as vinegar, yogurt, cheese, etc. (pasteurization)
-decomposers (bacteria)- recycle nutrients in food web
-enviromental clean-up- bacteria eat oil from oil spills
0health and medicine- bacteria break down food in your intestines/make

If one DNA strand reads CCGTAATGCAT, what will be the sequence of the complimentary strand?

Answers

The complimentary strand would be GGCATTACGTA

Fill in the blanks the world banks the word bank is on the picture provided below :)

Answers

Answer:

1 is pioneer species 2 is limiting factor 3 is ecological succession

Explanation:

Answer:

1) pioneer

2) limiting factor

3) ecological succession

Which statement best explains how the gases of the atmosphere affect the temperature of Earth?

Answers

The atmosphere today contains more greenhouse gas molecules, so more of the infrared energy emitted by the surface ends up being absorbed by the atmosphere. Since some of the extra energy from a warmer atmosphere radiates back down to the surface, Earth's surface temperature rises.

Construct an argumentative paragraph. Do you believe it's ethical or unethical to artificially select traits in plants and or animals? Provide evidenco to suoport your claims. It doesn't matter what side you chose, but I need it asap.​I will give you any mark you want.​

Answers

Answer:

The ethics of artificially inserting traits in animals has been in the practice for years in the form of selective breeding, but should scientists really be editing DNA to the extent they are today? I don't believe they should. Life itself should construct itself without us interfering. Making a brand new plant just because it looks nice doesn't account for many factors, including the fact that it could be harmful to nearby plants if pollinated. In addition, generic engineering costs quite a lot of money, which should be used on other more cost effective methods, such as improving agriculture rather than creating a whole new plant that could harm entire crops. Genetic engineering isn't a necessity and humans should not play God with plant and animal life.

The vocal cords stretch across the opening of the larynx. True or false??

Answers

Answer:

True

Explanation:

Vocal cords are bands of smooth muscle tissue located in the larynx. When air passes through, the vocal cords vibrate.

Answer: True

Explanation:

The vocal folds, also known popularly as vocal cords, are composed of twin infoldings of mucous membrane stretched horizontally across the larynx. They vibrate, modulating the flow of air being expelled from the lungs during phonation.

I hit a substance with a hammer and it shatters.It is a

Answers

Answer:

non metal ,so it is brittle in nature

what is the relation between cell cycle disruption and cancer?
I need help!!!?

Answers

Cancer is the result of unchecked cell division caused by a breakdown of the mechanisms that regulate the cell cycle. The loss of control begins with a change in the DNA sequence of a gene that codes for one of the regulatory molecules. Faulty instructions lead to a protein that does not function as it should.
Cancer is the result of unchecked cell division caused by a breakdown of the mechanisms that regulate the cell cycle. The loss of control begins with a change in the DNA sequence of a gene that codes for one of the regulatory molecules. Faulty instructions lead to a protein that does not function as it should.

What does the temporal lobe and Cerebellum do?

Answers

Answer:

The temporal lobes are also believed to play an important role in processing affect/emotions, language, and certain aspects of visual perception.

The cerebellum is busy planning, adjusting and executing movements of the body, the limbs and the eyes.

Explanation:

Can someone help me with this chromosome assignment?

Answers

this is the answer for only first page.

homologous, diploid,gametes,haploid

the same thing as what the other person said.

di=2

hap=1

remember that for diploid and haploid

Put "Sympatric Speciation" in a sentence

Answers

Answer:

A 2008 study suggests that sympatric speciation has occurred in Tennessee cave salamanders.

Explanation:

Hope this helps

How can you determine the number of bonds an atom can make

Answers

Answer:

The number of bonds for a neutral atom is equal to the number of electrons in the full valence shell (2 or 8 electrons) minus the number of valence electrons. This method works because each covalent bond that an atom forms adds another electron to an atoms valence shell without changing its charge.

