list one part of the cell theory in your own words, explain what it means

List One Part Of The Cell Theory In Your Own Words, Explain What It Means

Answers

Answer 1

One part of the cell theory is that pre-existing cells can form more cells

This means that cells that currently exist are capable of creating more cells, however it’s a slow process


Related Questions

A molecule of oxygen gas contains two:
O molecules
O elements
O atoms

Answers

Answer:

O atoms

Explanation:

:)))

A molecule of oxygen gas contains two atoms of oxygen bonded together.

Answer: your answer will be C

how does the respiratory and digestive system work together to maintain homeostasis

Answers

You have four main types of tissues: epithelial, nervous, muscle, and connective tissue. Epithelial tissue covers the outside of the body. It also lines organs and cavities. Nervous tissue sends electrical signals. Muscle tissue helps you move. Connective tissue joins bones and cushions organs.
When groups of tissues work together, they are called organs. Some
examples of organs are the heart, lungs, skin, and stomach. When organs work together, they are called systems. For example, your heart, lungs, blood, and blood vessels work together. They make up the circulatory system.
There are eleven systems in the human body: muscular system, respiratory system, digestive system, integumentary system (skin), skeletal system, circulatory (or cardiovascular) system, excretory (or urinary) system, reproductive system, nervous system, lymphatic system, and endocrine system. Each system has a special job.
All of your body systems have to work together to keep you healthy. Your bones and muscles work together to support and move your body. Your respiratory system takes in oxygen from the air. It also gets rid of carbon dioxide.
1
2
3
4
5
6
Your digestive system absorbs water and nutrients from the food you eat.
Your circulatory system carries oxygen, water, and nutrients to cells throughout your body. Wastes from the cells are eliminated by your respiratory system, your excretory system, and your skin. Your nervous system controls all these activities with electrical impulses. If any system in your body isn't working properly, other systems are affected.
Think of your body as a building. A building has a plumbing system, a heating system, a cooling system, an electrical system, and a support system. If any system in a building breaks down, other systems can be affected.
As one example, think about a building's electrical system. Suppose a mouse chewed through an electrical wire to a furnace. Without electricity, the heating system would not work. If this happened in very cold weather, the plumbing system could be affected. Water pipes might freeze and burst. If a lot of water leaked into the building's walls, its support system would be damaged. Like a building's systems, your body's systems have to work together.
HERE IS UR ANSWER MATE!.....

The respiratory system brings oxygen into the lungs when you breathe. The digestive system breaks food down into nutrients such as glucose. Now the circulatory system enters the picture. It transports glucose and other nutrients from the digestive system to the cells.

HOPE IT HLPS UH WELL

Substances containing mercury would be classified as

Answers

Answer:

Toxic waste

Explanation:

Toxic waste are chemical substances which are poisonous, can cause cancer, can cause birth defects and may lead death or severe ailment. Toxic waste can lead to poisoning occurs when ingested, inhaled, or absorbed by the skin.

Examples of toxic wastes are Lead-Acid Battery, Mercury (mercury pollution), Pesticides Pollution, Arsenic in Ground Water etc.

Mercury vapors can cause neurological and behavioral disorders like tremors, emotional instability, insomnia, memory loss and so on.

1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG
mRNA:
Codon:
Anticodon:
Amino Acids:

Answers

Answer:
mRNA: UAUGCUUUAGCGCUAGCGCCGCUAAGCC

CODONS: AUG-GAA-AUG

AMINO ACIDS: METHIONINE-LEUCINE


Explanation: hope this helps
i am so confused is this an actual question or is it just random letters?-

Answer this please I promise 30 points + mark as brainliest ( only relevant answers )

Answers

Answer:

A) Group X = Rose ,mango tree,marigold,palm tree

B) This is the answer of group X =Rose ,mango

This is the answer of group Y =Fern ,pine trees

Explanation:

Answer:

jen, from my heart im saying i lu.v u for real

its been almost 5 months weren't having the same old c.hat we used to have.

ik that ur scared to c.hat with  me since the day ur mom caught u

but still the old memories keep coming into me how many times i try to forget u, i still lu.v u jen still lu.v u

and as i made u a promise that one day we'll meet, i still keep thqat word and that day even if its just one day, we're gonna enjoy the max we could

i'll be waiting for that moment and i hope u would be too...

still lu.v u :(  .......

