Please help!!!

Think of reasons teenagers should and shouldn’t stand up to injustice when others do not that relate to school…

Think of reasons teenagers should and shouldn’t stand up to injustice when others do not that relate to health...

Think of reasons teenagers should and shouldn’t stand up to injustice when others do not that relate to emotions...

Think of reasons teenagers should and shouldn’t stand up to injustice when other do not that relate to money...

Think of reasons teenagers should and shouldn’t stand up to injustice when other do not that relate to people...

Answers

Answer 1

The teenagers should not stand up to injustice. Teenagers is an immature age. They do not have enough knowledge about various issues of injustice and they might react too quickly and too aggressively.

Teenagers are mostly school going children so they are aware of the problems they might face. They should stand for injustice in school.

Teenagers should not stand up to injustice related to health issues. They are not aware of the health issues which an older age people or an adult might suffer. Their studies are at initial stage to they are not able to understand matters completely.

Teenagers should stand up to injustice related to health issues because they will be able to see the problems and become stronger adult in future to stand against injustice.

Teenagers should not stand up to injustice because they have mood swings and quick emotional changes. They might become very aggressive to an issue that they consider it their first priority. They might get stress due to extreme emotional attachments.

Teenagers should stand up to injustice because they will be able to experience different emotions at very early age and learn from it.

Teenagers should not stand up to injustice because they become greedy and consider money most important thing than any other.

Teenagers should stand up to injustice because they will be able to understand the value for money.

Teenagers should not stand up to injustice because this is an an age where most of education is learned and they should not waste their precious time in other activities.

Teenagers should stand up to injustice because they will be better able to understand people and care for them.

Learn more at https://brainly.com/question/25914611


Related Questions

8
Select the correct text in the passage.
Which line suggests the theme “Nature offers a place of rest for those who are weary”?

excerpt from Green River
by William Cullen Bryant


When breezes are soft and skies are fair,
I steal an hour from study and care,
And hie me away to the woodland scene,
Where wanders the stream with waters of green,
5 As if the bright fringe of herbs on its brink
Had given their stain to the wave they drink;
And they, whose meadows it murmurs through,
Have named the stream from its own fair hue.
A. I steal an hour from study and care,
B. Where wanders the stream with waters of green,
C. Had given their stain to the wave they drink;
D. Have named the stream from its own fair hue.

Answers

We can actually deduce that the line that suggests the themeNature offers a place of rest for those who are weary” is:

A. I steal an hour from study and care.

What is theme?

Theme refers to the subject or topic that is actually seen in a passage or text. Theme reveals what the author or writer is trying to pass across in a passage. It's like an underlying message in a passage.

We can see here that the line that suggests the theme is: I steal an hour from study and care.

Learn more about theme on https://brainly.com/question/734603

Answer:

A. I steal an hour from study and care.

Explanation:

this one


can somebody do this for me? i want it to be about social anxiety and how i feel alone but i cant put it into words !i’ll give you a crown if you do it:)

Answers

Answer:

What are two characteristics that are caused by your social anxiety? Maybe shy, and or quiet? nervous, maybe awkward? There, that's the first line which is repeated at the beginning of each stanza.

What are you curious about? Maybe what it's like to easily connect with people, or maybe you're wondering how to do that.

The next line is "I hear". What do you hear in a situation where you get social anxiety? Conversation? Laughter?

Same with the next line, "I see". Do you see groups of people, or are you just staring at the floor or your phone?

See if you can go through the poem and answer each question with a simple word or two, afterwards you can revise it so it makes more sense. Hope this helps!

Answer:

I am socially awkward

I am strange

I hear your voices

I see your lips moving

I want to speak, but I'm afraid

I am socially awkward

I pretend to be calm and cool

I feel as if you'll laugh If I talk

I touch the place above my beating heart.

I worry I'll never meet new friends

I cry when friendships comes to an end

I am socially akward

I understand that you won't laugh

I say that dreams come true

I dream about the day, that I'll be cool

I try to start conversations

I hope I won't be excluded

I am socially awkward

Explanation:

I hope this helped (you can change the parts you don't like)

Who would you like to associate yourself with?

