This chart illustrates the type and number of items collected during a clean up of a beach. Based on the chart, what approximate percentage of the total items result from the action of people?

This Chart Illustrates The Type And Number Of Items Collected During A Clean Up Of A Beach. Based On

Answers

Answer 1

Answer:

50%

Explanation:

Answer 2

Based on this chart, the approximate percentage of the total items that result from the action of people is 70% - 80%.

What is a pie chart?

A pie chart can show the method by which a total amount can be divided between the levels of a categorical variable as a circle is divided into radial slices.

Each categorical value is corresponding to a single slice of the circle, and the size of each slice, both in the area and arc length, is indicative of the proportion of the whole that each category level will take.

Pie charts have comparatively limited cases of use this is encapsulated particularly accurately according to its definition.

So, for the utilization of a pie chart, one must have some kind of a whole amount that is divided into a number of distinct parts. These are represented by various sections.

Therefore, based on this chart, the approximate percentage of the total items that result from the action of people is 70% - 80%.

Read more about pie charts, here

https://brainly.com/question/9979761

#SPJ2


Related Questions

Which of the following problems are a result of acid deposition?


Nitrogen depletion in soils
Decreased pH levels in lakes and rivers
Corrosion of monuments and metal structures
I and III
II and III
I only
II only

Answers

Answer:

II and III

Explanation:

Acid will decrease pH levels in water and corrode monuments like marble statues and rust metals, but has no correlation to nitrogen depletion.

Hope this helped!

Compare asexual and sexual reproduction. Place each statement into the correct box.

Answers

Answer:

Explanation:

asexual doesn't require a mate or another thing to reproduce. sexual requires another thing to reproduce like a male and female

Answer:

During asexual reproduction, the organism that is reproducing spits in two.

A sea anemone reproduces asexually.

During sexual reproduction, there are two organisms(male and female) that are part of the reproductive process.

Humans reproduce sexually.

Explanation:

WILL GIVE 20 POINTS AND BRAINLIEST PLS HURRY

In order for a scientific explanation to be valid, it MUST be based on evidence from _[blank]_.
a. hypotheses of scientific experiments
b. a credible scientific journal
c. the latest scientific research
d. observations of the scientific investigation

Answers

Answer:

a. hypotheses of scientific experiments

Explanation:

Phenotypes are the
observable characteristics of an individual (ex:
curly hair)

or

genetic representation of a an individual (ex: Hh)

Answers

Answer:

phenotype are the observable characteristics of an individual (ex:curly hair)

Make a list of different weather patterns

Answers

Weather comes in all different forms, and it changes by the day. It could be sunny one day and raining the next. It could even be sunny, rainy, cloudy, and stormy in one day.

Common Types of Weather Elements

The weather has a lot of different factors. When someone asks how the weather is today, you need to think about temperature, humidity, precipitation, wind, cloudiness, and atmospheric pressure. All these different parts work together to create the weather you see when you walk out the door.

Which of the following statements regarding prokaryotic and eukaryotic cells is true

Answers

Answer:

I would need the statements to answer that. however prokaryotic cells are plant cells and eukaryotic cells are animal cells

Answer:

They are typically smaller than eukaryotic cells. The DNA of a prokaryotic cell is contained in the nucleoid. There are several ways in which prokaryotic cells are different from eukaryotic cells. Firstly, they are generally smaller in size, their organelles are not membrane bound, and they have no nucleus. They, however, share commonalities with eukaryotic cells including the presence of a bilipid plasma membrane, presence of ribosomes and DNA.

Hope this helps, have a great day/night, and stay safe!

What is the difference between prokaryotic and eukaryotic cells?

Answers

The main difference that separates prokariotic organisms from eukaryotic organisms is the organisation of the genetic material. Prokaryotes have a single chromosome that isn't separated by a membrane and it's called nucleoid. Eukaryotes have multiple chromosomes that are inclosed in a nuclear envelope(nucleus).

