A metric drawing scale of 1:100 typically depicts units in

Answers

Answer 1

Answer:

This usual depicts units in centi-metre

Usually Centi-(and the unit you have)

Step-by-step explanation:

Because it is 1 in 100

100 is what centi means, so centi-metre

Like centipede, an insect with 100 legs

1:100 means 1 in 100

or one centi-metre

Hope this helps!


Related Questions

HELP ASAP PLEASE THIS IS FOR ALGEBRA

1. he slope of a line through the points (-2, 4) and (6, b) is -3/2 What is the value of b?
Explain your method for calculating b.

Answers

Answer:

Step-by-step explanation:

Use the slope formula to solve this problem. Slope, usually called m, is the change in y-values over the change in x-values.

m = (y2 - y1)/(x2 -x1)

It actually doesn't matter which point is the first point and which point is the second point. But you must be consistent.

So fill in -3/2 for the m

Let your (6, b) be your (x1, y1)

Let (-2, 4) be your (x2, y2)

So, the numbers fill into the formula like so:

-3/2 = (4 - b)/ (-2 - 6)

-3/2 = (4 - b)/(-8)

Multiply -8 on both sides of the equation.

(-8)(-3/2) = 4 - b

12 = 4 - b

Subtract 4 from both sides.

Don't lose the negative in front of the b

8 = -b

Multiply or divide by -1 on both sides.

-8 = b This is the answer.

**note: Its kinda crummy to use b in this equation, because b has a special meaning when you are working with linear equations. They should have given you a different variable. b usually stands for the y-intercept but in this problem it doesn't, it's just a variable representing an unknown value.

line passes through the points (4,-2) and the slope is 5/4 write an equation in slope intercept form

Answers

Answer:

y=5/4x -7

Step-by-step explanation:

Hope this helps!

To bring a "carry-on" bag onto an airplane the bag needs to weigh less than 25 pounds. Right now Julie's carry-on bag weighs 32 pounds. How much weight must Julie remove from her bag?

Answers

My answer needs to be 32-25=7

To get to the next term in this sequence, multiply the last term by 2.5. What is the value of the next term?

1, 2.5, 6.25, 15.625, ...

HELP ASAP WILL GIVE BRAINLIEST

Answers

Answer:

39.0625

Step-by-step explanation:

15.625 times 2.5= 39.0625

You're just multiplying each value by 2.5

1 times 2.5= 2.5

2.5 times 2.5= 6.25

6.25 times 2.5= 15.625

and then 15.625 times 2.5= 39.0625

Understand how to work with negative bases and negative exponents.
5^2 =
5^-2 =
(-5)^2 =
- 5^2 =
(Remember to find the base, then multiply.)

Answers

Answer:

[tex]Understand \: how \: to \: work \: with \: negative \: bases \\ \: and \: negative \: exponents. \\

\bold{answer - } \\ {5}^{2} = 5 \times 5 = 25 \\ {5}^{ - 2} = \frac{1}{ {5}^{2} } = \frac{1}{25} = 0.04 \\ {( - 5)}^{2} = ( - 5) \times ( - 5) = 25 \\ - {5}^{2} = ( - 5) \times ( - 5) = 25 \\ \\ \bold \purple{hope \: it \: helps \: ♡}[/tex]

Jose left the airport and traveled toward the mountains. Kayla left 2.1 hours later traveling 35 mph faster in an effort to catch up to him. After 1.2 hours Kayla finally caught up. Find Jose's speed.

Answers

Answer:   20 mph

========================================================

Explanation:

x = Jose's speed in mph

x+35 = Kayla's speed since she drives 35 mph faster than Jose

Jose gets a 2.1 hour head start and it takes Kayla 1.2 hours to reach him. So this means Jose has been driving for 2.1+1.2 = 3.3 hours when Kayla reaches him. The distance he travels is

distance = rate*time

d = r*t

d = x*3.3

d = 3.3x

while Kayla's distance equation is

d = r*t

d = (x+35)*1.2

d = 1.2x+42

Since Kayla meets up with Jose at the 1.2 hour mark, this means the two distances they travel is the same. Set their distance expressions equal to one another. Solve for x.

3.3x = 1.2x+42

3.3x-1.2x = 42

2.1x = 42

x = 42/(2.1)

x = 20

Jose's speed is 20 mph, while Kayla's speed is x+35 = 20+35 = 55 mph.

Jose's fairly slow speed is probably due to a number of factors such as heavy traffic, icy roads, or poor visibility. Kayla probably got a bit of a break with more favorable conditions.

Since Jose travels at 20 mph and does so for 3.3 hours, he travels d = r*t = 20*3.3 = 66 miles. Kayla travels d = r*t = 55*1.2 = 66 miles as well. We get the same number each time to help confirm the answer.

