In this lab, you will simulate birds with three
different beaks. After watching the birds feed, you
will remove fruit to simulate a change in the
environment. What question are you answering by
doing this observation? Write it by filling in the
blanks below.
What is the effect of

on..

Answers

Answer 1
By looking at how the birds interact with fruits in different environment, you can determine where birds are from, what beaks specialize in eating what kind of food, and how those traits came to be (Darwinism)
Answer 2

Answer:

1.

The independent variable is the type of food available.

2.

The dependent variable is the frequency of each type of beak (or number of birds with each beak type).

Explanation:

ong


Related Questions

What are the advantages and disadvantages of a honey bees sexual reproduction

Answers

Answer:I just learned this.

Explanation: The Advantage is that they have plant pollination and honey.

How many chlorine atoms are there in the molecule NiCl2

Answers

Answer:

2, that’s what the 2 means.

Explanation:

⦁ In what stage of an animal’s life cycle do most cells differentiate?

Answers

Answer:

Reproduction

Explanation:

Answer:

Animals and plants produced by sexual reproduction begin life as a single cell, a fertilised egg or zygote . These cells must divide by mitosis to produce a multicellular organism.

how do gray whales migrate?

Answers

Answer:  Grey whales travel 12,000 miles round-trip from their feeding grounds in the Arctic to calve and breed in the Baja lagoons, and then back again.

Explanation:

Which is required for sexual reproduction

Answers

Answer:

meiosis

Explanation:

meiosis is used to produce gametes for sexual reproduction

Answer:

Meiosis, and female and male

Explanation:

Sexual reproduction is a reproduction that requires a male and a female of the same species to contribute genetic material. Special cells called gametes are produced through meiosis, which halves the number of chromosomes in each resulting cell. These cells are called haploid gametes.

How could one determine if two
unidentified organisms share a common
ancestor?

Answers

Answer:

Evolutionists determine that two organisms have a common ancestor is by looking at fossil evidence in different rock layers using the law of Superposition (Oldest layers are on the bottom, newest are on the top) and compare the skulls or other bones to each other in order of oldest to newest (or newest to oldest). Another way to determine this is to examine the amount of DNA a certain species shares with another species. An example of this would be that Humans share roughly 90% of our DNA with chimpanzees or the other Great Apes.

Explanation:

DNA

They can look at the DNA it's the most common one.

There are 4 pieces of evolution and they are

Fossils , Geography , Embryos / DNA , Anatomy

Fossils: Physical remains of species , Determine age, location,  environment

Deeper layers = older

Geography: Proves species share common  ancestors, depending on where

they live

DNA: BEST evidence because it’s the  MOST ACCURATE

Similarities in the early stages of  development

Similarities in DNA

More similarities = closely related

More differences = not related

Anatomy: Compare body parts of different  species to see how they evolved

3 different structures:

Homologous (same structure,  different function)

Analogous (similar structure,  different organisms)

Vestigial (body parts that no  longer serve a purpose)

All of that are in evolution

Hope it helped! ( Gave u my biology notes :D)

What are 3 lines of evidence that corroborate the theory of evolution?

Answers

Answer:

Lines of Evidence supporting theory of evolution by natural selection: Fossil evidence, Biographical evidence and Anatomical evidence.

Explanation:

I majored in Biology

A molecule of oxygen gas contains two:
O molecules
O elements
O atoms

Answers

Answer:

O atoms

Explanation:

:)))

A molecule of oxygen gas contains two atoms of oxygen bonded together.

Answer: your answer will be C

Which ecosystem most likely has the greatest biological diversity and therefore the highest sustainability A. A tank that includes several goldfish B. Tundra region that has many penguins C. A pine tree in which three groups of birds live D. A rainforest that has many different types of plants and animals

Answers

Answer:

definitely D because a rainforest is extremely vast when it comes to different species

Explanation:

brainliest plz?

The ecosystem which is most likely has the greatest biological diversity and therefore the highest sustainability is a rainforest that has many types of plants and animals. Therefore, the correct option is D.

What is ecosystem?

An ecosystem refers to the biological community where the biotic as well as the abiotic components interact with each other and influence each other.

It encompasses all the living organisms in a specific area as well as physical and chemical factors that shape their environment such as air water soil climate and environment. They play an important role in functioning the earth's biosphere, as they provide a range of essential services.