The only organelles present in prokaryotic cells are the ribosomes(70S) which differ from the eukaryotic ribosomes(80S). Eukaryotic cells have membrane bound organelles like the mitochondrion or Golgi aparatus.

Describe some of the properties of water and explain how the structure of water is responsible for these properties.

Answers

Answer:

The main properties of water are its polarity, cohesion, adhesion, surface tension, high specific heat, and evaporative cooling. A water molecule is slightly charged on both ends. This is because oxygen is more electronegative than hydrogen. ... The stream of water bends due to the polarity of water molecules.

Explanation:

when benedicts solution is added to a sucrose solution and put into a boiling water-bath , no change in color is observed

state why no color change is observed

Answers

Answer:

b

Explanation:

List four characteristics of plants.

Answers

Answer:

1. Plants produce their own food.

2. Plant cells have a cell wall.

3. Plants reproduce with spores and sex cells.

4. Plants have a vascular system.

Explanation:

Here is four characteristics plants have.

Plants produce food through photosynthesis so I included that here.

Hope this is correct, have a great day.

What Bacteria is put in yougurt ?

Answers

two species of bacteria called Lactobacillus bulgaricus and Streptococcus thermophilus.

Answer:

food bateria

Explanation:

What are three organelles that are involved in the production of proteins?

Answers

Answer:

golgi bodies, ribosomes and endoplasmic reticulum.

Explanation:

Hope this helps!

What would happen to a species if it was quickly moved from a familiar environment to an extremely different environment.

Answers

Depending on how good that species is at adapting to new environments that species of animals could adapt overtime, or die

What do the enzymes in excision repair systems do?

A destroy cancer cells
B cut off telomere sections
C replace dna damaged by chemicals
D replace rna primers with dna

Answers

B would be the answer I think

Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide
chain, identifying the codons, anticodons, and amino acid sequence.
DNA: CGATACAATGGACCCGGTATGCGATATCC

Answers

I don’t feel like answering all that but....
C=G G=C T=A A=U
C=G A=T dont know the rest have a gcodocododd dday

Peoples choices can sometimes have negative effects on their own health as well as the health of your well-being of others describe to these choices explain how they can impact the individual and others

Answers

Answer

a good environment could mean better people better love and kindness bad environment could mean problems in your future and/or daily life this can affect everybody and anybody

Explanation:

Explain how diffusion and osmosis are related to the symptoms of cystic fibrosis

Answers

Answer:

Answer D

Explanation:

just took the test.

In a chemical analysis of a sample of animal tissue, which element would most likely be found in the smallest quantity?

Answers

Answer:

Iodine

Explanation:

Iodine is needed by animals because the body's metabolic rate is controlled by the action of an iodine hormone, called thyroxine, which is secreted by the thyroid gland in the neck.

If the animal fails to supply enough iodine through food to be able to make a normal amount of this compound, then the thyroid gland enlarges or expands trying to create enough, resulting in a common type of goiter.

People are more likely to seek treatment if they
A. are in a minority
B. live in a rural community
C. have medical insurance
D. have a diagnosis

Answers

Answer:

C. have medical insurance

Explanation:

People are more likely to seek treatment if they D. have a diagnosis as it helps in the treatment of disease.

The clinical diagnosis lets in a clinical expert chart a listing of clinical signs after which evaluate them to different data. A high-quality fitness final result is primarily based totally one scale of being alive and not using a long-time period results to death.

What is the diagnosis?

The act of spotting a disorder from its symptoms and symptoms and signs the realization this is reached following and trying out .The prognosis turned into pneumonia.

Thus it is well explained.

To learn more about the medical insurance refer to link :

https://brainly.com/question/1941778

Bacteria cannot survive in deep ocean areas where no light is present. true or false

Answers

Answer:

false on edge

Explanation:

BRAINLIEST:
in which month is a hurricane most likely to occur: October or December? explain

Answers

Answer:

October

Explanation:

October is one of the hurricane season months

All substances are built from
compound
oxygen
metals
atoms

Answers

Answer: All substances are built from

compound

oxygen

Explanation:

All substances are built from atoms as atoms are the basic building blocks of matter and are the smallest units of a chemical element. The correct option is D.

