The sides of the DNA ladder consist of alternating______ and phosphates

Answers

Answer 1

Answer:

sugar

Explanation:

The sides of the stepping stool are made of rotating sugar and phosphate particles. The sugar is deoxyribose. The rungs of the stepping stool are sets of 4 sorts of nitrogen bases. Two of the bases are purines-adenine and guanine.


Related Questions

Organisms are classified into Kingdoms based upon basic characteristics. An organism has a nucleus in its cell, is multicellular, and produces its own food for energy through the process of photosynthesis.

Answers

Answer:

kingdom plantae because of process of photosynthesis

Why might parents who don't show the trait of albinism have children who do?

Answers

Answer:

This trait is rare when it occurs. Some genes depend on other genes to be expressed, so in most cases a trait is denied an expression. But its still there, so it passes down to generation until it gets expressed.

Explanation:

Answer:

Because it's a recessive trait

Explanation:

There are two chromosomes that determine your biological sex: XX for the female and XY for the male. You inherit one X chromosome from your mother and one X or Y chromosome from your father, which is what determines your sex.

A certain inheritable genetic condition can be recessive or dominant. If it's dominant, it shows even if just one chromosome carries that condition. If it's recessive, it has to be in both ones (or just the x one or just y if you're male. That's why some conditions, such as daltonism, affect men more that women).

For example, blue eyes are a recessive trait, brown eyes are a dominant trait. If your parents are both blue eyed, you will surely have blue eyes as well. The same can't be said if both of your parents have brown eyes: they might still be carrier of the blue eyed trait (both of them have to), in which case you would have a 25% chance (1/4) to have blue eyes (½ to inherit the carrier chromosome from your mother; ½ from your father). The same can be said about albinism

P S Q R The biological levels of organization range from a single organelle all the way up to the biosphere in a highly structured hierarchy. Multicellular organisms are organized from the simplest to most complex: cells, tissues, organs, organ systems, organisms. Evaluate the model above. Select ALL of the statements that accurately depict the examples shown in the model. A) R shows an animal cell. B) O shows types of tissue. P shows organs in the endocrine system. D) P shows an organ system, the digestive system. E) S shows an organ system, the digestive system.​

Answers

Answer: the red thing pretend is blood and blue thing is water you first ta

Explanation:

Answer:

A) R → Q → P → S

Explanation:

I just took the test on USA Test Prep


Commonly found fossils are of the ______ type.

A. print
B. petrified
C. carbonized

Please help, ASAP.

Answers

Answer:

C. carbonized

Explanation:

The mode of fossilization of these inclusions varies, but carbonization is most common.

Describe some of the changes in the land and in life-forms that occurred at the end of the Paleozoic Era.

Answers

during the end of the paleozoic era it was probably one of the greatest mass extinctions on earth and the land started to break up and move around to form what the world looks like today

during an experiment scientists study a portion of a gene found in the white mouse. they determined that the following sets of codons has been translated into a series of three animo acids shown below
mRNA sequence- GCA-UUA-UCG
amino acids sequince- alanine - leucine - serine
which of the following would be the expected outcome of this same set codons were to be found in humans genes
The human cell would be unable to translate the mRNA codons.

The sequence of amino acids would be completely different in the human.

The amino acid sequence would be identical in the human cell.

The human cell would be converted into a mouse cell.

Answers

Answer:

the amino a acid sequence would be  identical to human cell

becuuse the codes sequencing is simialr in all animals

Explain why only certain substrate can combine with enzymes.
Help me please​

Answers

Answer:

sry i cant i too dubm need points tho

Explanation:

Describe Why are trochophores of interest to biologists?

Answers

Answer:

Because it is also one of the larval stages in some other groups of invertebrates, and are used by biologists to deduce evolutionary relationships among different groups of invertebrates

Explanation:

hope it will help you.