The study of ecosystem and interaction between is components is referred to as ecology. Hence, the correct option is D.

For more details regarding ecosystem, visit:

https://brainly.com/question/15011558

#SPJ6

What is mass transport across the cell membrane

Answers

Diffusion through a permeable membrane moves a substance from an area of high concentration (extracellular fluid, in this case) down its concentration gradient (into the cytoplasm). The passive forms of transport, diffusion and osmosis, move materials of small molecular weight across membranes.

Answer this please I promise 30 points + mark as brainliest ( only relevant answers )

Answers

Answer:

A) Group X = Rose ,mango tree,marigold,palm tree

B) This is the answer of group X =Rose ,mango

This is the answer of group Y =Fern ,pine trees

Explanation:

Answer:

jen, from my heart im saying i lu.v u for real

its been almost 5 months weren't having the same old c.hat we used to have.

ik that ur scared to c.hat with  me since the day ur mom caught u

but still the old memories keep coming into me how many times i try to forget u, i still lu.v u jen still lu.v u

and as i made u a promise that one day we'll meet, i still keep thqat word and that day even if its just one day, we're gonna enjoy the max we could

i'll be waiting for that moment and i hope u would be too...

still lu.v u :(  .......

Atmospheric nitrogen, in its gaseous form, is useful to plants. *
True
False

Answers

Answer:

true

Explanation:

Answer:

False.

Explanation:

Atmospheric Nitrogen, in its gaseous form, is harmful to Plants and Animals.

Have a great day! (:

What is the function of a phospholipid bilayer

Answers

Answer:

Phospholipid bilayers create a selectively permeable barrier to the movement of ions and molecules important for cellular function.

Answer: The phospholipid bilayer acts as a barrier to the passage of molecules.

Which of the following solutions is neutral?


Group of answer choices


a solution with a pH of 14


a solution with a pH of 2


a solution with a pH of 7


a solution with a pH of 9


Flag this Question

Question 4

Potassium hydroxide has the chemical formula KOH. It feels slippery and is used in cleaning liquids. Based on this description, potassium hydroxide is most likely a(n)?


Group of answer choices


acid


base


neutral solution


pH indicator








first to answer gets the brinllest

Answers

Answer:

Kleenex

ekekkdkdkeeee

please answer asap! anatomy final exam!! thanks:)
Describe what lymph is and how it travels throughout the body. What would happen if the lymphatic system did not drain interstitial fluid from the body?

Answers

Answer:

A fluid that flows through the lymphatic system is called lymph. it travels when you breathe and move your muscles the lymph continuously get pushed towards the heart from the outer reaches of your body. if the lymphatic system didn't drain interstitial fluid then the lymph fluid would build up in the body's tissues, making them swell.

Are gender traits completely a result of societal expectations?

Answers

Answer:

No. Gender traits in humans are largely determined by biophysical processes. There seems to be a vocal political faction that is trying to convince people in the name of liberty and equality that gender traits are completely learned, and therefore arbitrary. But this claim disagrees with scientific evidence. In general, boys play more with cars and girls play more with dolls not because their parents are perpetuating outdated gender stereotypes, but because their brain is telling them to. This fact does not mean that boys have to play with boy toys, or that boys who play with dolls aren't really boys. It is just a scientific observation about average behavior and its link to fetal development.

What happens to the cells at the edges of an injury when a cut in the skin or a break in a
bone occurs?

Answers

Explanation:

[tex]\huge{\underbrace{\overbrace{\mathfrak{\blue{Answer:}}}}}[/tex]

When an injury such as a cut in the skin or a break in a bone occurs, cells at the edges of the injury are stimulated to divide rapidly. This action produces new cells, starting the process of healing.

How does the size of a bacterial cell compare with an animal cell?

Answers

Answer:

hope it helped

Explanation:

Bacterial cells are very small - about 10 times smaller than most plant and animal cells. Most bacterial cells range in size from 0.2 to 10 microns or micrometers (0.0000079 to 0.00039 inches). ... One reason why bacterial cells are so small is that they need a large surface area to cell volume to take in nutrients.