Atoms form the basis of all compounds. The fundamental building blocks of matter, atoms are the smallest units of a chemical element that nonetheless retain that element's chemical characteristics.

Atoms from various elements combine chemically to produce compounds, however compounds themselves are not the basic building blocks.

Although oxygen is an element that is present in several substances, it is untrue to say that oxygen is the primary component of all substances.

Although metals are a specific kind of element, not all substances are made of metals. Thus, the most correct response is that all substances are composed of atoms.

Thus, the correct option is D.

For more details regarding atoms visit:

https://brainly.com/question/13654549

#SPJ6

Your question seems incomplete, the probable complete question is:

All substances are built from

A. compound

B. oxygen

C. metals

D. atoms

has anyone done this worksheet? i need help with it. thanks:)

Answers

I have done it I think
try scanning it with the google app with text and usually answer keys pop up good luck!

The air in the thermosphere is composed of atoms of _____ that are very far apart from each other.

Answers

Answer:

Explanation:

In the upper thermosphere, atomic oxygen (O), atomic nitrogen (N), and helium (He) are the main components of air.

Energetic ultraviolet and X-ray photons from the Sun also break apart molecules in the thermosphere. In the upper thermosphere, atomic oxygen (O), atomic nitrogen (N), and helium (He) are the main components of air there ya go son

What is a society that is able to survive and function over a specified time?​

Answers

Answer:because time and society are different

Explanation:

A 100 kg box is initially at rest on a level surface. One 10 N force acts on the box , directed toward the right. A second 10 N force acts simultaneously on the box , directed toward the left , as shown.

Answers

The box would stay at rest where it lies since the same amount of force is pulling it in opposite directions :)

Since 10 N forces are acting from both sides, these are balanced forces and the box will not move because balanced forces are acting on it. So the correct option is D.

What are balanced forces?

Forces that are equal in magnitude and opposing in direction are said to be balanced forces. Equilibrium is seen as a condition of balanced forces. There is no shift in direction when the forces are in balance.

Balanced combined forces have always been equal to zero. These are vectors for merging. Balance forces cannot alter an object's momentum or direction.

An item is kept traveling at a constant speed by a balanced force. In it, Newton's First Law of Motion is explained. A good illustration of a balanced force is a book on the table. The normal force (support force) of the table balances out the weight of the book. The two forces are exactly equal and opposed to one another.

While forces that are balanced can keep an item at rest or move at a steady speed, unequal forces can cause things to accelerate.

Therefore the correct option is D.

Read more about balanced forces, here

https://brainly.com/question/19127263

#SPJ5

Use chromosomes 11 and 17 to answer the following questions. Chromosome Map Chromosome 17 is made of over million base pairs. Approximately how many genes are found on chromosome 17? List the genetic disorders found on chromosome 17. What do you know about any of those disorders?

Answers

Answer:

Hello!

Chromosome 17 is made of over 80 million base pairs.

Approximately how many genes are found on chromosome 17? 1600

Explanation:

Chromosome 17 is made up of more than 80 million base pairs. Approximately, 1600 genes are found on chromosome 17. The genetic disorders found on chromosome 17 are as follows:

Breast cancer.Neurofibromatosis.DNA damage response in individuals.Scoliosis.Congenital heart anomalies.

What are Chromosomes?

Chromosomes may be defined as thin, thread-like structures that may appear in the nucleus of the cell during the process of cell division. These structures may contain DNA, RNA, histones, and non-histone proteins. Chromosomes may be discovered by E. Strasburger in 1875.

Human chromosome 17 is implicated in a wide range of human genetic diseases. It is home to genes involved in many genetic disorders that may affect the physiology of an individual. They are very severe to organisms.

Mosaic trisomy 17 is a rare chromosomal anomaly syndrome, with a highly variable clinical presentation, mostly characterized by growth delay, intellectual disability, body asymmetry with leg length differentiation, scoliosis, and congenital heart anomalies.