1) f(4) = g(4)
2) f(4) = g(-2)
3) f(2) = g(-2)
4) f(-2) = g(-2)

Answers

Answer: 4)

Step-by-step explanation:

f(4) = -14

g(4) = 10

g(-2) = 4

f(2) = -8

f(-2) = 4

The correct statement is 4) f(-2) = g(-2)

Or by inspection, we can see that the graph f(x) intersects g(x) at x = -2 and    y = 4. So, f(-2) = g(-2) = 4 is true

Jamal has a plan to save money for a trip. Today, Jamal deposits $8.00 into the savings account. Each week, Jamal will add $5.00 to the amount that is deposited into the savings account. The table below shows the relationship between the number of weeks and how much money, in dollars, Jamal deposits into the savings account. Week 0 1 2 3 4 Deposit (Dollars) 8 13 18 23 28 Let f(x) represent the amount of money Jamal deposits into saving account at the end of x weeks. Based on the table, what is f(8)?

Answers

Answer:

f(8) = $48

EQUATION

f(x)= 8+5(x)

Step-by-step explanation:

initial value = $8

every week there is an additional $5 added.

f(x) = 8+5x

f(8) = 8+ 5(8) = 8 + 40 = 48.

At the end of week 8 (x=8) , Jamal has $48 (y=48) saved.

emma has 63 pencils noah has 49 penecils and michel has 77 pencils.Use the GCF and the distributive property to find the total number of pencils

Answers

Step-by-step explanation:

the greatest common factor (GCF) is 7.

it is 9×7, 7×7 and 11×7.

so the total number of pencils is

7×(9 + 7 + 11) = 7×27 = 189

SCO
Sarah put 15 gumdrops on the roof of her
gingerbread house. How many gumdrops
will she need to make 16 more houses
exactly like this one?
MY
gumdrops

Answers

Answer: 240 gumdrops

Step-by-step explanation:

1 house: 15 gumdrops

16 houses : 240 gumdrops

1 x 16 = 16

15 x 16 = 240

what is the answer i need done by midnight -15x+60<105

Answers

Answer:

[tex]x > -3[/tex]

Step-by-step explanation:

Isolate the variable. Treat the < sign like an equal sign, in that what you do to one side, you do to the other.

Do the opposite of PEMDAS. PEMDAS is the order of operations, and stands for:

Parenthesis

Exponents (& Roots)

Multiplications

Divisions

Additions

Subtractions

~

First, subtract 60 from both sides of the equation:

-15x + 60 (-60) < 105 (-60)

-15x < 45

Next, divide -15 from both sides of the equation. Note that when you multiply or divide a negative number, you must flip the sign:

(-15x)/-15 < (45)/-15

x < 45/(-15)

x > -3

[tex]x > -3[/tex] is your answer.

~

The table shows the final score of four golfers.
Golfer Final Score
Joe
-2
Allen
-5
Tara
-8
Violet
-4
Whose score was the lowest? Whose was the highest? Select your answers from the drop-down lists.
score was the lowest.
score was the highest.
Students, draw anywhere on this slide!
PER Deck eractive Skoe

Answers

highest is joe because it the most closest to 0
Lowest is Tara because it the most far from 0

Answer:

Joe score was the highest. Tara score was the lowest.

Step-by-step explanation:

State whether the system is consistent or inconsistent. If it is consistent, then state whether the graphs' equations are dependent or independent. State the number of solutions.

Answers

If a system has at least one solution, it is said to be consistent . If a consistent system has exactly one solution, it is independent . If a consistent system has an infinite number of solutions, it is dependent . When you graph the equations, both equations represent the same line.

A desk drawer is shaped like a rectangular prism. The height of the drawer is 7 inches. The bottom of the drawer has an area of 210 square inches.

What is the volume of the desk drawer?

Enter your answer in the box.

Answers

Answer:

1470 inches cubed

Step-by-step explanation:

Vol=length × width × height

But ALSO,

length × width = Area,

So we find another Volume equation,

Vol = BaseArea × height

This is the information you are given in the question.

Vol = 210 × 7

Vol = 1470 inches cubed

Four times a number is equal to the number increased by 24 find the number

Answers

Answer:

8

Step-by-step explanation:

Let the number is x.

Translate the given into equation and solve for x:

4x = x + 244x - x = 243x = 24x = 8

Which one is correct

Answers

D IS CORRECT BC 30/-2 =-15 AND WHEN U DIVIDE 30 BY A NEGATIVE NUMBER THE SIGN FLIPS THE OTHER WAY

When Hugo puts a book and a candle on a scale, the scale reads 8.705 lbs. When he removes the book, the scale reads 4.93 lbs. How much does the book weigh?

