The answer is A I believe.
Answer:
A)
Explanation:
It is a behavior that allows the gray whales migrate and survive the changes in weather conditions.
Help brainiest answer:(
Answer: if you eat it you would be eating radiation
Explanation: Common sense
which type of specialized cells would be found in an animal’s neuvous system?
The type of specialized cells would be found in an animal’s nervous system are the cells that transmit signals around the body. The correct option is D.
What is the nervous system?The nervous system is the part of an animal's body that controls behavior and sends messages to other parts of the body. It is divided into two components in vertebrates: the central nervous system (CNS) and the peripheral nervous system. The CNS houses the brain and the spinal cord.
Neurons are specialized cells found in animals. These cells are classified as sensory neurons, interneurons, or motor neurons based on their function. They transmit signals from the body to the brain and from the brain to the body parts.
Therefore, the correct option is D. Cells that can transmit signals around the body.
To learn more about the nervous system, refer to the link:
https://brainly.com/question/29355295
#SPJ2
The question is incomplete. Your most probably complete question is given below:
Cells that transport oxygen are found in the blood.
Cells that secrete hormones to trigger cellular responses.
Cells secrete enzymes to break down food.
Cells that can transmit signals around the body.
definition of compounds
Answer:
A material made up of two or more substances.
Example: H20 2 hydrogen 1 oxygen
Explanation:
Please give me BRAINLIEST and THANKS lol <(￣︶￣)>
Why does a mountain create a rain shadow on the other side of a mountain?
Answer:
I hope this will help u
Explanation:
A rain shadow is a dry region of land on the side of a mountain range that is protected from the prevailing winds. ... As the air rises up over a mountain range, the air cools, water vapor condenses, and clouds form. On this side of the mountains, called the windward side, precipitation falls in the form of rain or snow
Which of these is NOT true about vaccines?
a. they simulate a specific immune response
b. they cause memory cells to be produced
c. they contain an antigen of a weakened pathogen
d. it has been proven that there are many possible negative side-effects to being vaccinated
Answer:
I'm going to say A
Explanation:
because it just make more sense
Strands of genetic material floating in the nucleus are refered to as_____
During a hot July day, Brian and his friends play football outside. After a while, they are covered in sweat. Brian comments that sweat is just your body’s way of cooling itself. Which systems are involved in your body attempting to maintain homeostasis during high temperatures?
a. Your nervous system sends signals to your muscular system.
b. Your circulatory system gives blood to your respiratory system.
c. Your muscular system attempts to cool your skin through radiation.
d. Your excretory system attempts to cool your skin through evaporation.
Answer: B is correct I had this question too!
Similarly, the cardiovascular, integumentary (pores and skin and related structures), respiratory, and muscular structures paintings collectively assist the frame preserves a strong inner temperature. If frame temperature rises, blood vessels withinside the pores and skin dilate, permitting extra blood to waft close to the pores and skin's surface.
The temperature in the frame varies; in a frame in homeostasis (regular fitness state), the 'core' temperature is maintained inside quite a number 36-37.5.
What is Homeostasis?Homeostasis via way of means of contracting to show chemical electricity into thermal electricity if the frame is cold, it additionally facilitates to preserve homeostasis via way of means of contracting extra or much less frequently so oxygen can get to all cells from the heart.
Thus it is clear that systems are involved in your body attempting to maintain homeostasis during high temperatures your muscular system attempts to cool your skin through radiation.
To learn more about homeostasis refer to the link :
https://brainly.com/question/1046675
Which section of the article BEST explains why the development of CRISPR-Cas9 is significant for the scientific community?
Answer:
It allows the scientists to activate gene expression instead of cutting the DNA.
Explanation:
The development of CRISPR-Cas9 is significant for the scientific community because this development allows the scientists to activate gene expression instead of cutting the DNA. This technique allows the scientists and researchers to study the function of the gene. Before development, Cas9 enzymes produced by the CRISPR system binds to the DNA and cuts it by shutting the targeted gene off so this development of CRISPR-Cas9 enables the scientists to activate gene expression instead of cutting the DNA.