How does the size of a bacterial cell compare with an animal cell?

Answers

Answer:

hope it helped

Explanation:

Bacterial cells are very small - about 10 times smaller than most plant and animal cells. Most bacterial cells range in size from 0.2 to 10 microns or micrometers (0.0000079 to 0.00039 inches). ... One reason why bacterial cells are so small is that they need a large surface area to cell volume to take in nutrients.

Can someone please helpppppo I’ll mark the brainliest

Answers

Answer:

C [the third one btw]

Explanation:

He believed that evolution gradually [slowly] happened over time.

Hope this helps :D Have a great day

PLEASE HELP ME - In 1839, Schleiden and Schwann began formulating a theory of cells and their role in living organisms. Over time, cell theory has been updated. Modern theory is summarized below. All known living things are made up of cells. The cell is the structural and functional unit of all living things. All cells come from pre-existing cells by division. The flow of energy occurs within cells. Cell theory explains all of the following except a. the growth of animals. b. how viruses require the cells of living organisms to survive. c. how bacteria reproduce. d. the storage of chemical energy in plant cells.​

Answers

It made it possible to actually see cells. Explanation: With the development and improvement of the light microscope, the theory created by Sir Robert Hooke that organisms would be made of cells was confirmed as scientist were able to actually see cells in tissues placed under the microscope.

Thank You so Much

your amazing have a great life

how do vital signs allow medical professionals to assess a patient's physiology and overall health

Answers

they measure the pulse rate and blood pressure of a patient, these can  help to determine if a patient has any diseases of the blood or if they are under stress.

Are gender traits completely a result of societal expectations?

Answers

Answer:

No. Gender traits in humans are largely determined by biophysical processes. There seems to be a vocal political faction that is trying to convince people in the name of liberty and equality that gender traits are completely learned, and therefore arbitrary. But this claim disagrees with scientific evidence. In general, boys play more with cars and girls play more with dolls not because their parents are perpetuating outdated gender stereotypes, but because their brain is telling them to. This fact does not mean that boys have to play with boy toys, or that boys who play with dolls aren't really boys. It is just a scientific observation about average behavior and its link to fetal development.

correct order of events during the process of nucleosynthesis?

Answers

Answer:

hydrogen nucleus formed, isotope of hydrogen, tritium formed, helium nucleus formed

Explanation:

Answer:

A

Explanation:

took the quiz

What is the phase change from gas to liquid?
A. Sublimation
B. Condensation
C. Vaporization
D. Transpiration

Answers

Answer:

Condensation

Explanation:

Condensation is the phase change from gas to liquid. For example, water vapor condenses when you are taking a shower because wet spots show up on a mirror after taking a shower.

Answer:

Condensation

Explanation:

Sublimation is when a solid turns into a gas. Condensation is when water in the air collects to form droplets that gather on a surface/object. Vaporization is when a liquid forms into a gas. Transpiration is a thing in plants where water transfers throughout the plant.

1. Carbon is a very important element in biology. What are some of the reasons that organisms need carbon? please help me

Answers

Answer:

"All living orgasms contain carbon and all virtual molecules in the body contain carbon, sugar, DNA, proteins, Fats..."

Explanation:

Hope this helps :)

How could one determine if two
unidentified organisms share a common
ancestor?

Answers

Answer:

Evolutionists determine that two organisms have a common ancestor is by looking at fossil evidence in different rock layers using the law of Superposition (Oldest layers are on the bottom, newest are on the top) and compare the skulls or other bones to each other in order of oldest to newest (or newest to oldest). Another way to determine this is to examine the amount of DNA a certain species shares with another species. An example of this would be that Humans share roughly 90% of our DNA with chimpanzees or the other Great Apes.

