Help please- im still gonna keep wasting my points until someone helps i only have these 4 questions left man-

17. In Gregor Mendel's first experiment, he created a plant with purple flowers (PP , two dominant traits) with a plant with white flowers (pp , two recessive traits). What were the results of his experiment:

[tex]\left[\begin{array}{ccc}&P&P\\p&Pp&Pp\\p&Pp&Pp\end{array}\right][/tex]

a. 100% purple is your answer. Note that if there is a dominant trait, the dominant trait will show. In this case, purple is the dominant trait P, and is located on all quadrants, therefore 100% purple is your answer.

18. In Mendel's second experiment, he uses two purple flowers (Pp , one dominant, one recessive, each respectively). What were the result of his experiment:

[tex]\left[\begin{array}{ccc}&P&p\\P&PP&Pp\\p&Pp&pp\end{array}\right][/tex]

d. 75% purple, 25% white is your answer. The dominant trait P is found in three quadrants, with only the bottom right quadrant having two recessive trait p. This means that the quadrant with pp is white, and the others are purple.

19. Note that the Bob's dimples (DD) are the dominant trait, while Janet has the recessive traits (dd). Set the Punnett Square:

[tex]\left[\begin{array}{ccc}&D&D\\d&Dd&Dd\\d&Dd&Dd\end{array}\right][/tex]

d. 100%. In this case, the dominant trait shows up in all 4 quadrants, and will therefore mean that their child will have dimples. However, they will carry the recessive trait.

20. Matt and Meredith both have dominant brown eyes, but their daughter has blue eyes. This means that they both are carriers of a recessive blue strand (denoted by b.) This means that both Matt and Meredith are Bb. Set the Punnett Square:

[tex]\left[\begin{array}{ccc}&B&b\\B&BB&Bb\\b&Bb&bb\end{array}\right][/tex]

B) is your answer.

HELP! ILL GIVE BRAINLIEST

What do the following membranes surround?

Please complete the following DNA strands

1. AGGTCCAAGCTCAAATTTCCCC

2. GAAACCCCTTAAACCTTAATTCC

3. GCGCGCGCAAATTTTTCCCATCT

Please complete the following strands using RNA:

1. AGGTCCCAAAGGCCCTTTCC

2. UAAAGGGCCCAGCCCACC

3. CUAAAAGGGGGUUUUAACC

How is carbon moving between the air and found it decreasing

Explain ONE possibe advantage of vivipary when compared to
ovipary​

Be able to explain how segmentation and exoskeletons gave some animals an adaptive advantage over those that were not segmented and did not have exoskeletons.

What is the major cause of changes in gene expression?

Crossing-over and nondisjunction take place during the process of
1.mitosis
2.meiosis
3.internal fertilization
4.binary fission

Someone help please and thank you

A cell has undergone determination to become an epithelial lung cell. If it is transplanted to a leg muscle, what do you think will happen to this cell?

reproductive process of amoeba​

I'll give brainliest

Has anyone done the 4.06 Enzymes Lab?

I don't need help on the lab part just the hypothesis.

I'm terrible at writing a hypothesis.
ACCESS 2021

Would appreciate if somebody helped please.

This Is for today help!!

After the removal of the sea stars,


the number of species in the ecosystem was reduced.

the ecosystem became more diverse.

food webs in the ecosystem became more complex.

the size of the ecosystem was reduced.

What might happen to a desert biome if the area received more rain than it normally receives over an extended period of time? Describe some of the changes that you might expect to see

If there is no external force on a moving object it will

Which of the following are sites where waste products are released from the body but not where they are produced
O skin and anus
O large intestine and small intestine
O liver and kidney
O tubules and ureters

The starfish's water-vascular system is used for locomotion and capturing food. True/False

Which of the following describes positive feedback?

Select one:

A. A loss of output from the body’s receptors.

B. The response of the body to increased temperatures.

C. An event that reduces the effects of a stimulus.

D. An event that enhances the original stimulus.

The following passage explains the relationship between tectonic plates and earthquakes. Which sentence states incorrect information?


Tectonic plates can push together, pull apart, or slide past each other at their boundaries. The edges of tectonic plates are not smooth, so they create friction as they move. When friction is too great for the plates to move, they can become stuck and pressure can build up. An earthquake occurs when pressure that has built up between plates suddenly is released. The buildup of pressure that leads to earthquakes only occurs at plate boundaries.​

The living organism found within an ecosystem

Which of the following describes positive feedback?
Select one:

A. A loss of output from the body’s receptors.

B. The response of the body to increased temperatures.

C. An event that reduces the effects of a stimulus.

D. An event that enhances the original stimulus.

Sophie visited Carlsbad Caverns with her family during her summer vacation, and she was amazed at the cave’s formations. She learned that the cave was formed from minerals.

Rearrange the phrases describing one of the ways minerals form into the correct order. Place the earliest stage of mineral formation at the top. Place the final stage at the bottom. (Write 1 2 3 or 4 in order)
1. a solution forms from a liquid and dissolved substances
2. a warm solution flows through a crack in the rocks there
3. elements and compounds leave as the solution cools
4. elements and compounds crystallize
BASICALLY SAY WHICH STEPS GO FIRST IN MINERAL FORMATIONS! PLESSS

Which invertebrate from the picture did you choose from Figure 1? HINT: There is only 1 on there to choose.

Explain how body plan and anatomy enables your chosen invertebrate to perform the essential functions it needs to survive.

Which of the following substances is/are involved in
oxidative phosphorylation of cellular respiration?

Mitchell's family has the unusual trait of having an extra finger. Many members of his family were with an extra finger, which is a recessive trait. a family dinner, Mitchell's grandmother helped him sketch a pedigree of the family. Dark-shaded family members were born with an extra finger. No shading indicates people who do not have an extra finger. A question mari means it is unknown. Mitchell is #8 on the pedigree and grandmother is #2. Based on the pedigree what do you predict members number 12 number 11 and 13.

A rabbit is born with brown(g) fur. It has 9 other siblings from the same
litter, and they all have white(G) fur.
Select the True Statements.
• Brown fur is caused by a mutation
•The dominant allele is G
•The dominant allele is g
•gG is a genotype for white fur
•Brown fur is the recessive trait
•Gg is a genotype for brown fur
•The recessive allele is g
•White fur is dominant over brown fur

PLEASE HELP ME!!

A dam is built across a river to generate electricity. What is likely effect of the construction of a dam on the river?

a)increase in the size of fish in the river
b)increase in the water flow in the river
c)decrease in the population of aquatic organisms in the river
d)decrease in the amount of pollutants dumped into the river

Someone please help meee ;-;

How can you prevent oxygen toxicity?