Would poor nutrition affect the traits or the genes of an organism?
Answer:
yes
Explanation:
PLEASE HELP
Explain what steps you could take to prepare for a career in the agricultural sciences.
Answer:
Education after high school. A bachelor's degree in agricultural science is required for jobs in research. ...
Work Experience. Previous work experience in a particular research area may be required for some jobs.
On-the-job training.
Explanation:
Have a great day!
why is it important to save energy in our daily lives
Answer:
So you can be more active and do different things that need energy
Explanation:
Having energy is an important part of daily life. Without energy, the human body would not be able to go throughout the day without being tired and without their muscles and bones hurting.
What is the Complementary strand?
Original: UACUCAGGUUCA
Complementary strand:
Answer:
AUGAGUCCAAGA
Explanation:
because adenine always pair's with thymine and cytosine with guanine. you can also remember it as Apple Tree and Car Garage.
Is this person male or female? Why?
Answer:
I can't tell you why, but I think the person is male.
3. Which of the following statements best explains how the cell membrane 1 point
is selectively permeable? *
The movement of specific substances into and out of the cell is controlled by the cell
membrane
The movement of waste substances into, but not out of the cell is controlled by the
cell membrane
The cell membrane is inflexible and cannot control the movement of substances into
and out of the cell
The cell membrane does not surround the cell so it plays no role in the movement of
substances
Answer:
The movement of specific substances into and out of the cell is controlled by the cell membrane.
Explanation:
The cell membrane is permeable, so it allows for the passage of substances both into and out of the cell. It is also selective, so only specific substances can enter and exit the cell.
At high altitudes, air is less dense than at sea level because of decreased air pressure. This means that a person who ascends to high altitudes takes in fewer oxygen molecules per breath. Describe and explain an immediate response that occurs in the circulatory system when a person first reaches high altitudes. Use vocabulary from class.
An immediate response that occurs in the circulatory system when a person first reaches high altitudes is that the heart beats faster to meet the demand for oxygen that the body needs.
What are the main effects of altitude?The higher it is, the worse the symptoms, which include
headacheshortness of breathrapid heartbeatamong othersNot everyone has these symptoms when they go to high-altitude places, but it is also not possible to know who will or will not feel something.
With this information, we can conclude that An immediate response that occurs in the circulatory system when a person first reaches high altitudes is that the heart beats faster to meet the demand for oxygen that the body needs.
Learn more about high-altitude in brainly.com/question/14756132
#SPJ2
Earth's core is the source of the energy that drives the movement of tectonic plates. Which two processes help transfer this energy outward to earth's crust?
Answer:The two processes are CONDUCTION and CONVECTION
Explanation:
The Energy produced in the Earth core is generated by Sun, gravitational force , radioactive decay, and the Earth' rotation, To maintain balance in the earth, The processes of CONDUCTION and CONVECTION transfer energy (HEAT) to Earth's interior, which also helps the movement of tectonic plates at a constant rate.
Now, inside the earth mantle is made up of hot solid rock and because Conduction occurs more in solids, Its currents helps the continuous transfer of heat energy from the warmer mantle at the bottom to the cooler mantle at the top While Convection currents in the core move thermal energy causing the rising and sinking of warm and cooler molten rock inside Earth, thereby maintaining the motion of tectonic plates and creating a balance in the earth.
Answer:
Conduction and Convection
Explanation:
The first line of defense involves which structure(s)?
T-cells
skin
blood
B-cells
Answer:
option 2, skin
Explanation:
Answer:
b skin
Explanation:
Which of the following resources are used the most in the US.
Coal
Natural Gas
Oil
Nuclear Energy
Solar
Wind
Hydropower
Geothermal
Biomass/biofuel
Which explanation is best supported by the numbers in the chart?
Lion and cheetah populations compete for the food source of zebras, and lions outcompete cheetahs.
