One part of the cell theory is that pre-existing cells can form more cells
This means that cells that currently exist are capable of creating more cells, however it’s a slow process
A molecule of oxygen gas contains two:
O molecules
O elements
O atoms
Answer:
O atoms
Explanation:
:)))
A molecule of oxygen gas contains two atoms of oxygen bonded together.
Answer: your answer will be C
how does the respiratory and digestive system work together to maintain homeostasis
The respiratory system brings oxygen into the lungs when you breathe. The digestive system breaks food down into nutrients such as glucose. Now the circulatory system enters the picture. It transports glucose and other nutrients from the digestive system to the cells.
HOPE IT HLPS UH WELL✌✌Substances containing mercury would be classified as
Answer:
Toxic waste
Explanation:
Toxic waste are chemical substances which are poisonous, can cause cancer, can cause birth defects and may lead death or severe ailment. Toxic waste can lead to poisoning occurs when ingested, inhaled, or absorbed by the skin.
Examples of toxic wastes are Lead-Acid Battery, Mercury (mercury pollution), Pesticides Pollution, Arsenic in Ground Water etc.
Mercury vapors can cause neurological and behavioral disorders like tremors, emotional instability, insomnia, memory loss and so on.
1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG
mRNA:
Codon:
Anticodon:
Amino Acids:
Answer this please I promise 30 points + mark as brainliest ( only relevant answers )
Answer:
A) Group X = Rose ,mango tree,marigold,palm tree
B) This is the answer of group X =Rose ,mango
This is the answer of group Y =Fern ,pine trees
Explanation:
Answer:
jen, from my heart im saying i lu.v u for real
its been almost 5 months weren't having the same old c.hat we used to have.
ik that ur scared to c.hat with me since the day ur mom caught u
but still the old memories keep coming into me how many times i try to forget u, i still lu.v u jen still lu.v u
and as i made u a promise that one day we'll meet, i still keep thqat word and that day even if its just one day, we're gonna enjoy the max we could
i'll be waiting for that moment and i hope u would be too...
still lu.v u :( .......
How does the size of a bacterial cell compare with an animal cell?
Answer:
hope it helped
Explanation:
Bacterial cells are very small - about 10 times smaller than most plant and animal cells. Most bacterial cells range in size from 0.2 to 10 microns or micrometers (0.0000079 to 0.00039 inches). ... One reason why bacterial cells are so small is that they need a large surface area to cell volume to take in nutrients.
Can someone please helpppppo I’ll mark the brainliest
Answer:
C [the third one btw]
Explanation:
He believed that evolution gradually [slowly] happened over time.
Hope this helps :D Have a great day
PLEASE HELP ME - In 1839, Schleiden and Schwann began formulating a theory of cells and their role in living organisms. Over time, cell theory has been updated. Modern theory is summarized below. All known living things are made up of cells. The cell is the structural and functional unit of all living things. All cells come from pre-existing cells by division. The flow of energy occurs within cells. Cell theory explains all of the following except a. the growth of animals. b. how viruses require the cells of living organisms to survive. c. how bacteria reproduce. d. the storage of chemical energy in plant cells.
Thank You so Much
your amazing have a great life
how do vital signs allow medical professionals to assess a patient's physiology and overall health
they measure the pulse rate and blood pressure of a patient, these can help to determine if a patient has any diseases of the blood or if they are under stress.
Are gender traits completely a result of societal expectations?
Answer:
No. Gender traits in humans are largely determined by biophysical processes. There seems to be a vocal political faction that is trying to convince people in the name of liberty and equality that gender traits are completely learned, and therefore arbitrary. But this claim disagrees with scientific evidence. In general, boys play more with cars and girls play more with dolls not because their parents are perpetuating outdated gender stereotypes, but because their brain is telling them to. This fact does not mean that boys have to play with boy toys, or that boys who play with dolls aren't really boys. It is just a scientific observation about average behavior and its link to fetal development.
correct order of events during the process of nucleosynthesis?