Answers

Answer:

I would like to associate myself with good people, Not toxic people.

Explanation:

Have a good day!

can you wright a quick aab 3 sentence paragraph​

Answers

Associate of Science (A.S.) and Associate of Arts (A.A.) degrees are designed to prepare a student for transfer to a 4-year institution to pursue their bachelor's degree. Associate of Applied Science (A.A.S.) and Associate of Applied Business (A.A.B.) degrees are "career" programs which prepare students for employment.

What kind of person Hà is?

Answers

tenacity, bravery and cleverness

Answer:Ha's character traits in Inside Out and Back Again include tenacity, bravery, and cleverness.

Explanation:

Freee 450 points

Steven is a car salesperson at Empire Motors in Pomona. At his dealership, salespeople earn a 25% commission rate, which is based on the profit made on the sale, after a "pack" fee. The pack fee at his dealership is $800. Steven sold a used car for $18,500 and $3000 of that was profit. How much money will Steven earn on this sale considering the price of the car, the pack fee, and his 25% commission?

Answers

Answer:

100 is my guess. Hope this helps and sorry if it's wrong T^T

Explanation:

In 1–2 sentences, explain how context influences whether a writer uses formal or informal language.

Answers

It should be noted that context simply means the surroundings of the text and this influences the language that's used.

Context simply means the setting within which a literary work is situated. It should be noted that context provides the background information to inform the readers about where the event in the story will take place.

Context simply means the surroundings of the text and this influences the language that's used. A playful context can be used to denote an informal setting.

Learn more about context on:

https://brainly.com/question/2684713

it hasn't been graded yet but this was my answer:   Context influences whether a writer uses formal or informal language because for example they were writing a paper for school they would use formal language, but if they were just sending their friend a text they would use informal language.

don't forget to rewrite it in your own words... that would be plagiarism! :)

As it turns out, becoming a moral person can help you become a psychologically healthy person;
promoting happiness of others frequently enhances your own happiness. The following adages all
support this concept except

Answers

Hey
yes it’s right good job

The following adages all support this concept, except To err is human, to forgive is divine. The correct option is A.

What is psychology?

The area of psychology known as humanistic psychology is concerned with assisting individuals in realizing their potential and achieving their highest level of well-being.

It considers self-efficacy, free will, and Individual self-actualization over defects in cognitive processes. Thus, humanistic psychology is a perspective on personality that places an emphasis on the study of psychologically sound individuals.

Carl Rogers vividly illustrates what it means to be a “psychologically healthy” person, which is one of the key ideas he brought to psychology. A person was also stated to have "a positive unconditional self-regard and the potential to realize self-actualization" in order to be regarded as psychologically fit.

Therefore, the correct option is A, To err is human, to forgive is divine.

To learn more about psychology, refer to the link:

https://brainly.com/question/29450508

#SPJ2

The question is incomplete. Your most probably complete question is given below:

To err is human, to forgive is divine.

A categorically imperative

moral dilemma

he ends up justifying the means

12. Choose the answer that best matches the word in italics. (1 point)
The suspects eluded the police for almost 24 hours.
O acknowledged
O denied
O escaped
O hindered
???

Answers

I’d say hindered is the answer if it’s eluded

Hindered the best matches the word in italics. Therefore option D is correct.

What is the word?

A word is a fundamental component of language that has an objective or useful meaning, can stand alone, and cannot be interrupted. Despite the fact that language users frequently understand a term intuitively, linguists disagree on its exact meaning, and various attempts to identify precise standards for the idea have proven unsuccessful.

The idea of a "word" is different from a morpheme, which is the smallest linguistic unit with meaning even if it cannot stand on its own. Every word has at least one morpheme. The morphological derivation is the process of combining morphemes to produce new words.

