Answer:
1.
The independent variable is the type of food available.
2.
The dependent variable is the frequency of each type of beak (or number of birds with each beak type).
Explanation:
ong
What are the advantages and disadvantages of a honey bees sexual reproduction
Answer:I just learned this.
Explanation: The Advantage is that they have plant pollination and honey.
How many chlorine atoms are there in the molecule NiCl2
Answer:
2, that’s what the 2 means.
Explanation:
⦁ In what stage of an animal’s life cycle do most cells differentiate?
Answer:
Reproduction
Explanation:
Answer:
Animals and plants produced by sexual reproduction begin life as a single cell, a fertilised egg or zygote . These cells must divide by mitosis to produce a multicellular organism.
how do gray whales migrate?
Answer: Grey whales travel 12,000 miles round-trip from their feeding grounds in the Arctic to calve and breed in the Baja lagoons, and then back again.
Explanation:
Which is required for sexual reproduction
Answer:
meiosis
Explanation:
meiosis is used to produce gametes for sexual reproduction
Answer:
Meiosis, and female and male
Explanation:
Sexual reproduction is a reproduction that requires a male and a female of the same species to contribute genetic material. Special cells called gametes are produced through meiosis, which halves the number of chromosomes in each resulting cell. These cells are called haploid gametes.
How could one determine if two
unidentified organisms share a common
ancestor?
Answer:
Evolutionists determine that two organisms have a common ancestor is by looking at fossil evidence in different rock layers using the law of Superposition (Oldest layers are on the bottom, newest are on the top) and compare the skulls or other bones to each other in order of oldest to newest (or newest to oldest). Another way to determine this is to examine the amount of DNA a certain species shares with another species. An example of this would be that Humans share roughly 90% of our DNA with chimpanzees or the other Great Apes.
Explanation:
DNA
They can look at the DNA it's the most common one.
There are 4 pieces of evolution and they are
Fossils , Geography , Embryos / DNA , Anatomy
Fossils: Physical remains of species , Determine age, location, environment
Deeper layers = older
Geography: Proves species share common ancestors, depending on where
they live
DNA: BEST evidence because it’s the MOST ACCURATE
Similarities in the early stages of development
Similarities in DNA
More similarities = closely related
More differences = not related
Anatomy: Compare body parts of different species to see how they evolved
3 different structures:
Homologous (same structure, different function)
Analogous (similar structure, different organisms)
Vestigial (body parts that no longer serve a purpose)
All of that are in evolution
Hope it helped! ( Gave u my biology notes :D)
What are 3 lines of evidence that corroborate the theory of evolution?
Answer:
Lines of Evidence supporting theory of evolution by natural selection: Fossil evidence, Biographical evidence and Anatomical evidence.
Explanation:
I majored in Biology
A molecule of oxygen gas contains two:
O molecules
O elements
O atoms
Answer:
O atoms
Explanation:
:)))
A molecule of oxygen gas contains two atoms of oxygen bonded together.
Answer: your answer will be C
Which ecosystem most likely has the greatest biological diversity and therefore the highest sustainability A. A tank that includes several goldfish B. Tundra region that has many penguins C. A pine tree in which three groups of birds live D. A rainforest that has many different types of plants and animals
Answer:
definitely D because a rainforest is extremely vast when it comes to different species
Explanation:
brainliest plz?
The ecosystem which is most likely has the greatest biological diversity and therefore the highest sustainability is a rainforest that has many types of plants and animals. Therefore, the correct option is D.
What is ecosystem?An ecosystem refers to the biological community where the biotic as well as the abiotic components interact with each other and influence each other.
It encompasses all the living organisms in a specific area as well as physical and chemical factors that shape their environment such as air water soil climate and environment. They play an important role in functioning the earth's biosphere, as they provide a range of essential services.
The study of ecosystem and interaction between is components is referred to as ecology. Hence, the correct option is D.