Answer:
hydrogen nucleus formed, isotope of hydrogen, tritium formed, helium nucleus formed
Explanation:
Answer:
A
Explanation:
took the quiz
What is the phase change from gas to liquid?
A. Sublimation
B. Condensation
C. Vaporization
D. Transpiration
Answer:
Condensation
Explanation:
Condensation is the phase change from gas to liquid. For example, water vapor condenses when you are taking a shower because wet spots show up on a mirror after taking a shower.
Answer:
Condensation
Explanation:
Sublimation is when a solid turns into a gas. Condensation is when water in the air collects to form droplets that gather on a surface/object. Vaporization is when a liquid forms into a gas. Transpiration is a thing in plants where water transfers throughout the plant.
1. Carbon is a very important element in biology. What are some of the reasons that organisms need carbon? please help me
Answer:
"All living orgasms contain carbon and all virtual molecules in the body contain carbon, sugar, DNA, proteins, Fats..."
Explanation:
Hope this helps :)
How could one determine if two
unidentified organisms share a common
ancestor?
Answer:
Evolutionists determine that two organisms have a common ancestor is by looking at fossil evidence in different rock layers using the law of Superposition (Oldest layers are on the bottom, newest are on the top) and compare the skulls or other bones to each other in order of oldest to newest (or newest to oldest). Another way to determine this is to examine the amount of DNA a certain species shares with another species. An example of this would be that Humans share roughly 90% of our DNA with chimpanzees or the other Great Apes.
Explanation:
DNA
They can look at the DNA it's the most common one.
There are 4 pieces of evolution and they are
Fossils , Geography , Embryos / DNA , Anatomy
Fossils: Physical remains of species , Determine age, location, environment
Deeper layers = older
Geography: Proves species share common ancestors, depending on where
they live
DNA: BEST evidence because it’s the MOST ACCURATE
Similarities in the early stages of development
Similarities in DNA
More similarities = closely related
More differences = not related
Anatomy: Compare body parts of different species to see how they evolved
3 different structures:
Homologous (same structure, different function)
Analogous (similar structure, different organisms)
Vestigial (body parts that no longer serve a purpose)
All of that are in evolution
Hope it helped! ( Gave u my biology notes :D)
The formation of an ionic bond involves the
Select one:
O sharing of neutrons.
sharing of protons.
transfer of neutrons
transfer of electrons
Answer: transfer of electrons
Explanation:
Please help As fast as you can!
NEED HELP WITH THESE 4 QUESTIONS WILL GIVE BRAINLIST!!!
1.What were some characteristics that the finches developed to give them an advantage in surviving?
2.How do you think that the one species of finch evolved into many different species, each with its own advantages?
3. In what ways do these advantages help the finches to survive and reproduce?
4. What might have happened if the finches didn't evolve into many different species?
Answer:
1. Because the drought reduced the number of seeds and finches with bigger beaks were able to eat the larger and harder seeds so more of them survived.
2. Summary: Changes in the size and form of the beak have enabled different species to utilize different food resources such as insects, seeds, nectar from cactus flowers as well as blood from iguanas, all driven by Darwinian selection
3. Medium ground finches with larger beaks could take advantage of alternate food
4. three species of Darwin's tree finches have been known to inhabit Floreana but no birds singing that song on Floreana have been heard in many years.
Explanation:
What biotic factors might affect a population of fish? Check ALL that apply.
predators
prey
light
bacteria
Answer:
Explanation: Abiotic factors for fish is water, temperature, amount of dissolved oxygen in water, etc. Penetration of sunlight is also important in fresh water habitat. Biotic factors are predators, disease causing organisms, organisms available as food, population density of competitors, etc.
Explanation:
True or false: recycling can positively impact Earth's spheres.