How do living organisms return carbon to the atmosphere in the carbon cycle

Answers

Answer:

Carbon enters the atmosphere as carbon dioxide from respiration and combustion. Carbon dioxide is absorbed by producers to make glucose in photosynthesis

Living organisms return carbon to the atmosphere in the carbon cycle by two  process namely respiration and combustion. Carbon dioxide is absorbed by producers to make glucose in photosynthesis.

What is photosynthesis?

A photosynthesis is a biochemical process which occurs in plants, algae, and bacteria, when they are exposed to sunlight. During photosynthesis, water and carbon dioxide join to form sugars and give off oxygen.

Respiration is defined as the inhaling of oxygen and the exhaling of carbon dioxide and combustion is defined as the process in which a substance burns in the presence of Oxygen, produce off heat and light in the process.

For more information regarding carbon cycle, visit:

https://brainly.com/question/10861032

##SPJ2

What are some factors that can cause observed evolutionary change?

Answers

Answer:

There are four such forces: mutation, gene flow, genetic drift, and natural selection.

Explanation:

Answer:

natural selection, random genetic drift, mutation, population mating structure, and culture.

Explanation:

I hope this helps! ^^

☁️☁️☁️☁️☁️☁️☁️☁️

explain how the cells, tissue, and organs within the circulatory system work together to enable it to perform its function of pumping materials around the body and removing waste products such as carbon dioxide.

Answers

Answer:

the body has levels of organization that build on each other.Cells make up tissues,tissues make up organs,and organs make up organs system.

PLEASE ANSWER ALL QUESTIONS! THANKS!

Which of the following statements about salinity is true?
Question 1 options:

Ocean water near areas with low evaporation has higher salinity.


Ocean water in regions with high levels of precipitation has higher salinity.


Ocean water near rivers has a lower salinity.


Ocean water in areas with high humidity has a higher salinity



How are latitude and temperature related?








Question 2 options:

Lower latitudes will have warmer water because it is closer to the equator.


Higher latitudes will have warmer water because it is closer to the equator.


Higher latitudes will have warmer water because it is closer to the poles.


Lower latitudes will have warmer water because it is closer to the poles


How does salinity vary with freezing and melting?









Question 3 options:

Both freezing and melting decrease salinity.


Both freezing and melting increase salinity.


Freezing decreases salinity, while melting increases salinity.


Freezing increases salinity, while melting decreases salinity.


How does salinity vary with evaporation?









Question 4 options:

When water evaporates, it takes salt with it, increasing its salinity.


When water evaporates, it leaves salt behind, increasing its salinity.


When water evaporates, it leaves salt behind, decreasing its salinity.


When water evaporates, it takes salt with it, decreasing its salinity.

Answers

Answer:

that guys answers are all wrong except for #3

Explanation:

i took the quiz and got 1/4

What is the universe made of

Answers

Answer:

composition

Explanation:

the universe is composed almost completely of dark energy, dark matter , and ordinary matter

Answer: matter , atoms

Explanation:

In a sex linked trait, the recessive phenotype is most often found in males because...

Answers

Answer:

X-linked recessive diseases most often occur in males. Males have only one X chromosome. A single recessive gene on that X chromosome will cause the disease. The Y chromosome is the other half of the XY gene pair in the male.

Explanation:

Why are you learning this stuff anyways.Girl????????

1. DNA base sequence: GACGATGTAGCATCGACCATTG.
What would the mRNA sequence for this sequence of DNA be?

Answers

CUGCUACAUCGUAGCUGGUAAC

A cell containing 20 chromosomes undergoes mitosis, each daughter cell will have 20 chromosomes
a.True
b.False

Answers

Answer:

the answer is true because a cell containing 20 chromosomes undergoes mitosis, each daughter cell will have 20 chromosomes

Name one adaptation that allows desert plants to survive with little water?

Answers

Answer:

stomata

Explanation:

This adaptation helps cacti reduce water loss by keeping the hot, dry wind from blowing directly across the stomata. The leaves and stems of many desert plants have a thick, waxy covering.

WILL GIVE BRAINLIEST

DNA molecules are the instructions to make what?