Answers

Answer:

8.705-4.93=3.775

Hope This Helps!!!

Activity 1.
Direction. Using the diagram below, form ratios. Express them in lowest term to
To form a proportion

Answers

Answer:

6:3 =2:12:2=1:16:13:24:14=2:7

Is this table proportional?
XY
1 3 3
4 12
5 15
7 21

Answers

Yes it is proportional for a table

Determine if the sequence below is arithmetic or geometric and determine the common difference/ ratio in simplest form

15, 11 ,7, …

Answers

Answer:

This is the arithmetic sequence which has a common difference that equals to -4.

Step-by-step explanation:

An arithmetic sequence is a sequence with common difference. A common difference can be found by subtracting previous term with next term.

A common difference can be expressed in [tex]\displaystyle \large{d=a_{n+1}-a_n}[/tex] where d stands for common difference.

________

Moving to the question given. We have a sequence with given 15,11,7, ... first subtract 15 with 11.

11-15 = -4

7-11 = -4

Therefore, we can conclude that the common difference is -4 thus making the given sequence an arithmetic.

Let me know if you have any question so regarding the sequence!

help me plz ineed help

Answers

Answer:

23°

Step-by-step explanation:

Opposite angles so:

60° = 2x + 14

Therefore:

x = 23°

Answer:

x is 23°

Step-by-step explanation:

those opposite angles and are always equal to each other...so to get x take 60-14 then answer divide by two

Evaluate.

(jk−1)÷j when j=−4 and k=−0.7

Enter your answer as a decimal in the box.

Answers

Answer:

(jk - 1) / j

jk = (-4 x -0.7) = 2.8

(2.8 - 1) / - 4

1.8 / -4 = -0.45

Answer is -0.45 when j = -4 and k = -0.7

Classify the Triangle by its sides and angles. 140° Right Scalene Right Isosceles Equilateral Obtuse Isosceles Acute Isosceles Obtuse scate Acute Scalene​

Answers

Answer: Obtuse Isosceles.

Explanation: Two angles are congruent, which means the triangle is isosceles. One angle is over 90°, which means the triangle is obtuse.

What is an equivalent ratio

Answers

Answer:

Equivalent ratios (which are, in effect, equivalent fractions) are two ratios that express the same relationship between numbers. We can create equivalent ratios by multiplying or dividing both the numerator and denominator of a given ratio by the same number. Two ratios that have the same value are called equivalent ratios. To find an equivalent ratio, multiply or divide both quantities by the same number. It is the same process as finding equivalent fractions.

when 2 ratios are the same or equivalent by simplifying. For example 1 to 4 is the same as 2 to 8 because when I simplify it i get 1 to 4

Help me please i really need it​

Answers

Answer:

Step-by-step explanation:

RSB is a right angle

12. RSB is 90 degrees

13. A right angle is 90 degrees

H is between P and S

14. PS + PH = HS

15. Deductive Reasoning

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'


Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5'


Type of mutation (3pts):


Amino acid ( 3pts):


Type of mutation ( 3pts):


4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5'


Mutated DNA sequence: 3' TACCGCTAATTATTACGTGCTGCTATCGCT 5'


Type of mutation ( 3pts) :


Amino acid ( 3pts):


Type of mutation ( 3pts):

Answers

3. The original sequence

TAC - CGC - TTA - CGT - CTG - ATC - GCT

codes for

tyr - arg - leu - arg - leu - ile - ala

while the mutated sequence codes for

TAC - CGC - TTA - TTA - TTA - CGT - GCT - GCT - ATC - GCT

tyr - arg - leu - leu - leu - arg - ala - ala - ile - ala

There are several frameshift mutations involved here:

• the first inserts 6 bases (TTA - TTA)

• the second inserts 1 base (G) before the CTG triplet (underlined)

• the third inserts 2 bases (CT) after the CTG triplet

4. The original sequence is the same as before. The mutated sequence

TAC - CGC - TAA - TTA - TTA - CGT - GCT - GCT - ATC - GCT

codes for

tyr - arg - STOP - leu - leu - arg - ala - ala - ile - ala

Then

• there is a (nonsense) point mutation that swaps T for A in the original TTA triplet (nonsense since it produces a stop codon that would halt replication/expression)

• there is a frameshift mutation that inserts 3 bases (TTA)

as well as two other frameshift mutations that also occurred in the previous part.

Does anyone know the answer for this question? I really need it.

Answers

Your answer is 9 1/3

3 x 9 1/3
= 3/1 x 28/3
= 84/3
= 28

The impact on sampling of increasing the sample size is: There is no specific relationship between sample size and sampling error.