For more details regarding ecosystem, visit:
https://brainly.com/question/15011558
#SPJ6
What is mass transport across the cell membrane
Answer this please I promise 30 points + mark as brainliest ( only relevant answers )
Answer:
A) Group X = Rose ,mango tree,marigold,palm tree
B) This is the answer of group X =Rose ,mango
This is the answer of group Y =Fern ,pine trees
Explanation:
Answer:
jen, from my heart im saying i lu.v u for real
its been almost 5 months weren't having the same old c.hat we used to have.
ik that ur scared to c.hat with me since the day ur mom caught u
but still the old memories keep coming into me how many times i try to forget u, i still lu.v u jen still lu.v u
and as i made u a promise that one day we'll meet, i still keep thqat word and that day even if its just one day, we're gonna enjoy the max we could
i'll be waiting for that moment and i hope u would be too...
still lu.v u :( .......
Atmospheric nitrogen, in its gaseous form, is useful to plants. *
True
False
Answer:
true
Explanation:
Answer:
False.
Explanation:
Atmospheric Nitrogen, in its gaseous form, is harmful to Plants and Animals.
Have a great day! (:
What is the function of a phospholipid bilayer
Answer:
Phospholipid bilayers create a selectively permeable barrier to the movement of ions and molecules important for cellular function.
Answer: The phospholipid bilayer acts as a barrier to the passage of molecules.
Which of the following solutions is neutral?
Group of answer choices
a solution with a pH of 14
a solution with a pH of 2
a solution with a pH of 7
a solution with a pH of 9
Flag this Question
Question 4
Potassium hydroxide has the chemical formula KOH. It feels slippery and is used in cleaning liquids. Based on this description, potassium hydroxide is most likely a(n)?
Group of answer choices
acid
base
neutral solution
pH indicator
first to answer gets the brinllest
Answer:
Kleenex
ekekkdkdkeeee
please answer asap! anatomy final exam!! thanks:)
Describe what lymph is and how it travels throughout the body. What would happen if the lymphatic system did not drain interstitial fluid from the body?
Answer:
A fluid that flows through the lymphatic system is called lymph. it travels when you breathe and move your muscles the lymph continuously get pushed towards the heart from the outer reaches of your body. if the lymphatic system didn't drain interstitial fluid then the lymph fluid would build up in the body's tissues, making them swell.
Are gender traits completely a result of societal expectations?
Answer:
No. Gender traits in humans are largely determined by biophysical processes. There seems to be a vocal political faction that is trying to convince people in the name of liberty and equality that gender traits are completely learned, and therefore arbitrary. But this claim disagrees with scientific evidence. In general, boys play more with cars and girls play more with dolls not because their parents are perpetuating outdated gender stereotypes, but because their brain is telling them to. This fact does not mean that boys have to play with boy toys, or that boys who play with dolls aren't really boys. It is just a scientific observation about average behavior and its link to fetal development.
What happens to the cells at the edges of an injury when a cut in the skin or a break in a
bone occurs?
Explanation:
[tex]\huge{\underbrace{\overbrace{\mathfrak{\blue{Answer:}}}}}[/tex]
When an injury such as a cut in the skin or a break in a bone occurs, cells at the edges of the injury are stimulated to divide rapidly. This action produces new cells, starting the process of healing.
How does the size of a bacterial cell compare with an animal cell?
Answer:
hope it helped
Explanation:
Bacterial cells are very small - about 10 times smaller than most plant and animal cells. Most bacterial cells range in size from 0.2 to 10 microns or micrometers (0.0000079 to 0.00039 inches). ... One reason why bacterial cells are so small is that they need a large surface area to cell volume to take in nutrients.
PLEASE HELP ME - In 1839, Schleiden and Schwann began formulating a theory of cells and their role in living organisms. Over time, cell theory has been updated. Modern theory is summarized below. All known living things are made up of cells. The cell is the structural and functional unit of all living things. All cells come from pre-existing cells by division. The flow of energy occurs within cells. Cell theory explains all of the following except a. the growth of animals. b. how viruses require the cells of living organisms to survive. c. how bacteria reproduce. d. the storage of chemical energy in plant cells.
Thank You so Much
your amazing have a great life
Which model below shows a prokaryotic cells?
Answer:
Modle two as it is singular, simple with a flagellum
Explanation:
(GIVING BRAINLIEST!!)