Numerous attempts have been attempted to define what a word is since the beginning of the study of linguistics, using a variety of different criteria. However, no satisfactory definition has yet been discovered that can be applied to all languages and at all levels of linguistic analysis. At various levels of description, it is feasible to locate consistent meanings of "word," nonetheless.

To learn more about the word follow the link.

https://brainly.com/question/18499157

#SPJ2

Write a paragraph about education ??​

Answers

Answer:

Answer

Image result for education paragraph essay

Education is a process of learning through which we acquire knowledge. It enlightens, empowers, and creates a positive development. Education gives an individual the knowledge and skills to work with virtue. It aids the all-round mental, physical, and intellectual growth and development of an individual.

Explanation:

School

2. There were a lot of famous faces on the red carpet Brittany Spears, Lady Gaga, and Nick Jonas.

Answers

Explanation: nick jonas

Answer:

if i was to choose i would choose Brittany Spears

Explanation:

what is map legends???

Answers

Answer:

a map is a represontation of a place or the earth ,usually drawn on a flat surface.

It should be noted that a map legend simply defines the features that are in a map.

A map legend is important as it helps in displaying the meaning of the symbols, styles, colors, etc that are used in the map.

Legends typically consist of the examples of the symbols that are on the map with labels that contain the explanatory text.

In conclusion, map legends are important in a map.

Learn more about map on;

https://brainly.com/question/25822898

help me Write a short essay 2 - 3 paragraphs in which you will PERSUADE your classmates why it is important for schools to return to face to face learning.  Your essay must: Be 2 - 3 paragraphs  , Be properly structured Follow the rules of spelling, punctuation and grammar.​

Answers

Answer:cuz yes

Explanation:

yes

why do every one here hates me?!​

Answers

Answer:

Why are you saying that???? Your are the best

Na your overthinking there just mad they can’t be as cool as you :)

When Elizabeth saw Heathcliff what did she say?

Answers

Answer:

Heathcliff enters and Hareton leaves, "to enjoy his grief and anger in solitude” (303). Heathcliff moodily confides to Lockwood that Hareton reminds him more of Catherine Earnshaw than he does of Hindley. He also tells Lockwood that he will still have to pay his full rent even if he leaves the Grange, to which Lockwood, insulted, agrees. Heathcliff invites Lockwood to dinner, and informs Cathy that she can eat with Joseph in the kitchen. Lockwood eats the cheerless meal and leaves, contemplating the possibility of his courting Cathy and bringing her "into the stirring atmosphere of the town” (304). and tell him he is moving to London :

meaning of yamete kudisia?​

Answers

Answer:

yametekudasai." = Can you please stop it?

Answer:

ah ah ah yameteh

Explanation:

ah ah ah deliciosso

We won't cut anything, so there...... are not necessary
A. walking boots B. scissors C. travel items D. plasters

Answers

Answer:

Scissors is the answer

Explanation:

Which of the following ideas did the author
develop the LEAST in this article about why you
should date your best friend?
A
why best friends make better romantic
partners
B
how expectations for modern relationships
have changed
С
how partnerships between best friends are
more satisfying
D
younger people are not as likely to view
their partner as a best friend

Answers

D because the question is asking which article would develop the LEAST reason on why you should date your best friend , and D goes against on why you should date your best friend

The length of a rectangle is 5 yd less than three times the width, and the area of the rectangle is 50 yd. Find the dimensions of the rectangle.

Answers

[tex]\large\huge\green{\sf{Answer:-}}[/tex]

[tex]Answer:

The width is 5m and the length is 10m.

Step-by-step explanation:

Rectangle:

Has two dimensions: Width(w) and length(l).

It's area is:

A = w*lA=w∗l

The length of a rectangle is 5m less than three times the width

This means that l = 3w - 5l=3w−5

The area of the rectangle is 50m^(2)

This means that A = 50A=50 . So

A = w*lA=w∗l

50 = w*(3w - 5)50=w∗(3w−5)

3w^{2} - 5w - 50 = 03w2−5w−50=0

Solving a quadratic equation:

Given a second order polynomial expressed by the following equation:

ax^{2} + bx + c, a\neq0ax2+bx+c,a=0 .