Explanation:

DNA

They can look at the DNA it's the most common one.

There are 4 pieces of evolution and they are

Fossils , Geography , Embryos / DNA , Anatomy

Fossils: Physical remains of species , Determine age, location,  environment

Deeper layers = older

Geography: Proves species share common  ancestors, depending on where

they live

DNA: BEST evidence because it’s the  MOST ACCURATE

Similarities in the early stages of  development

Similarities in DNA

More similarities = closely related

More differences = not related

Anatomy: Compare body parts of different  species to see how they evolved

3 different structures:

Homologous (same structure,  different function)

Analogous (similar structure,  different organisms)

Vestigial (body parts that no  longer serve a purpose)

All of that are in evolution

Hope it helped! ( Gave u my biology notes :D)

The formation of an ionic bond involves the
Select one:
O sharing of neutrons.
sharing of protons.
transfer of neutrons
transfer of electrons

Answers

Answer: transfer of electrons

Explanation:

Please help As fast as you can!

Answers

The answer is c because boy have the same rock layer you can use they key to help you

NEED HELP WITH THESE 4 QUESTIONS WILL GIVE BRAINLIST!!!
1.What were some characteristics that the finches developed to give them an advantage in surviving?

2.How do you think that the one species of finch evolved into many different species, each with its own advantages?

3. In what ways do these advantages help the finches to survive and reproduce?

4. What might have happened if the finches didn't evolve into many different species?

Answers

Answer:

1. Because the drought reduced the number of seeds and finches with bigger beaks were able to eat the larger and harder seeds so more of them survived.

2. Summary: Changes in the size and form of the beak have enabled different species to utilize different food resources such as insects, seeds, nectar from cactus flowers as well as blood from iguanas, all driven by Darwinian selection

3.  Medium ground finches with larger beaks could take advantage of alternate food

4. three species of Darwin's tree finches have been known to inhabit Floreana  but no birds singing that song on Floreana have been heard in many years.

Explanation:

What biotic factors might affect a population of fish? Check ALL that apply.

predators
prey
light
bacteria

Answers

Answer:

Explanation: Abiotic factors for fish is water, temperature, amount of dissolved oxygen in water, etc. Penetration of sunlight is also important in fresh water habitat. Biotic factors are predators, disease causing organisms, organisms available as food, population density of competitors, etc.

Explanation:

True or false: recycling can positively impact Earth's spheres.

Answers

Answer:

true

Explanation:

Answer:

True

Explanation:

Recycling provides big benefits to the planet's atmosphere by reducing overall materials consumption. ... The more we recycle, the more we reduce the impacts of global warming on the earth's climate. Animal Safety. Ocean-dwelling animals are threatened by the large amounts of plastic trash dumped into the seas every year.

When the northern hemisphere points toward the sun, the southern hemisphere faces away from the sun. In this instance, it is:

A.
summer in North America, and winter in Australia.
B.
summer in North America and Australia.
C.
winter in North America, and summer in Australia.

Answers

Answer:

A

Explanation:

the northern hemisphere is the opposite from the southern hemisphere

Since northern and southern hemisphere are in opposite directions therefore, option (A) is correct.

Why are the seasons reversed in each hemisphere?

The axis of rotation of the Earth is inclined with regard to the plane in which it orbits the sun. This is the root reason of the changing of the seasons. When the axis of the earth is aligned with the sun, summer arrives in that hemisphere of the planet. Expect winter to arrive when the axis of the earth is tilted away from the sun.

Different places of Earth receive the Sun's most direct rays throughout the year. When the North Pole tilts toward the Sun, it's summer in the Northern Hemisphere. When the South Pole tilts toward the Sun, the Northern Hemisphere experiences winter.

Learn more about seasons, here:

https://brainly.com/question/12028829

#SPJ2

which layer of the earth is made out of melted metal?

Answers

The outer core. A molten nickle- iron alloy.