The real length of one villus is 0.8 mm
Calculate the image length if the villus is viewed at a magnification of x20

magnification = size of image / size of real object

Answers

Answer:

Explanation:

Re arrange formula=Size of image=Magnification*size of real image

0.8mm*20=16mm

The image length will be "16 mm". A further explanation is below.

Given:

Magnification,

20

Size of real image,

0.8 mm

As we know the formula,

→ [tex]Magnification = \frac{Size \ of \ image}{Size \ of \ real \ image}[/tex]

or,

→ [tex]Size \ of \ image=Magnification\times Size \ of \ real\ image[/tex]

By substituting the values, we get

→                         [tex]=20\times 0.88[/tex]

→                         [tex]= 16 \ mm[/tex]  

Thus the response above is correct.

Learn more:

https://brainly.com/question/24716995

distinguish between active and passive immunity​

Answers

Answer:While active immunity occurs when an individual produces antibodies to a disease through his or her own immune system, passive immunity is provided when a person is given antibodies.

Explanation:

DNA double helix. Hydrogen bonds break and helix opens. Each strand of DNA acts as a template for synthesis of a new, complementary strand. Replication produces two identical DNA double helices, each with one new and one old strand.

Answers

Answer:

The process described above is known as DNA replication.

Hope this helps you! Have an amazing day!

Consider the following chemical reaction: Hb + O2 → HbO2 When this reaction is going from right to left, what process is occurring?

O a. oxygen unloading

O b. cellular respiration

O c. pulmonary ventilation

O d.oxygen loading

Answers

Answer: A, Oxygen Unloading

Describe how Mendel performed his pea plant experiments.

Answers

Answer:

Every offspring does not look alike they change with the generations

Explanation:

What type of graph is used for a PH test

Answers

Explain why a line graph is used for the pH data. Line graphs are utilized when data is continuous. It’s either a line graph or bar graph but usually line graph

5 5. Normally, the temperature inside the scrotum is slightly lower than normal body temperature. What do you predict would happen if the temperature inside the scrotum were a few degrees higher than normal body temperature instead? A. Sperm would not be able to travel through the vas deferens. B. Sperm would be stored in the epididymis rather than in the testes. c. Sperm would not be able to develop properly. D. The rate of sperm production would increase,​

Answers

Answer:

C. Sperm would not be able to develop properly.

Explanation:

There is an optimum temperature where sperm production is at its best. An increase or decrease in temperature may affect the quality and quantity of the sperm.

If the temperature inside the "sc-rotum" raises by few degree than normal body temperature, than the "sp-erm" would not be able to develop properly.

What is the function of "sc-rotum"?

A pouch, which is suspended from the groin, and comprising the "tes-tes" and some of the male "s-ex" accessory ducts is known as the "sc-rotum". The prime function of the "sc-rotum" is to maintain the temperature essential for the process of "sper-matogenesis", that is, by situating the testes external of the body cavity.

Within the human "sc-rotum", the temperature is 3.1 degree C lesser than the usual temperature of the body. In case, if the temperature elevates of the "sc-rotum", the degeneration of the germinal epithelium will take place, which will eventually result in sterility. Therefore, for the production of sperms within the testes, a lower temperature is needed, otherwise the development of the "sp-erm" will not take place appropriately.

Thus, the correct answer is option C.

Find out more information about the function of "sc-rotum" here:

https://brainly.com/question/940283

help please 30 points will give brainliest
Plants release the waste ___________ during cellular respiration and ____________ during photosynthesis.

fill in the blanks

Answers

Plants release the waste carbon dioxide during cellular respiration and oxygen during photosynthesis.