The dwindling zebra population has led to the decline of the predator lion and cheetah populations.
Overhunting of lion and cheetah populations has led to a decline in the food source population.
Lion and cheetah populations compete for the food source of zebras, and cheetahs outcompete lions.
Answer:
The dwindling zebra population has led to the decline of the predator lion and cheetah populations.
Explanation:
The decrease in zebra population also decreases the population of the predator lion and cheetah because both predators depends on zebra for their survival. Both predators used zebra as a source of food for their growth and survival so if there is high availability of zebra so the population of Lions and cheetah also increases while on the other hand, if there is decrease in zebra population, the population of lion and cheetah also decreases because of less available food for them.
Answer:
B) The dwindling zebra population has led to the decline of the predator lion and cheetah populations.
Explanation:
2021 edge :)
Write the CODON that corresponds with each amino acid. There may be more than one. The full names are written, but the codon chart only shows the first three letters. proline ______________________ glycine ______________________ valine ______________________ phenylalanine ______________________ histidine ______________________ arginine _________________
Answer:
In protein synthesis, different mRNA codons produce different amino acids by the translation process with the help of ribosomes and tRNA. These mRNA sequences are read in sets of three which are termed as triplet codons. Specific amino acids are produced by different codons, however, more than one codons code for one amino acid. The given amino acids correspond with the following codons:
Proline: it corresponds with four codons
1. CCT
2. CCC
3. CCA
4. CCG
Glycine: it corresponds with four codons
GGT
GGC
GGA
GGG
Valine: it corresponds with four codons
GTT
GTC
GTA
GTG
Phenylalanine: it corresponds with two codons
TTT
TTC
Histidine: it corresponds with two codons
CAT
CAC
Arginine: it corresponds with six codons
CGT
CGC
CGA
CGG
AGA
AGG
how do radiation, conduction, and convection affect the atmosphere?
Answer:
Conduction, radiation and convection all play a role in moving heat between Earth's surface and the atmosphere. Since air is a poor conductor, most energy transfer by conduction occurs right near Earth's surface. Conduction directly affects air temperature only a few centimeters into the atmosphere.
Explanation:
#KEEP LEARNING
Why is it we cannot directly observe a genotype, but can sometimes infer it?
Chlorophyll is essential to photosynthesis because it traps the _______________ needed. A. oxygen B. carbon dioxide C. sunlight D. water
Answer:
sunlight
Explanation:
cawg
Answer:
C. sunlight
Have a good day
The Florida panther used to live in forests, prairies, and swamps over most of the southeastern United States. Now, it lives only in the southern tip of Florida, south of the Caloosahatchee River. Based on this information, what is the most likely cause of the decline of the Florida panther population?
Answer:
The Decline of the black panther started to decline due to habitat loss and human activity like hunting.
Explanation:
A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include
Answer: Identify the promoter and the stop signal (terminator).
Explanation:
DNA is a molecule that contains the genetic information in all living things. This information is used for the synthesis of proteins that make up the body and carry out vital functions of the organism.
The DNA molecule consists of two strands that wind around each other to form a double helix structure, where each strand has a central part formed by sugars (deoxyribose in the case of DNA) and phosphate groups. The four basic components of DNA are nucleotides: adenine (A), thymine (T), guanine (G) and cytosine (C). The nucleotides are joined together (A to T and G to C) by chemical bonds and form base pairs that connect the two strands of DNA. Depending on the sequence of nucleotides (which have different bases), different proteins are synthesized.
DNA replication consists of synthesizing another identical DNA molecule, using enzymes called polymerases, which are molecules specifically dedicated only to copy DNA. Transcription, on the other hand, is the process by which a copy of messenger RNA (mRNA) is generated from the sequence of a gene in the DNA. This RNA molecule leaves the cell nucleus and enters the cytoplasm, where it directs protein synthesis (a polymer made up of many amino acids).