What happens to the cells at the edges of an injury when a cut in the skin or a break in a
bone occurs?

Answers

Explanation:

[tex]\huge{\underbrace{\overbrace{\mathfrak{\blue{Answer:}}}}}[/tex]

When an injury such as a cut in the skin or a break in a bone occurs, cells at the edges of the injury are stimulated to divide rapidly. This action produces new cells, starting the process of healing.

What are 3 lines of evidence that corroborate the theory of evolution?

Answers

Answer:

Lines of Evidence supporting theory of evolution by natural selection: Fossil evidence, Biographical evidence and Anatomical evidence.

Explanation:

I majored in Biology

When is carbon dioxide released during aerobic cellular respiration?

Answers

Answer:

I hope this helps and rate it if its right

Explanation:

I hope this helps and rate it if its right

Which are the following statements are TRUE when concerning cells?
A: Prokaryotic cells can only produce eukaryotic cells
B:All cells come from pre-existing cells
C:Cells must always reproduce with other cells

D:Plant cells can only reproduce with animal cells

Answers

Answer:

I think it will option b hope it helps

What two elements of weather are affected by air masses

Answers

Answer:

The air masses separated by a front usually differ in temperature and humidity. Cold fronts may feature narrow bands of thunderstorms and severe weather, and may on occasion be preceded by squall lines or dry lines. Warm fronts are usually preceded by stratiform precipitation and fog.

Cold fronts and warm fronts

What is inheritance in biology

Answers

Answer:

passing of traits

Explanation:

Inheritance is the act of passing traits through sexual or asexual reproduction.

The division of the cytoplasm, which follows Mitosis, is called...

Answers

Answer:

Cytokinesis,

Explanation:

Cytokinesis, the division of the cytoplasm to form two new cells, overlaps with the final stages of mitosis. It may start in either anaphase or telophase, depending on the cell, and finishes shortly after telophase.

The division of the cytoplasm, which follows Mitosis, is called Cytokinesis. This is further explained below.

What is Mitosis?

Generally, Mitosis is simply defined as a kind of cell division that produces two daughter cells with the same number and type of chromosomes as the parent nucleus, as seen in normal tissue growth.

In conclusion, Cytokinesis is simply defined as the division of the cytoplasm that occurs after mitosis to produce two daughter cells.

Read more about Cell

https://brainly.com/question/2622341

#SPJ2

what is reduced soil?

Answers

Answer:

A chain of reactions is initiated upon soil flooding leading to reduced (low) soil redox potential (Eh, mV) conditions. These reactions include physical, chemical and biological processes that have significant implications for wetland plants.


Physical processes include restriction of atmospheric gas diffusion in the soil leading to depletion of soil oxygen and accumulation of carbon dioxide [4,5]. ... This process leads to oxygen depletion and reduction in soil oxidation reduction potential (Eh) followed by a chain of soil chemical changes.