This polynomial has roots x_{1}, x_{2}x1,x2 such that ax^{2} + bx + c = a(x - x_{1})*(x - x_{2})ax2+bx+c=a(x−x1)∗(x−x2) , given by the following formulas:

x_{1} = \frac{-b + \sqrt{\bigtriangleup}}{2*a}x1=2∗a−b+△

x_{2} = \frac{-b - \sqrt{\bigtriangleup}}{2*a}x2=2∗a−b−△

\bigtriangleup = b^{2} - 4ac△=b2−4ac

In this question:

3w^{2} - 5w - 50 = 03w2−5w−50=0

So

a = 3, b = -5, c = -50a=3,b=−5,c=−50

\bigtriangleup = (-5)^{2} - 4*3*(-50) = 625△=(−5)2−4∗3∗(−50)=625

w_{1} = \frac{-(-5) + \sqrt{625}}{2*3} = 5w1=2∗3−(−5)+625=5

w_{2} = \frac{-(-5) - \sqrt{625}}{2*3} = -3.33w2=2∗3−(−5)−625=−3.33

Dimension must be positive result, so

The width is 5m(in meters because the area is in square meters).

Length:

l = 3w - 5 = 3*5 - 5 = 10l=3w−5=3∗5−5=10

The length is 10 meters

[/tex]

Which sentence offers the best explanation of why this passage follows the formal rules of epic poems?

Answer choices for the above question

A. This passage introduces the story’s antagonist.

B. This passage includes an irregular rhyme scheme.

C. This passage tells a story about Rama’s early life.

D. This passage contains examples of alliteration.

Answers

The answer A. This passage introduces the story’s antagonist.

What is the most likely reason why the author does not include a resolution?

The author wants to keep the reader or listener engaged.
The author wants to create a comparison with a famous Greek tale.
The author wants to teach lessons about Arabian cultural practices.
The author wants to promote the idea of reason and wisdom over power.

Answers

Answer:

The author wants to keep the reader or listener engaged.so its a

Explanation:

What is the otuer word for young
A. juvenile B. Old C.small D.tiny​

Answers

Answer:

juvenile

Explanation:

Answer:

Juvenile

Explanation:

one paragraph about 'winter season' . It should be 10 lines.​

Answers

Answer:

The winds blowing in winter are fast, very cold and chilly. I feel very active in winter because I sweat less. My mother takes out woolen clothes and blankets at the beginning of winter to keep us warm. Many rare birds can be seen in winter.

Explanation:

please mark my answer in brainlist

Answer:

winter os one of the most important season. It is one of the four seasons of temperature zones. winter is the coldest season of the year. Its duration is from November to February. It is the season with the shortest days, lowest temperatures and the nights are long. In winter season, the people wear warm clothes and like drinks or coffee soup In winter, the wind become very cold and sizzling. The looks rough and the trees shade their leaves. In the winter season, different beautiful flowers bloom and they enhance the beauty of of this season.

Make me as brainlest

Pretend you are a mouse in a busy department store. What do you see there.

Answers

Answer:

CHEESE

Explanation:

Answer: All them feet and dirt

Explanation:

plz help important Which of the following is the best definition of symbolism?
Question 12 options:

A person, place, thing, or event that has meaning both in itself and that also stands for something more than itself

the attitude held by the author towards the subject or audience of their text

the techniques an author uses to reveal character traits

the events in a story

Answers

Answer:

the first one

Explanation:

what genres do you personally use in your writing

Answers

Answer:

fantasy genre :D

Explanation:

Answer:

science fiction :))

Explanation:

What is one of Edgar Allan Poe's lasting legacies?

Answers

Answer: He paved the way for writing as a career.  