James made the following table to compare the common characteristics of planets. Which of the following would best replace X?
A) Asteroids
B) Comets
C) Moons
D) Stars
Answer: moons
Explanation:
Mars and Neptune both have moons
Answer:
hi answer is moons
Explanation:they have moons :)
A _______________ from the sun hits chlorophyll and excites an electron, known as __________________________________.
Answer:
Photon, light dependent reaction of photosynthesis
Explanation:
Photosynthesis is the process by which green plants make their own food in the presence of sunlight and water.
There are two steps of Photosynthesis that include light dependent reaction and light-independent reaction.
In light dependent reaction, a photon from the sun is absorbed by the green pigment in leaves called chlorophyll that allow the electron to excite from ground energy level to high energy level. It converts the solar energy into chemical energy and called light dependent reaction of photosynthesis.
Hence, the correct answer is "Photon, light dependent reaction of photosynthesis".
What is the difference between a detritivore and a decomposer?
A.While detritivores consume animals, decomposers only consume plants.
B. While detritivores feed on dead organic matter, decomposers actually break down dead or decaying organisms.
C. While detritivores consume both plants and animals, decomposers only consume dead animals.
D. While detritivores are heterotrophic, decomposers are autotrophic.
Detritivores are organisms that feed on the organic waste of dead plants and animals
What are decomposers?Decomposers are organisms that break down dead or decaying organisms; they carry out decomposition, a process possible by only certain kingdoms, such as fungi. Decomposers are the organisms that decompose dead plants and animals.
Difference between detrivores and decomposersOption C is the the correct answer
While detritivores consume both plants and animals, decomposers only consume dead animals.
Read more about organisms
https://brainly.com/question/25832580
Answer:
While detritivores feed on dead organic matter, decomposers actually break down dead or decaying organisms.
Explanation:
The answer explains itself. It is accurate information. :) Have a good day!
According to Vince Carter, "...the most important aspect of getting his degree was the sense of accomplishment it brought. " Use information from the selection and your own ideas to explain what he meant by this statement.
Answer:
the hard work he went through
which describes a eukaryotic cell,but not a prokaryotic cell?
As scientists advise about potential risks due to climate change, many coastal areas are preparing for a higher risk of impact Predict
which of these has a greater impact on human health in coastal areas due to climate change.
Since the coast water is rising,it would be hard to find fresh water. The people would not be able to use the water,because it would be contaminated with bacteria. If all of the ice does melt,most of the fresh water will turn to salt water,and we would have to adapt to a new way of life. People would have to live on higher land,there would be no one to grow crops,and their would be no way that trees would survive,meaning we would not be able to breathe.The worst part of this all is that the Earth's temperature will sky rocket,and it will be so hot,the Earth will kinda be like a huge hurricane.(lol)
Hope this helped and good luck!
-Nea
Answer:
C. Increased severity of tropical storms
Explanation:
Due to increased water temp and increased evaporation
1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG
mRNA:
Codon:
Anticodon:
Amino Acids:
What two elements of weather are affected by air masses
Answer:
The air masses separated by a front usually differ in temperature and humidity. Cold fronts may feature narrow bands of thunderstorms and severe weather, and may on occasion be preceded by squall lines or dry lines. Warm fronts are usually preceded by stratiform precipitation and fog.
PLEASEE help me answer this question!??
Answer:
a or b.
Explanation:
it can be in ts regular form solid or it just formed like a liquid
Answer:
B. liquid I think.
Explanation:
or solid bc coal is a solid.
thats all i got.
Fossil remains of Glossopteris (an extinct plant with large leaves) have been discovered in India and Australia. When they were living, all the Glossopteris were located together on land, but now the Glossopteris fossils are separated by an ocean. What could explain how these fossils got so far apart?
Answer:
Due to splitting of lands.
Explanation:
These Glossopteris fossils got so far apart from each other because of the splitting of super continent about 175 million years ago. Before 175 million years, India and Australia are attached to each other and these Glossopteris plants are present on these lands but with the passage of time, the lands of India and Australia split and go far away from each other so due to splitting of lands, these fossils got so far apart from each other.