Pls I need answers at least one answer of any of the questions

Answers

Have you ever wondered how many times your heart beats in a day, a month, a year—or will beat in total throughout your life? Over an average lifetime, the human heart beats more than 2.5 billion times. For a person to keep their heart healthy, they should eat right, not smoke and get regular exercise. In this science activity, you'll measure your heart rate during different types of physical activities to find out which gives your heart the best workout to help keep it fit.
Background
A 150-pound adult has about 5.5 liters of blood on average, which the heart circulates about three times every minute. A person's heart is continuously beating to keep the blood circulating. Heart health experts say that the best ways to keep our hearts healthy is through a balanced diet, avoiding smoking and regular exercise.
Other Questions
Adding oil to a table would ___________ the friction when sliding a book across it.Increase or decrease Anyone know??? thank you Sketch a graph that shows therelationship between grams of honey andgrams of salt needed for a bakery recipe.Show on the graph how much honey isneeded for 70 grams of salt.salthoneyflour(c)101442535101 Add file 5.3. He left in a hurry after he got a phone call, buthe came back five minutes later.(2 Points)simplecompoundcomplexcompound-complex 2. (3.7) and (2.3) 7I WILL MARK BRAINLIEst pls HELP MEEE Describe two positive changes that came about as a result of the Great Chicago Fire. 70 POINTS Use the library and other reference materials to research the discovery of radioactivity and its current applications. Then, write a 500 word report on what you have learned. Be sure to include the contributions of French chemists Marie Curie and Pierre Curie and the medical uses of radiation. What equation is a proportion?7/9 = 21=281/3 = 1/45/8 = 20/323/4 = 6/9 PLEASE HELP I WILL GIVE YOU BRAINLIEST(the linked photo)!!! thank you Help please if I fail it I litterally fail history and I cant!!! It was the big day; Lance had been training for months in anticipation of the annual Dasher Twenty-Six-Two. As he laced up his sneakers, he thought back to the endless grind of aerobic training he had accomplished. Hour after hour of lung-burning, quad frying jogging on pavement and dirty. He was ready mentally and physically, plus he had a secret weapon ready to go. Lance had been experimenting in the use of a thick, sugar saturated gel-nutrition to supplement his running. He anticipated finishing just before the three-hour mark and he planned to eat his special goo around hour two for a much-needed energy boost. The goo solution was a mixture of maltose, sucrose, and glucose, as well as some salt. Water would be available on the course every few miles and with his nutrition plan set he found his way to the line. *BOOM*The start gun leaked smoke as wave after wave of runner set off. Miles started flowing by five miles feeling good Mile thirteen halfway there! Just as the two-hour mark was upon him, Lance pulled the gel from his pocket and slurped the gooey syrup down. Mile fifteen Phew, heavy legs Mile eighteen Legs are burning but I got it then came a hit of fatigue. He had read about this before. The dreaded bonk. Bonking was said to be the final drips of glycogen being removed from the muscles cells, with an accompanying burn suggesting rapid production of lactate. It also meant he had spent the last two hours less aerobic than he thought. Making it to mile twenty-two, Lance noticed his heart rate ten-beats over his planned pace. His breath was getting harsher, his legs getting weaker. The mile twenty-four marker went by and he was down to nearly a walk, lips dry and stomach lurching. The last half mile was a blur as Lance crossed the line his raised arms quickly fell, and so did he, right into a chair near the finish line.Discuss the necessity of Lances training to prepare for his ability to fuel a marathon with specific reference to the major organ systems involved and their purpose. Identify the needed reactants and excreted products Lance utilized during his ongoing respiring, with specific reference to where each is created or used. Finally, predict the influence of his experimental goo and suggest advantages and disadvantages to its use, as well as better use with reference to time and impact on the ability to enter and circulate to where it would be needed Please Help???LOOK AT THE PICTURES AND I NEED THE ANSWER FOR EVERY PLACE THAT HAS PTS IN IT.BRAINLESS TO WHO EVER ANSWERS. Water leaves the plant life of biosphere and enters the atmosphere by way of transpiration.TrueFalse A salesperson earns $450 per week plus 15% of her weekly sales. Theexpression representing her earnings is 450 +0.15x. Which of the followingdescribes the sales necessary for the salesperson to earn at least $600 inone week? I need help fast thank you!! que es la primera cosa que ves cuando vuelves a full casa? Bethany can mow her lamily's lawn in 4 hours. Her brother coin can mow the lawn into hoursWhich equation can veused to find the number of hours, x, it would take for Bethany and Colin to mow the lawn together? What causes the air pressure dial to move in an aneroid barometer?Group of answer choicesa Mercury inside the barometer rises and falls moving the dial according to the increase or decrease in pressure.b Weights activated by air pressure change position according to the weight of the air moving a dial on the instrument.c A spring inside the instrument, connected to a dial, moves when the air pressure contacts the spring.d A small flexible metal box expands and contracts which is connected to the instrument's dial. An investigator wishes to use animals in an experiment that involves category B, C, and D activities performed on the same animal. How should the animal be categorized if 72 is 40% what is 100%?