The behavior of an organism is influenced by both internal and external factors. How might a bear be influenced by external factors in its environment? A. A decrease in the number of fish causes bears to start consuming more plants. B. An increase in hunting causes bears to stay in covered areas and avoid humans. C. A decrease in temperature causes bears to look for food during the day instead of at night. D. all of these

Answers

Answer:

D. all of these

Explanation:

I just got it right in study island (:

Answer:

it's D

Explanation:

In the 1860s Gregor Mendel performed numerous dihybrid crosses between pea plants. Dihybrid crosses involve the study of the inheritance patterns related to two different traits. In guinea pigs the allele for black fur (B) is dominant over the allele for brown fur (b), and the allele for short fur (F) is dominant over the allele for long fur (f). What percentage of the offspring from a BbFf x bbff cross would be expected to be heterozygous for both traits

Answers

Answer:

25% of the progeny is expected to be dihybrid, BbFf, expressing Black and short fur

Explanation:

Available data:

the allele for black fur (B) is dominant over the allele for brown fur (b)the allele for short fur (F) is dominant over the allele for long fur (f)Cross: BbFf x bbff

Parentals)            BbFf      x         bbff

Phenotypes) Black/Short    Brown/Long

Gametes)       BF, Bf, bF, bf      bf, bf, bf, bf

Punnett square)      BF         Bf          bF          bf

                      bf    BbFf     Bbff       bbFf       bbff

                      bf    BbFf     Bbff       bbFf       bbff

                      bf    BbFf     Bbff       bbFf       bbff

                      bf    BbFf     Bbff       bbFf       bbff

F1) 4/16 = 1/4 = 25% of the progeny is expected to be dihybrid, BbFf, expressing Black and short fur

    4/16 = 1/4 = 25% of the progeny is expected to be bbFf, expressing Brown and short fur

    4/16 = 1/4 = 25% of the progeny is expected to be Bbff, expressing Black and long fur

    4/16 = 1/4 = 25% of the progeny is expected to be bbff, expressing Brown and Long fur

Answer:

25%

Explanation:

Because i took the test

3. In the image, which letter represents the enzyme?
a. Letter A
b. Letter B
c. Letter C
d. Letter D

Answers

Answer: The answer is C

Explanation:

The correct option is, (c) Letter C.

What is the enzyme?Proteins called enzymes assist our bodies' chemical reactions move forward more quickly. For several processes, including digestion and liver function, enzymes are crucial. Health issues might result from having too much or too little of a specific enzyme. Healthcare professionals can also use the enzymes in our blood to look for injuries and illnesses.

How do you classify enzymes?

According to the sort of process they catalyze, enzymes are divided into six categories:

Oxidoreductases. Transferases.Hydrolases.Lyases.Ligases.Isomerases.

What are the 7 enzymes?Depending on the type of reaction they catalyze, enzymes can be divided into seven different types. These groups include hydrolases, lyases, isomerases, ligases, translocases, oxidoreductases, transferases, and hydrolases.

What is enzyme structure?Proteins called enzymes are made up of amino acids connected by one or more polypeptide chains. The fundamental structure of a polypeptide chain refers to this arrangement of amino acids. This in turn dictates the enzyme's three-dimensional structure, including the active site's shape.

Learn more about enzyme here:

https://brainly.com/question/1596855

#SPJ2

Which of the following is NOT an example of a biotic factor in an ecosystem?
F.
Grasses
G.
Bacteria
H.
Beetle
J. Water

Answers

the answer is h. beetle

which are examples of steroids? A. testosterone and trans fats B. cholesterol and phospholipids C. cholesterol and vitamin D D. estrogen and phospholipids

Answers

Answer:

A

Explanation:

because it really is suppose. to make u more stronger tougher and high testosterone.

state the taxonomic family to which the virus that causes EVD belongs​

Answers

Ebolavirus, genus of viruses in the family Filoviridae, certain members of which are particularly fatal in humans and nonhuman primates. In humans, ebolaviruses are responsible for Ebola virus disease (EVD), an illness characterized primarily by fever, rash, vomiting, diarrhea, and hemorrhaging.

15. Cells found in plants and animals have similarities but can differ in function. Consider the following two organisms: a corn plant cell (Zea mays) and a camel cell (Bactrianus ferus). What is the best explanation for the difference in the cellular vacuole size between these two biotic organisms?

