Please help me!!!!!!!!!

Please Help Me!!!!!!!!!

Answers

Answer 1

Answer:

y=25x+1150

Step-by-step explanation:

1425-1275=150

150/6=25 so 25 dollars per month

1275-5(25)

1275-125=1150

y=25x+1150


Related Questions

LAST ATTEMPT IM MARKING AS BRAINLIEST!! (Graph the image of the figure using the dilation given)

Answers

Answer:

[tex]I(-2,0) \to\\ I \ ' \ (-0.5,0)\\\\J(3,2) \to\\ J \ ' \ (0.75,0.5)\\\\K(1,-1) \to\\ K \ ' \ (0.25,-0.25)\\\\[/tex]

==================================================

Explanation:

For each point, multiply each x,y coordinate by 0.25 (the scale factor) to dilate the preimage to the image. This will shrink the image because the positive scale factor is less than 1.

So for instance, point J(3,2) will have this scratch work

3*(0.25) = 0.752*(0.25) = 0.5

meaning J(3,2) moves to J ' (0.75, 0.5)

----------

Side notes:

0.25 = 1/40.5 = 2/4 = 1/20.75 = 3/4this trick only works if the center of dilation is the origin

A shipping container will be used to transport several 60-kilogram crates across the country by rail. The greatest weight that can be loaded into the container is 26000 kilograms. Other shipments weighing 13200 kilograms have already been loaded into the container. What is the greatest number of 60-kilogram crates that can be loaded into the shipping container?

Answers

Answer:

213 crates

Step-by-step explanation:

There is enough space for 26000 kg - 13200 kg = 12800 kg. Divide this by 60 and you get 213 and 1/3. You cannot put 1/3 of a crate, so it is 213 crates.

Helpppo for an exammmm

Answers

Answer:

AAS

Step-by-step explanation:

The area of each square tile is square feet and the area of each triangular tile is square foot.

We will pour sand into each frame to a depth of foot.

image placeholder
ft
Complete the sentence with the amount of sand we will need for each tile.​

We will need

ft of sand for each square tile, and

ft of sand for each triangular tile.

Answers

Answer

hi

Step-by-step explanation:

ok


give a pair of alternate interior angles, a pair of corresponding angles and a pair of alternate exterior angles.

Answers

alternate interior: 6&3
corresponding: 5&7
alternate exterior: 8&1

The length of a rectangular garden is 3 feet more than 2 times the width. The perimeter of the garden is 48 feet. Find the length and width of the garden .

Answers

Answer:

  length 17 feet

  width 7 feet

Step-by-step explanation:

Let w represent the width. Then the length is 2w+3, and the perimeter is ...

  P = 2(L +W)

  48 = 2((2w+3) +w) = 6w +6

  42 = 6w

  7 = w . . . . . . . . width

  (2w+3) = 17 . . . length

The length of the garden is 17 feet; its width is 7 feet.

HELPPP!! DUE NOWWWW!

Lucy recently joined a fitness club, she had to pay an initial fee to join. Lucy will also pay an extra fee per class she takes there. The equation below represents the relationship.


f(x)=20+3x


Identify the false statement


A. Lucy paid $3 per class.

B. f(x) represents the total amount Lucy paid.

C. x represents the cost of classes.

D. The initial fee was $20

Answers

Answer: C

Step-by-step explanation: x represents the number of classes, not the cost of classes.

Select the correct answer from each drop-down menu.
what is 1 plus 1

Answers

one plus one equals 2 let me know if you need more help

Antonio wants to examine the sales in a restaurant during a period of time from 2 hours before to 2 hours after the peak dinner time and graph his results. If the peak dinner time is considered to be at 6 p.m., what would be the domain for the graph Antonio is creating?

Answers

Using function concepts, it is found that the domain of the graph Antonio is creating would be: [tex]4 \leq x \leq 8[/tex]

The domain of a function is the set that contains all possible input values.

In this problem, the inputs are the time, between 2 hours before and 2 hours after the peak time of 6 pm, hence, it is given by: [tex]4 \leq x \leq 8[/tex]

For more on the domain of functions, you can check https://brainly.com/question/24374080

Manny borrowed $800 at 10% annual interest. How much interest did he owe in one year?

Answers

Answer:

80

Step-by-step explanation:

Find the perimeter of the figure. Use 3.14 for 7 and round to at least 1 decimal place.

Answers

Answer:

the perimeter of the figure is 27.4 mi

Step-by-step explanation:

rectangle perimeter = 6+6+6 = 18

half circle perimeter = 1/2 2πr = 3.14 × 3 = 9.42

the perimeter of the figure is 18+9.42 = 27.42 --> 27.4 mi

heeeeeeeeeeeeeeeeeeeelp me plssssssssssss

Answers

Answer:

Yep linear functions look like diagonal lines. Vertical lines have a slope of 0 whilst horizontal lines aren’t even defined. Diagonal and horizontal don’t work since horizontal aren’t defined so if one doesn’t work then it won’t work.