PLEASE HELP ME - In 1839, Schleiden and Schwann began formulating a theory of cells and their role in living organisms. Over time, cell theory has been updated. Modern theory is summarized below. All known living things are made up of cells. The cell is the structural and functional unit of all living things. All cells come from pre-existing cells by division. The flow of energy occurs within cells. Cell theory explains all of the following except a. the growth of animals. b. how viruses require the cells of living organisms to survive. c. how bacteria reproduce. d. the storage of chemical energy in plant cells.​

Answers

It made it possible to actually see cells. Explanation: With the development and improvement of the light microscope, the theory created by Sir Robert Hooke that organisms would be made of cells was confirmed as scientist were able to actually see cells in tissues placed under the microscope.

Thank You so Much

your amazing have a great life

Which model below shows a prokaryotic cells?

Answers

Answer:

Modle two as it is singular, simple with a flagellum

Explanation:

(GIVING BRAINLIEST!!)


James made the following table to compare the common characteristics of planets. Which of the following would best replace X?


A) Asteroids

B) Comets

C) Moons

D) Stars

Answers

Answer: moons

Explanation:

Mars and Neptune both have moons

Answer:

hi answer is moons

Explanation:they have moons :)

A _______________ from the sun hits chlorophyll and excites an electron, known as __________________________________.

Answers

Answer:

Photon, light dependent reaction of photosynthesis

Explanation:

Photosynthesis is the process by which green plants make their own food in the presence of sunlight and water.

There are two steps of Photosynthesis that include light dependent reaction and light-independent reaction.

In light dependent reaction, a photon from the sun is absorbed by the green pigment in leaves called chlorophyll that allow the electron to excite from ground energy level to high energy level. It converts the solar energy into chemical energy and called light dependent reaction of photosynthesis.

Hence, the correct answer is "Photon, light dependent reaction of photosynthesis".

What is the difference between a detritivore and a decomposer?
A.While detritivores consume animals, decomposers only consume plants.
B. While detritivores feed on dead organic matter, decomposers actually break down dead or decaying organisms.
C. While detritivores consume both plants and animals, decomposers only consume dead animals.
D. While detritivores are heterotrophic, decomposers are autotrophic.

Answers

What are detrivores?

Detritivores are organisms that feed on the organic waste of dead plants and animals

What are decomposers?

Decomposers are organisms that break down dead or decaying organisms; they carry out decomposition, a process possible by only certain kingdoms, such as fungi. Decomposers are the organisms that decompose dead plants and animals.

Difference between detrivores and decomposers

Option C is the the correct answer

While detritivores consume both plants and animals, decomposers only consume dead animals.

Read more about organisms

https://brainly.com/question/25832580

Answer:

While detritivores feed on dead organic matter, decomposers actually break down dead or decaying organisms.

Explanation:

The answer explains itself. It is accurate information. :) Have a good day!

According to Vince Carter, "...the most important aspect of getting his degree was the sense of accomplishment it brought. " Use information from the selection and your own ideas to explain what he meant by this statement.

Answers

Answer:

the hard work he went through

which describes a eukaryotic cell,but not a prokaryotic cell?

Answers

Answer is c it is surrounded by cell membrane

As scientists advise about potential risks due to climate change, many coastal areas are preparing for a higher risk of impact Predict
which of these has a greater impact on human health in coastal areas due to climate change.

Answers

Since the coast water is rising,it would be hard to find fresh water. The people would not be able to use the water,because it would be contaminated with bacteria. If all of the ice does melt,most of the fresh water will turn to salt water,and we would have to adapt to a new way of life. People would have to live on higher land,there would be no one to grow crops,and their would be no way that trees would survive,meaning we would not be able to breathe.The worst part of this all is that the Earth's temperature will sky rocket,and it will be so hot,the Earth will kinda be like a huge hurricane.(lol)

Hope this helped and good luck!

-Nea

Answer:

C.  Increased severity of tropical storms

Explanation:

Due to increased water temp and increased evaporation

1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG
mRNA:
Codon:
Anticodon:
Amino Acids:

Answers

Answer:
mRNA: UAUGCUUUAGCGCUAGCGCCGCUAAGCC

CODONS: AUG-GAA-AUG

AMINO ACIDS: METHIONINE-LEUCINE


Explanation: hope this helps
i am so confused is this an actual question or is it just random letters?-

What two elements of weather are affected by air masses

Answers

Answer:

The air masses separated by a front usually differ in temperature and humidity. Cold fronts may feature narrow bands of thunderstorms and severe weather, and may on occasion be preceded by squall lines or dry lines. Warm fronts are usually preceded by stratiform precipitation and fog.