Protein synthesis, or translation, involves translating the sequence of an mRNA molecule into an amino acid sequence during protein synthesis. The genetic code describes the relationship between the sequence of base pairs in a gene and the corresponding sequence of amino acids it encodes. To begin translation, a start codon (set of 3 bases) must first be identified, which is usually AUG that also codes for the amino acid methionine. Then, the codons that follow are read and the corresponding amino acids are added according to the genetic code. The transfer RNA (tRNA) is complementary to the anticodon at specific codons in the messenger RNA and carries the amino acid coding for the codon. In addition, ribosomal RNA (rRNA) is an RNA that is part of ribosomes and is essential for protein synthesis in all living things. rRNAs form the framework of ribosomes and associate with specific proteins to form ribosomal pre-subunits. To finish the translation, a termination codon has to be read, which can be UGA, UAG or UAA.
To revise the model to show transcription to form mRNA, the research should identify the promoter and the stop signal. The promoter is a DNA sequence required to turn a gene on or off. The transcription process starts at the promoter which is usually located near the beginning of a gene and has a binding site for the enzyme that is used to make a messenger RNA (mRNA) molecule. The enzyme RNA polymerase will keep doing the transcription until it reaches a sequence of DNA that is signal which indicates it should stop. This process is called termination, and it happens once the enzyme reaches this sequence, called terminator.
fill in the blanks to complete the concept map for the process of translation
Answer:RNA code for Amino Acids that make Proteins through the process of translation
Explanation:
During translation, tRNA recognizes the mRNA codons, complements them, and add the correct amino acid to the growing protein. CODON and PROTEIN are the missing words.
--------------------------------------------------------------------------
Protein synthesis
Occurs in two steps. Transcription and translation.
Transcription ⇒ mRNA syntheis
The first step before protein synthesis begins is to synthesize messenger RNA, mRNA.
This is the coping process of the DNA section for the desired protein, and it happens in the nucleus.
Translation:
⇒ Cytoplasm stage
• Translation takes place when the formed mRNA moves to the cytoplasm through the nucleus membrane pores.
• Once in the cytoplasm, mRNA meets a ribosome, which is the primary structure for protein synthesis.
• Ribosomes are organelles composed by the association of proteins with rRNA and tRNA. They can be found in the rough endoplasmic reticulum or floating in the cytosol.
• While the ribosome reads mRNA strain from its 5´ extreme to 3´, tRNA adds the correct amino acids to build the polypeptide.
→ mRNA is composed of different codons.
→ Each codon is a chort sequence of
three nucleotides that codes for one amino acid.
→ When tRNA molecules recognize these
sequencies, they add the correct amino
acid to the growing protein.
⇒ Protein synthesis ends when the proteins passes through the Endoplasmic Reticulum and the Golgi complex for their final folding process.
---------------------------------------------------------------
Related link: https://brainly.com/question/4161465?referrer=searchResults
can you please answer these questions for me I really need help I am begging you
Answer:
1: 75%
2: 75%
3: 50%
4: 25%
HELPPPPP ME PLS lol lol lol lol
Answer: 1. chemical weathering
2. mechanial weathering
3. Chemical weathering
4. I believe mechanical??
If theses are not right, I'm sorry for the wrong answers
Explanation:
Answer:
I dont even know-
Explanation:
How do dendrites help the function of nerve cells? (1 point) 0 They help the neuron receive messages from the dendrites of another neuron. They help the neuron receive messages from the axon of another neuron. They help the neuron block messages from the dendrites of another neuron. They help the neuron block messages from the axon of another neuron.
Answer:
Explanation:Dendrites are the segments of the neuron that receive stimulation in order for the cell to become active. They conduct electrical messages to the neuron cell body for the cell to function
Explanation:
?
Why do scientists carry out experiments?
A.
Because scientific knowledge is based on observations

B.
Because scientific knowledge is full of untested theories

C.
Because scientists like to control variables

D.
Because scientists like to work in labs
Answer:
A
Explanation:
the scientist always makes a hypothesis