Answer:
true
Explanation:
Answer:
True
Explanation:
Recycling provides big benefits to the planet's atmosphere by reducing overall materials consumption. ... The more we recycle, the more we reduce the impacts of global warming on the earth's climate. Animal Safety. Ocean-dwelling animals are threatened by the large amounts of plastic trash dumped into the seas every year.
When the northern hemisphere points toward the sun, the southern hemisphere faces away from the sun. In this instance, it is:
A.
summer in North America, and winter in Australia.
B.
summer in North America and Australia.
C.
winter in North America, and summer in Australia.
Answer:
A
Explanation:
the northern hemisphere is the opposite from the southern hemisphere
Since northern and southern hemisphere are in opposite directions therefore, option (A) is correct.
Why are the seasons reversed in each hemisphere?The axis of rotation of the Earth is inclined with regard to the plane in which it orbits the sun. This is the root reason of the changing of the seasons. When the axis of the earth is aligned with the sun, summer arrives in that hemisphere of the planet. Expect winter to arrive when the axis of the earth is tilted away from the sun.
Different places of Earth receive the Sun's most direct rays throughout the year. When the North Pole tilts toward the Sun, it's summer in the Northern Hemisphere. When the South Pole tilts toward the Sun, the Northern Hemisphere experiences winter.
Learn more about seasons, here:
https://brainly.com/question/12028829
#SPJ2
which layer of the earth is made out of melted metal?
The outer core. A molten nickle- iron alloy.
What happens to the cells at the edges of an injury when a cut in the skin or a break in a
bone occurs?
Explanation:
[tex]\huge{\underbrace{\overbrace{\mathfrak{\blue{Answer:}}}}}[/tex]
When an injury such as a cut in the skin or a break in a bone occurs, cells at the edges of the injury are stimulated to divide rapidly. This action produces new cells, starting the process of healing.
What are 3 lines of evidence that corroborate the theory of evolution?
Answer:
Lines of Evidence supporting theory of evolution by natural selection: Fossil evidence, Biographical evidence and Anatomical evidence.
Explanation:
I majored in Biology
When is carbon dioxide released during aerobic cellular respiration?
Answer:
I hope this helps and rate it if its right
Explanation:
I hope this helps and rate it if its right
Which are the following statements are TRUE when concerning cells?
A: Prokaryotic cells can only produce eukaryotic cells
B:All cells come from pre-existing cells
C:Cells must always reproduce with other cells
D:Plant cells can only reproduce with animal cells
Answer:
I think it will option b hope it helps
What two elements of weather are affected by air masses
Answer:
The air masses separated by a front usually differ in temperature and humidity. Cold fronts may feature narrow bands of thunderstorms and severe weather, and may on occasion be preceded by squall lines or dry lines. Warm fronts are usually preceded by stratiform precipitation and fog.
What is inheritance in biology
Answer:
passing of traits
Explanation:
Inheritance is the act of passing traits through sexual or asexual reproduction.
The division of the cytoplasm, which follows Mitosis, is called...
Answer:
Cytokinesis,
Explanation:
Cytokinesis, the division of the cytoplasm to form two new cells, overlaps with the final stages of mitosis. It may start in either anaphase or telophase, depending on the cell, and finishes shortly after telophase.
The division of the cytoplasm, which follows Mitosis, is called Cytokinesis. This is further explained below.
What is Mitosis?Generally, Mitosis is simply defined as a kind of cell division that produces two daughter cells with the same number and type of chromosomes as the parent nucleus, as seen in normal tissue growth.
In conclusion, Cytokinesis is simply defined as the division of the cytoplasm that occurs after mitosis to produce two daughter cells.
Read more about Cell
https://brainly.com/question/2622341
#SPJ2
what is reduced soil?
Answer:
A chain of reactions is initiated upon soil flooding leading to reduced (low) soil redox potential (Eh, mV) conditions. These reactions include physical, chemical and biological processes that have significant implications for wetland plants.
Pls I need answers at least one answer of any of the questions