Cold fronts and warm fronts

PLEASEE help me answer this question!??

Answers

Answer:

a or b.

Explanation:

it can be in ts regular form solid or it just formed like a liquid

Answer:

B. liquid I think.

Explanation:

or solid bc coal is a solid.

thats all i got.

Fossil remains of Glossopteris (an extinct plant with large leaves) have been discovered in India and Australia. When they were living, all the Glossopteris were located together on land, but now the Glossopteris fossils are separated by an ocean. What could explain how these fossils got so far apart?

Answers

Answer:

Due to splitting of lands.

Explanation:

These Glossopteris fossils got so far apart from each other because of the splitting of super continent about 175 million years ago. Before 175 million years, India and Australia are attached to each other and these Glossopteris plants are present on these lands but with the passage of time, the lands of India and Australia split and go far away from each other so due to splitting of lands, these fossils got so far apart from each other.

Other Questions
Choose the correct description of the pattern below. Then find the next 3 number4 6 9 13.5Each number is 1.5 times the previous numberEach number is 2/3 of the next numberEach number is 3/2 of the previous numberWritten as decimals the next 3 numbers are PlS HELP! 1. What is the pH range for an acid?A. 0 - 7- 142. What is the pH range for a baseA. 0 - 7- 143. What are the products of an acid base reaction?A. water and saltB. acid and baseC. water and sugarD. water4. What substance has a neutral pH?A. ammoniaB. waterC. sodium bicarbonateD. vinegar5. The negative ion found in bases is the ______________A. hydrogen ion (H+)B. hydroxide ion (OH-) Which faith is the dominant religion in Europe today? The American National Park System why did the number of parks increase so much after 1915 A student was asked the following question on her biology final exam question : how do organisms grow in size her answer : organisms grow in size when the cells within the organism grow larger. As the cells grow larger the organism grows larger as wellExplain why her answer is not correct then explain how she should have answered the question 7. Before entering Mitosis what most important feature happens Find the missing angle. What is the value of the expression -48 (-4) What is the most likely reason the author ends the article with the quote from Michael Berenbaum? Plz help!! Photography assignment!!! Answer as many as you can!!!!Answer the following question in complete sentences describing technology and photography.What have been three technological changes to photography in the last 200 years?How has technology affected the way that you produce art like photographs?Are you able to create photographs differently than 100 years ago? Why or why not?How can the changes in technology inspire your practice of photography?How do you use technology to improve your art, such as photographs? The narrative voice in this passage shows that SqueakyA.has little respect for people she thinks are shallow.B.thinks Mary Louise is a worse friend than Gretchen.C.is upset that Gretchen and Mary Louise are unkind.D.believes that talking to people is a waste of time. What is the effect of the exposition on "President Cleveland, Where Are You?"?It describes Jerry's intense interest in collecting cowboy cards.It provides detailed background information about the people in Jerry's family. It is the point when Jerry begins to consider other people's needs before his own.It explains how Rollie Tremaine helps Jerry do something kind for Armand. list one part of the cell theory in your own words, explain what it means 3. "God hath power to create or destroy, make or unmake, at his pleasure; to givelife or send death; to judge...and to be judged (by) none...And the like power havekings;..."Which idea is described by this passage?1. theory of divine right2. enlightened despotism3. Social Darwinism4. constitutional monarchy Find the request values Geometry What are the three main classifications that describe galaxies? By what one visiblecharacteristic do scientists categorize galaxies? 1. Grace rode her bike 5 miles in 20 minutes. At this rate, how many miles can she ride her bike in 30 minutes? *plz help and explain 2. Of the 50 players in a school band, 12% play a woodwind instrument. How many players play a woodwind instrument? * Both different questions The Pythagorean theorem biological macromolecules are organized into four main categories. What type of macromolecule contains phosphorus as part of a phosphate group? 1.) lipids 2.) proteins3.) nucleic acid4.) carbohydrates 7 + x/5 = -4What is x?