Answers

Using margin of error, it is found that increasing the sample size results in a smaller sampling error.

The equation for the margin of error is given by:

[tex]M = c\frac{s}{\sqrt{n}}[/tex]

In which:

c is the critical value according to the distribution used.s is the standard deviation, either of the sample or of the population.n is the sample size.

From the equation, it can be noted that the margin of error is inversely proportional to the square root of the sample size, hence, increasing the sample size results in a smaller sampling error.

To learn more about margin of error, you can take a look at https://brainly.com/question/25821952

can you help me solve 4x - 15 = 17 - 4x

Answers

[tex]4x-15 = 17-4x\\\\\implies 4x +4x = 17 +15\\\\\implies 8x = 32\\\\\implies x = \dfrac{32} 8\\\\\implies x = 4[/tex]

Solve for x: one over eight 1/8(8x + 15) = 24

Answers

Answer:

22[tex]\frac{1}{8}[/tex]

Step-by-step explanation:

I hope this helps!!!

Other Questions
Help me out please ??????? A teacher wants to give each student 2 pencils. A store is selling pencils in boxes of 24. If the teacher has a total of 125 students, how many boxes of pencils should he buy? Please help!!!Think of reasons teenagers should and shouldnt stand up to injustice when others do not that relate to schoolThink of reasons teenagers should and shouldnt stand up to injustice when others do not that relate to health... Think of reasons teenagers should and shouldnt stand up to injustice when others do not that relate to emotions... Think of reasons teenagers should and shouldnt stand up to injustice when other do not that relate to money... Think of reasons teenagers should and shouldnt stand up to injustice when other do not that relate to people... Drag each tile to the correct box.Match each appropriate technology to the situation.1-cloud technology2-smart watch3-MEDLINE4-electronic health recordA.Dr. Shah wants to check if his patient has ahistory of allergies.B.Dr. Thomas wants her client to monitor herheart rate through the day.C.A senior cardiologist accesses the report of a PET scan via email while he is travelling,D.Laura, a nurse aide, is keen to improve her knowledge about certain illnesses. A system of equations is made up of an ellipse and a hyperbola. Part A: Create the equation of an ellipse centered at the origin, with a vertical major axis of 8 units and a minor axis of 6 units. Show your work. (3 points) Part B: Create the equation of a hyperbola centered at the origin, with a horizontal transverse axis, vertex at (4, 0), and asymptotes of y equals plus or minus seven fourths x period Show your work. (4 points) Part C: Determine the domain of each conic section and use it to explain why there is no solution to the system. (3 points) Which of the following describes the effect of high altitude on climate. why lysine is less basic than arginine If a = 0.3 and b =0.5, what is the value of a+b? A. [tex]\frac{8}{10}[/tex]B. [tex]\frac{8}{9}[/tex]C. [tex]\frac{80}{99}[/tex]D. [tex]\frac{88}{100}[/tex] Scientific notation of 1,750 Who is suffrage? The pain inflicted by overseers Abolitionist pamphlets Taxes charged on goods brought into the U.S. The right to vote you went to a coffee house with 2 friends and ordered an iced coffee and dessert which came to $12.96 how much is the tip if the rate is 15% can anybody help me with this plss... The letter in front of a number, showing multiplication. A.) Combining like termsB.) Coefficient C.) Distributive propertyD.) Like terms what is rule of law . with examples Which statement is true about the particles in liquid water at 100C and the particles in steam at 1000C? (Select ALL that apply) the particles will have the same kinetic energy the space between the particles is different with more space between particles in a gas the particles will have different kinetic energy the space between the particles is different,with less space between particles in a gas An athletic trainer believes that one of her football players is experiencing heat stroke. What is the MOST logical way for the trainer to react in this situation to BEST treat her athlete?A. Massage affected muscles.B. Call 911.C. Lead them through a cool down.D. Cover them with lukewarm towels. advance thanks,,,,,,,,,,,,,,,,,,,,, 5. Brent attends Narcotics Anonymous (a client-led group) meetings as mandated by a court decision. His program objectives will be conceptualized by: Tell which line contains each point for triangle ABC.the circumcenterthe orthocenterthe centroidthe incenter Which phrase from the excerpt shows that Hamilton thinks other governments are closely watching the formation of government in the United States? The subject speaks its own importance; comprehending in its consequences nothing less than the existence of the UNION the safety and welfare of the parts of which it is composed, the fate of an empire in many respects the most interesting in the world AFTER an unequivocal experience of the inefficiency of the subsisting federal government, you are called upon to deliberate on a new Constitution Among the most formidable of the obstacles which the new Constitution will have to encounter may readily be distinguished the obvious interest of a certain class of men in every State.