- Poe was one of the earliest American short story writers and is generally considered the inventor of the crime fiction genre, also receiving credit for his contribution to the emerging science fiction genre. He was the first American writer known for trying to make a living through writing alone, resulting in a financially difficult life and career.

which element helping you identifiy theme of a story

Answers

Answer:

the idea the writer wishes to convey about the subject—the writer's view of the world or a revelation about human nature.

To identify the theme, be sure that you've first identified the story's plot, the way the story uses characterization, and the primary conflict in the story.

Explanation:

Pls Mark Brainliest

What is the purpose of the supporting details?

a.
To make a paragraph longer

b.
To make a paragraph shorter

c.
To support the main idea

d.
To support your opinion​

Answers

C. To support the main idea.

the brother helped himself/him to a bowlof creal in the morning ​

Answers

Answer:

The brother helped himself to a bowl of cereal in the morning.​

Explanation:

Other Questions
The police___ that the children died in an accidenta. believes c. believeb. is to believe d. are believing Gravitational force acts on all object in proportion to their masses. Why then, a heavy object does not fall faster than a light object? Eleventh gradeX.1 Identify and correct errors with subject-verb agreement 08SYou have book covers to reveal! Co toFind the error with subject-verb agreement. Select the incorrect verb and type it correctiy.The metric system, first created by French scientists in the 1790s, isbased on a unit of length known as the meter. Approximately 3.28 feetare the equivalent of one meter,This is for English !!! Blair worked for 4 2/5 hours and earned $36.30. How much would she earn if she worked for 5 4/5 hours? Enter your answer in the box.PLEASE HELP ASAPPPPP!!! I WILL GIVE BRAINLIEST AND 50 POINTS!!! PLEASE HELP!You are camping and have only a 3 cup container and a 5 cup container. You need to measure 1 cup of water into a pot. How can you do this? Is there more than one way? Explain. How does Equiano's fear of being eaten by slavers serve as a metaphor for slavery itself ? 12 for every 2 male birds in a bird cage there are 5 females. What is the ratio of the males to females 2.5kg of potatoes cost 1.40work out the cost of 4.25kg pls help (written response pls) 3) Match the outline for the Federalist Papers written in Federalist No. 1. (in order as they appear) the additional security which its adoption will afford to the preservation of that species of government, to liberty, and to property the insufficiency of the present confederation to preserve that Union its analogy to your own state constitution the necessity of a government at least equally energetic with the one proposed, to the attainment of this object the utility of the Union to your political prosperity the conformity of the proposed Constitution to the true principles of republican government Julia went into a movie theater and bought 2 bags of popcorn and 5 pretzels, costing a total of $37.25. Zoe went into the same movie theater and bough 8 bags of popcorn and 9 pretzels, costing a total of $102.25. Write and solve a system of equations to determine the price of each bag of popcorn and the price of each pretzel. HELP URGENT!!! RESPOND QUICKLY!!! Why do regions/places have different types of climates? Try to give an example in your answer (PLEASE HELP - This is a essay thing that needs done!! I am so behind in assignments I BEG YOU FOR HELP!!) Sometimes, people do not realize justhow amazing they really are; this is evidentin Alberto Moravias Poor Fish. Usingtextual evidence, explain the narratorsstruggle in Poor Fish. Then, discusswhether one persons support and belief ofanother can positively affect that person.*This must be written in third person, andeach body paragraph should include at leastone direct quote from the text. Which of the following are valid names for the given triangle? Check all thatapply. Transcribe the following Strand of DNA:GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT PLS ANSWER QUICK I HSVE EXAMS COMING UP VERY SOON 42) Which equation best represents the line of best fit for thisscatter plot?A. y = 4x - 4B.y= 4x-2C. y = x-4D. y=x-2-5-4-3- e. Observe: notice or perceivef. Infer:g. Repetition:h. Replication:i. Data What does the narrators description of the wallpaper reveal about the context of the story? The narrator feels imprisoned by her life. The narrator wants everyone to study the wallpaper. The narrator thinks that the wallpaper hides a secret room. The narrator prefers to do her writing work at night. Which phrase best describes the harlem renaissance?.