-proteins

-carbohydrates

-lipids

-plasmids

Answers

Answer:

A

Explanation:

DNA is used to make mRNA, which is then used alongside tRNA to make a polypeptide chain. This chain folds to make a protein.

B cells can divide to form plasma cells. Each plasma cell contains many mitochondria
and an extensive endoplasmic reticulum. Referring to the function of plasma cells in your answer, explain why these features are important adaptations.

Answers

Answer:

Explanation:

The presence of mitochondria  and an extensive endoplasmic reticulum are the features that are important for adaptations of the plasma cell because plasma cells (white blood cells) secrete immune proteins also called antibodies which only formed due to the presence of endoplasmic reticulum whose function is to formed proteins for the cell so that's why plasma cells have large sized endoplasmic reticulum.

Process performed by plants (producers) using the sun's energy to make their own food.
A. Conduction
B. Photosynthesis
C. Fission
D. Fusion

Answers

Answer: B.Fotosintesis

Explanation:

Answer:

option B

Explanation:

photosynthesis is the correct answer.

plz mark my answer as brainlist plzzzz.

hope this will be helpful to you.

Other Questions
Find the unknown side length x. Write your answer in simplest radical form A water tank holds 1,088 gallons but is leaking at a rate of 5 gallons per week. A second water tank holds1,360 gallons but is leaking at a rate of 9 gallons per week. After how many weeks will the amount ofwater in the two tanks be the same?The amount of water in the two tanks will be the same in weeks. Determine mASAP please help!! How can getting fired from ajob be a good thing? Whatdoes "heaviness of beingsuccessful mean? How canyou be heavy with success?What does he mean bylightness of being a beginneragain?Do you want to be heavywith success? Or would youprefer to be light as abeginner? Explain byanswering all thesequestions. How many grams are in 21.4 mol Cl2 gas? Suppose a university is divided into three campuses: the Main campus, the Downtown campus, and the Bay Area campus. The Main campus has 60% of the university's students, the Downtown campus has 25%, and the Bay Area has the rest. At the Main campus, 12% of the students are statistics majors. At the Downtown campus, 4% of the students are statistics majors. Finally, at the Bay Area campus, 1% of the students are statistics majors.Required:a. What proportion of students at the university are statistics majors?b. Of all statistics majors at the university, what proportion are at the Main campus? PPPPPPPPPPPPPPPPPPPPPPPPPPPPplwlwlwlwlwlwlwlEEEEEEEEEEEEEEEEASE 3. What did the researchers from Brigham and Women's compare in theirstudy? what our society promotes? 5x - 4 = 2 (x + 3) + x Does your high school transcript go in your career portfolio What is x - 12 = 6THANKSSSSSSSSS A man with $20,000 to invest decides to diversify his investments by placing $10,000 in an account that earns 5.2% compounded continuously and $10,000 in an account that earns 6.4% compounded annually. Use graphical approximation methods to determine how long it will take for his total investment in the two accounts to grow to $35,000. It will take approximately nothing years for his When is the Glorious Mysteries of the Rsary Prayed? You are schools you are a school supply shopping in together as a package of six pink pencils for 250 how much does each pencil cost if Lauren robed (22+34) bread from the bread factory how much bread would she have. A gas at 127 celsius and 10.0 L expands to 20.0 L. What is the newtemperature in kelvin? (You must convert to Kelvin before calculatingthis problem While talking to a friend, a construction worker momentarily set her cell phone down on one end of an iron rail of length 7.50 m. At that moment, a second worker dropped a wrench so that it hit the other end of the rail. The person on the phone detected two pulses of sound, one that traveled through the air and a longitudinal wave that traveled through the rail. (Assume the speed of sound in iron is 5,950 m/s and the speed of sound in air is 343 m/s).A) Which pulse reaches the cell phone first?B) Find the separation in time (in s) between the arrivals of the two pulses. Need help!!!! ahaaaaaa What was Alexander Hamilton's ideal Economy