A. The corn cells' have a small vacuole size because it does not need long term water and
electrolyte storage.

B. The camel cells' have a small vacuole size because it does not need long term water and electrolyte storage.

C. The camel cells' have a small vacuole size because it is not in contact with toxins that need to be removed from the cell.

D. The corn cells' have a large vacuole size because it is in contact with many toxins in the soil which need to be removed from the cell.

Answers

The best explanation for the difference in the cellular vacuole size is option d. The corn cells' have a large vacuole size.

Explanation to the difference in the cellular vacuole size:

When there is the difference in the vacuole size that lies between the two biotic organism so it is due to the corn cells that contain high vacuole since they are in contact with various toxins in the soil that need to be eliminated from the cell.

hence, the correct option is d.

And, the rest of the options are wrong.

Learn more about cell here: https://brainly.com/question/14568392

3) identify and describe three abiotic characteristics of ecosystems. Give an example of how each

characteristic could be affected by a human activity

Answers

Answer:

The abiotic characteristics of an ecosystem that affects man includes: Land surface, rainfall and relative humidity.

Explanation:

In the ecosystem, man occupies the terrestrial habitat which is affected by the abiotic factors listed above.

Abiotic (non- living) factors determine the type of biotic (living) community that is found in an ecosystem. These factors include Land surface, rainfall and relative humidity, just to mention a few.

--> LAND SURFACE: This is responsible for the marked variation in the vegetation of a place. For example, a mountain in the tropics may have a rain forest vegetation at it's base and an afroalpine vegetation near its peak. The gradient of the slope affects the growth of organisms. A steep slope encourage fast run - off of water and therefore encourages erosion, which results in shallow and infertile soil. This in turn AFFECT man's farming activities as there would be little to no crop yield.

--> RAINFALL: Water is a very important abiotic factor that affects life. The main source of water to terrestrial habitat is rainfall. When rain falls, a greater percentage of it sinks into the soil while the rest run- off into water bodies. Water is absorbed by root hairs into the plant and used for photosynthesis to produce food. The absence of rainfall in the environment of man could lead to drought which AFFECTS man negatively.

--> RELATIVE HUMIDITY: This is a measure of the amount of moisture in the atmosphere. It's usually high in hot wet regions. It affects the rate at which water evaporates from the body surfaces of organisms. Low relative humidity cause more water (sweat) to evaporate from body surfaces giving the human body a cooling effect. But in high relative humidity, the sweat cannot evaporate leaving the body feeling hot and sticky. This AFFECTS man as the body tries to cool off in a harder way by increasing rate of respiration and depth of blood circulation.

What nitrogen base does Cytosine pair with

Answers

Answer:

Guanine

Explanation:

There are four nitrogenous bases in DNA, two purines (adenine and guanine) and two pyrimidines (cytosine and thymine)

Adenine always bonds with thymine, and cytosine always bonds with guanine.

Explain how organisms in both of the ecosystems are dependent on their environmental interactions with other living things and with nonliving factors.

Answers

Answer:

Explanation:Organisms, and populations of organisms, are dependent on their environmental interactions both with other living things and with nonliving factors. ... Mutually beneficial interactions, in contrast, may become so interdependent that each organism requires the other for survival.

The organism that considered for an ecosystem that should be dependent on the environmental interactions should be explained below,

Environmental interactions:

The organism and the organism population should be based on the environmental interactions along with the other living things also even with the non-living things of factors.

On the other hand, Mutually beneficial interactions should be considered as the independent where each and every organism should needed other for the survival purpose.

learn more about an organism here: https://brainly.com/question/18167856

Determine the mRNA and amino acid sequence for the below DNA sequence.

Answers

AUGAGCCCCGCUAGGUUCUC

The shark still has identical skeleton to previous sharks. What other way can you prove evolution occurred if fossil evidence does not show any?

Answers

There is biogeography comparative and anatomy and comparative embryology and molecular biology

identify the function of the vacuole. what is the funtion of the vacuole. please explain​

Answers

food vacuole or granule:- used to contain food for digestion .

contractile vacuole :- used to remove excess water.

follow me .....☺️☺️☺️nice study

Answer:

vacuole store water nutrients and other materials and in plants support the cell structure.