To learn more about Genes and chromosomes, refer to the link:

https://brainly.com/question/29393001

#SPJ2

Which of the following does not contribute to erosion?
O Lava
Olce
O Wind
O Water

Answers

Lava..

got it right on edge 2020

Which of the following statements is true?

Opportunistic bacteria only cause infection under certain conditions.
Most bacterial infections are caused by bacteria already in the body.
Leukocytes are the first line of defense against pathogenic microorganisms.
The flu and the common cold are treated with rest, fluids, and antibiotics.

Answers

Answer:

1 one is true

2 is true

3 is falase

Answer:

a

Explanation:

Which of the following processes begins when a star enters the main sequence?
a


Nuclear fission
b


Nuclear fusion
c


Condensation of a nebula
d


Appearance of a supernova

Answers

Answer:

i believe it is B: Nuclear Fusion

Explanation:

Answer:

C. Nuclear Fusion

Explanation:

I am 1000000000% sure this is correctamundo, stay cool, and have a great day!

Other Questions
this sentence has 5 errors! Ricky Martin canta mucho. Yo baila con la msica. Mi amigo y yo escuchan la radio. Nosotros vivimos la vida loca. Ricky Martin es simpticos y fantstica. Comprendas t? Adis. just fill out why it is 3 OH COME ON HELP ME OUT HERE PLSWhat type of battery cell is characterized by having two metals, zinc and copper, sitting in dilute sulfuric acid that touches both metals?pls help mewet celllead-acid cellelectric cellvoltaic cell Keep that Michelle went out To dinner. The total cost of the meal, including the tip, came out to $53.70. It's a combined tip came out to $9.60 and each friend spent an equal amount, how much did each friend pay not including the tip? Solve the given system by substitution. PLZ HELP ME PLZ I NEED IT Red blood cells need iron. They store iron and typically contain more iron than the fluid around them does. Which action would show the blood cells doing active transport?pushing iron outbringing iron inswellingshrinking What Disney Princess is this? Also how do you like my drawing? Which of the following makes a true statement?The country with the highest amount of gold reserves is in Africa.The country with the highest amount of gold reserves is in North America.No country in North America has a significant amount of gold reserves.No country in Africa has a significant amount of gold reserves. PLEASE HELP ME ASAPppppppp Distance between 3,-6 and -2,-5 This is an easy question pls help The sum of eleven and three times a number is equal to twenty six Which statement is false?HELP PLEASE FAST!!! An STD can make it difficult to have children in the future.Teen fathers often do not finish high school.There is no significant consequence in career and earning potential for teen fathers.Pregnancy and STDs are the most serious health consequences of sexual activity. what is the lowest possible tempature 3. Let's put the camera on this so that it won't wiggle as much!A) quadruped B) peddlerpedestrianD) tripod4. Most bicycles have two of these that make the wheels turn aroundA) pedals B) peddlersimpediments D) pedestrians5. Gerald looked through the peek hole in his front door and saw one of these holding abox of candyA) pedestrian B) millipede C) quadruped D) peddler6. Did you see Chloe's pet? It must have a thousand legs! It's one of these.A) centipede B) quadruped C) millipede D) biped7. Logan, Zack, and Ryan are smart. They always look both ways and use crosswalks.What are they?A) peddlers B) pedestrians centipedes D) quadrupeds8. Tanya jumped when she saw one of these crawling across her living room! She's sure ithad a hundred legs!A) centipede B) millipede Cbiped D) quadruped9. Although Marissa walked with a limp, she didn't let thisA) impediment B) pedestrian C) peddlerget in her wayD) pedicure10. Most of these living things walk upright rather than crawlingA) bipeds B) quadrupeds C) millipedesD) peddlers Why is cyberbullying so devastating to many people beyond just the victim? evaluate the expression (718+45)32please help 9c + 1 = 10 what is the answer the algebra way? Bonjour je suis en difficult devant a pouvez-vous maider svp