So (a) is the answer

Diagonal lines are linear functions

Answer:

Diagonal lines........

-6x+6y=9 (1/2,2) please helppppp

Answers

Answer:

A. Solution

General Formulas and Concepts:

Pre-Algebra

Order of Operations: BPEMDAS

Brackets Parenthesis Exponents Multiplication Division Addition Subtraction Left to Right

Algebra I

Coordinate Planes

Coordinates (x, y)

Step-by-step explanation:

*Note:

A coordinate is a solution if both the left side and right side of the equation is equal.

Step 1: Define

Identify.

-6x + 6y = 9

(1/2, 2)

Step 2: Verify

Substitute in variables [Equation]:                                                                   -6(1/2) + 6(2) = 9[Order of Operations] Evaluate:                                                                      9 = 9

Since 9 does indeed equal 9, the coordinate (1/2, 2) is a solution.

which holds the more capacity 0.75 litres or 350ml

Answers

Answer:

0.75 liters

Step-by-step explanation:

1000ml in 1 liter so 0.75*1000=750ml

750ml > 350ml

1038*472 please help

Answers

Answer:

443,226

Step-by-step explanation:

9. The length of a rectangle is 3 cm longer than twice the width. If the area of the rectangle is 65 cm2,
find its length and the width.

Answers

Answer:

  length: 13 cm

  width: 5 cm

Step-by-step explanation:

You may be aware that 65 = 5×13. We note that 13 is 3 more than twice 5, so these are the dimensions of the rectangle:

  5 cm wide; 13 cm long

__

If you want so solve this algebraically, you can let w represent the width. Then the length is 2w+3 and the area is ...

  A = LW

  65 = (2w+3)(w)

In standard form, this equation is ...

  2w^2 +3w -65 = 0

To factor this, you look for factors of 2×(-65) = -130 that have a sum of 3. Those would be ...

  -130 = (-10)(13)

Then the factored equation is ...

  2w^2 +13w -10w -65 = 0

  w(2w+13) -5(2w+13) = 0

  (w -5)(2w +13) = 0   ⇒   w = 5, -13/2

The positive solution makes sense in this problem, so ...

  width = 5 cm

  length = 2(5) +3 = 13 cm

you walk 3/4 miles to a grocery store. Then you walk another 1/5 miles to a shoe store. How many miles have you walked in all?

Answers

Answer:

19/20 miles

Step-by-step explanation:

3/4 + 1/5

3/4 = 0.75

1/5 = 0.2

3/4 + 1/5

= 0.75 + 0.2

= 0.95

= 95/100

= 19/20

Therefore,

the miles you have walked in all is 19/20.

Can someone help me? Will mark brainiest :)

Answers

the anser is 2 cuz i sad so, and i was droped don te stars as a lil kid ÆÆÆÆÆÆÆÆÆÆÆÆÆÆÆÆÆ

Help me please I don’t know what to don

Answers

The mistake was in the distributive property
4y-(5-9y) =4y-5-9y

It should’ve been 4y-5+9y

Helpppppppp me …………………..

Answers

Answer:

first let's solve for x

x + (x + 30) + 2x = 180

4x + 30 = 180

-30          -30

4x = 150

/4      /4

x = 37.5

Now solve for the angle measures:

(x + 30)    =    (37.5 + 30) = 67.5

2x       =        2(37.5) = 75

x = 37.5

Answer:

X= 37.5

Step-by-step explanation:

Solve for X
5x-8 Answer is not 4.5 or 9/2

Answers

Answer:

[tex]{ \rm{5x - 8 < x + 10}} \\ \\ { \rm{5x - x < 10 + 8}} \\ \\ { \rm{4x < 18}} \\ \\ { \rm{x < 4.5}}[/tex]

Solving for x in the inequality gives us;

x < 4.5

Inequality

We are given the inequality;

5x - 8 < x + 10

The first step is to use addition property of equality to add 8 to both sides;

5x - 8 + 8 < x + 10 + 8

5x < x + 18

Use subtraction property of equality to subtract x from both sides to get;

5x - x < x + 18 - x

4x < 18

Using division property of equality, we have;

x < 18/4

x < 4.5

Read more on inequalities at; https://brainly.com/question/25275758

GEOMETRY MULTIPLE CHOICE

Answers

Answer:

E seems to be the only one that is true

Step-by-step explanation:

its just asking you basically which ones are true based on the info they already give you

I do believe the Answer is E

If sinA=1/7, sinB=1/3.
Prove: cos2A=sin4A​

Answers

Answer:

Question!! What is the relationship between A and B?

Step-by-step explanation:

6. Rachael is married with 2 dependents. Her salary as a dental hygienist is $47,650 paid
in 26 pay periods. Find the state tax withheld per pay period.

Answers

Answer:1.2389 million US$

Step-by-step explanation:

Please help me solve this math problem

Answers

Answer:

 (b)

Step-by-step explanation:

A suitable calculator or spreadsheet can find the matrix product for you. Here, the answer choices differ in their upper left term, so we can determine the correct choice by finding the value of that term. It is the dot product of the first row of B and the first column of A.