Explanation:

A one-hectare forest community is sampled in early August. The sample yields 12 small trees, 4 types of vines, as well as 17 native shrubs that represent 10 species. What can be estimated from the sample for the shrubs in the forest community?

A. the forest’s productivity

B. the species richness

C. the degree of forest disturbance

D. the stability of the ecosystem

E. the uniformity of species distribution in the ecosystem

Answers

Answer:

The correct answer is - B. the species richness

Explanation:

Species richness determines the numbers of different species are present in an ecological community. It is a numerical value or count of different species present in a particular community.

The given information or data can only be used to estimate the species richness in the particular forest community as there is data available about the number of species presnt in this community.

Other Questions
Find the total surface area of the rectangular prism You can tell from her (accent/ascent/assent) that she is from Texas. The men were (all ready/already) exhausted from the battle.Colonel Travis ordered his troops to (cease/seize) firing The hopelessness of the situation does not (distract/detract) from the Texans' bravery. By the end of the battle, hundreds lay (deceased diseased) on the ground. Santa Anna's army used ladders in their (accent/ascent/assent) of the Alamo's walls. The Mexican general tried to illicit/elicit) a surrender from the defenders. The reinforcements arrived (latter/later) than expected. The soldiers were (all ready/already) for the attack. Travis worried about the civilians in the Alamo, but they did not (distract/defract) him from his goal. Santa Anna's army tried to (cease/seize) the Alamo by force. This is the equation: f(x)=x^2e) Is f(x) symmetric? If so, what is the equation of the line of symmetry?f) Does f(x) have a maximum or minimum? If so, at what point?g) What are the x-intercept(s) of f(x)? The economy of the United States can be best described asa) a mixed economyb) a command economyc) a mixed economy, but predominantly command and traditiond)a pure free marker Can you please help me Melanie took two identical thermometers, one with its bulb painted black and the other with its bulb painted white. She kept a lighted lamp at equal distance from the two thermometers.Which thermometer will show a higher temperature after an hour? Thermometer with black bulb, because black reflects less heat than white Thermometer with black bulb, because black absorbs less heat than white Thermometer with white bulb, because black reflects more heat than white Thermometer with white bulb, because black absorbs more heat than white What fuel does a main-sequence star use for nuclear fusion?oxygen (0)petroleumhelium (He)hydrogen (H) Please help I'm not sure what the answers are HELP ME PLEASE https://brainly.com/question/22734415Im gonnna fail :( what is a scienctific theory If you have 35 moles of sodium hydroxide (NaOH) in a 5000 mL solution, what is the concentration of the NaOH in the solution? Which statement best describes the relationship between the war during 1941 and 1944 Why would people object to the death penalty?New Jersey abolishes the death penalty 3(6x-5)-7(3x+10)=0. solve for x Which statements describe important characteristics of the growth of monarchies in Europe during the late Middle Ages?Choose all answers that are correct. Rulers made laws for their subjects and set up courts to keep the laws.Nobles who could gain control of a large territory formed councils to share power with local lords.Castles throughout the countryside were torn down to make way for modern palaces.Conquering rulers seized land from nobles and gave it to those who would swear allegiance to them as king.Some rulers raised armies to conquer larger territories and defend their borders. Convert 5.7108 to its expanded form. sorry guys im not good with math so i need halp ^_^ if a person takes a jump which is half a feet and then gets tired so he takes another jump which is half if the first jump and he takes another jump which is half of the second jump and so on how many jumps will it take the person to reach the distance of 1 foot NOTE:=NO NONSENSE ANSWERS OR YOU WILL GET REPORTED if there are any doubts about this question you can comment them down below and please read the question carefully ANSWER ONLY IF YOU ARE SHURE 2/5 of 16 simplify if you can thank you Is DNA replication always a foolproof process? Explain your answer. please can you help me with this