  (5)(3) +(7)(3) +(3)(2) = 15 +21 +6 = 42

This matches choice B.

pls help me anymore pls​

Answers

Answer:

thanks for the points again

Step-by-step explanation:

,(TT(TT)(TT)(TT)(TT)(TT)(TT

The diagram shows the distance between my home, H. and two towns, A and B.

It also shows information about journey times.

What is the average speed of the journey from my home to town A?

Answers

I do not know English :33333

Draw two lines with a slope of 1 / 2. What do you notice about the lines?

Answers

Answer:

The lines would be parallel.

Step-by-step explanation:

lines with the same slope are parallel.

The lines 1/2 should be parallel lines :)

PLEASE HELP ILL GIVE BRAINLIESTTTT

Answers

Answer:

f(-4a) = -16a + 8

Step-by-step explanation:

Substitute -4a into the equation

4x(-4a) + 8 = -16a +8

First guy is right!!

write an expression to represent admission to a zoo of $10.00 and the cost of special exhibits s at $4 each. Evaluate you expression when s=2

Answers

Answer:

10.00 +4s .

u wanted expression ,  not answer.?

Step-by-step explanation:

Other Questions
A garden hose shoots water horizontally from the top of a tall building toward the wall of a second building 20 meters away. If the speed with which the water leaves the hose is 5 m/sec, how long does it take the water to reach the second building, and what distance does the water fall in this time? Understand how to work with negative bases and negative exponents.5^2 = 5^-2 = (-5)^2 = - 5^2 = (Remember to find the base, then multiply.) Does anyone know the answer for this question? I really need it. ______ is an example of a TCS food.A whole watermelonChickenBreadUncooked (dry) rice A piecewise function is represented by the graph below.On a coordinate plane, a piecewise function has 2 lines. The first line is made up of 2 lines. One line goes from (negative 5, 3) to (negative 1, negative 1) and then goes up to a closed circle at (1, 1). The second line has an open circle at (1, 2) and then continues up through (3, 4).What is the domain for the piece of the function represented by f(x) = x + 1?x < 11 x 11 x < 2x > 1 Termina cada conversacin para indicar que la segunda persona est de acuerdo con la primera. 8. Carolina: A m no me gusta limpiar (to clean) la casa. Miguel: A m ____________________________. Immersive Reader(1 Point)tambientampoco Exam GuidelinesExam InstructionsQuestion 4 of 20:Select the best answer for the question.4. Which of the following statements about writing introductions and conclusions is true?O A. Always write the body paragraphs and the conclusion before going back to write the introduction.B. If you have trouble beginning with the introduction, write the body paragraphs first.C. If you're writing a research paper, you don't need an introduction or a conclusion.D. Always write the introduction first and the conclusion last.Mark for review (Will be highlighted on the review page)> Is this statement true or false?Impressionist paintings by John Twachtman depict a moment in time.truefalse What happend when matter condenses??Plzz Answer??? Is this table proportional?XY1 3 34 125 157 21 Your engineering department is asked to evaluate the performance of a new 370-hp sports car. You know that 27% of the engine's power can be converted to mechanical energy of the 1200-kg car, and that the power delivered is independent of the car's velocity. What do you report for the time it will take to accelerate from rest to 60 mi/h on a level road? A geriatric team wants to involve the patients family in his or her care. When is the best time to invite the family to become part of the team?not at allbefore the patients procedureafter the patients dischargeat the very beginning 3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts): Type of mutation ( 3pts): 4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTAATTATTACGTGCTGCTATCGCT 5' Type of mutation ( 3pts) : Amino acid ( 3pts): Type of mutation ( 3pts): Which one is correct Which of the following lines of a dialogue is most appropriate for a naturalist play A. Where are we going? What's happening? B. Does thou require a repast this morn?C. Hark, what light younder window breaks?D. Whither are we bond? At optimum light intensity, which atmospheric gas most directly influences the rate of photosynthesis? * Jamal has a plan to save money for a trip. Today, Jamal deposits $8.00 into the savings account. Each week, Jamal will add $5.00 to the amount that is deposited into the savings account. The table below shows the relationship between the number of weeks and how much money, in dollars, Jamal deposits into the savings account. Week 0 1 2 3 4 Deposit (Dollars) 8 13 18 23 28 Let f(x) represent the amount of money Jamal deposits into saving account at the end of x weeks. Based on the table, what is f(8)? Which details should you look for in determining the setting of a story? Check all that apply. the storys time period where the author lives the characters environment how long the story is where the story takes place As a missionary, where did you spend most of your time?A) at a churchB) in the fieldsC) in CaliforniaD) at a mission Por que tenen que dar el motivo de viaje?Los agentes quieren visitar los pasajeros en su hotelLos agentes can la informacin a los pasajerosLos pasajeros necesitan poner el motivo en el pasaporteLos pasajeros no pueden pasar por la aduana sin la informacin