You have a plot of strawberries planted and you begin to notice some tiny aphids on the leaves of your plants. How could you rid your farm of the aphids without using chemical control methods?

Answers

Answer 1

Answer:

put ladybugs in the garden with the strawberries. they kill the aphids and will be full and wont destroy the plants.

Explanation:

hope this helps

btw if u have a prob with the ladybugs chickens love ladybugs :p


Related Questions

To achieve which of the following goals would rotational grazing be most appropriate? (3 points)
-To maximize livestock populations while minimizing costs
-To preserve vegetation and soil fertility of land
-To involve townspeople in the operations of a nearby farm
-To transform an abandoned city lot into a neighborhood garden

Answers

Answer:

To preserve vegetation and soil fertility of land

Explanation:

.

A person with a low number of white blood cells could have difficulty in fighting infections and A decrease in the number of lymphoid stem cells could result in a decrease in red blood cell.

What is nucleotide?

It is the sub units and buIlding blocks of DNA. It is made up of a five-sided sugar, phosphate group and then a nitrogen base.

These groups make the backbone of the DNA helix. If you look at a DNA helix, they make the side of the ladder or the side portion. They connect to a nitrogen base which make the steps of the ladder.  The type of sugar that is used in a DNA helix is called deoxyribose.

Nitrogen bases are the molecules that make up the steps of the ladders. There are four different nitrogen bases, namely; Guanine, Thymine,Adenine and Cytosine.

Pyrimidines are compounds that make a single 6-sided ring. Examples of pyrimidines are Cytosine and Thymine. Purines on the other hand make 5-sided and 6-sided rings.

Therefore, A person with a low number of white blood cells could have difficulty in fighting infections and A decrease in the number of lymphoid stem cells could result in a decrease in red blood cell.

Learn more about white blood cells on:

https://brainly.com/question/19202269

#SPJ5

What Bacteria is put in yougurt ?

Answers

two species of bacteria called Lactobacillus bulgaricus and Streptococcus thermophilus.

Answer:

food bateria

Explanation:

The air in the thermosphere is composed of atoms of _____ that are very far apart from each other.

Answers

Answer:

Explanation:

In the upper thermosphere, atomic oxygen (O), atomic nitrogen (N), and helium (He) are the main components of air.

Energetic ultraviolet and X-ray photons from the Sun also break apart molecules in the thermosphere. In the upper thermosphere, atomic oxygen (O), atomic nitrogen (N), and helium (He) are the main components of air there ya go son

All substances are built from
compound
oxygen
metals
atoms

Answers

Answer: All substances are built from

compound

oxygen

Explanation:

All substances are built from atoms as atoms are the basic building blocks of matter and are the smallest units of a chemical element. The correct option is D.

Atoms form the basis of all compounds. The fundamental building blocks of matter, atoms are the smallest units of a chemical element that nonetheless retain that element's chemical characteristics.

Atoms from various elements combine chemically to produce compounds, however compounds themselves are not the basic building blocks.

Although oxygen is an element that is present in several substances, it is untrue to say that oxygen is the primary component of all substances.

Although metals are a specific kind of element, not all substances are made of metals. Thus, the most correct response is that all substances are composed of atoms.

Thus, the correct option is D.

For more details regarding atoms visit:

https://brainly.com/question/13654549

#SPJ6

Your question seems incomplete, the probable complete question is:

All substances are built from

A. compound

B. oxygen

C. metals

D. atoms

BRAINLIEST:
in which month is a hurricane most likely to occur: October or December? explain

Answers

Answer:

October

Explanation:

October is one of the hurricane season months

Explain how diffusion and osmosis are related to the symptoms of cystic fibrosis

Answers

Answer:

Answer D

Explanation:

just took the test.

What is the difference between prokaryotic and eukaryotic cells?

Answers

The main difference that separates prokariotic organisms from eukaryotic organisms is the organisation of the genetic material. Prokaryotes have a single chromosome that isn't separated by a membrane and it's called nucleoid. Eukaryotes have multiple chromosomes that are inclosed in a nuclear envelope(nucleus).

The only organelles present in prokaryotic cells are the ribosomes(70S) which differ from the eukaryotic ribosomes(80S). Eukaryotic cells have membrane bound organelles like the mitochondrion or Golgi aparatus.

What would happen to a species if it was quickly moved from a familiar environment to an extremely different environment.

Answers

Depending on how good that species is at adapting to new environments that species of animals could adapt overtime, or die

Peoples choices can sometimes have negative effects on their own health as well as the health of your well-being of others describe to these choices explain how they can impact the individual and others

Answers

Answer

a good environment could mean better people better love and kindness bad environment could mean problems in your future and/or daily life this can affect everybody and anybody

Explanation:

In a chemical analysis of a sample of animal tissue, which element would most likely be found in the smallest quantity?

Answers

Answer:

Iodine

Explanation:

Iodine is needed by animals because the body's metabolic rate is controlled by the action of an iodine hormone, called thyroxine, which is secreted by the thyroid gland in the neck.

If the animal fails to supply enough iodine through food to be able to make a normal amount of this compound, then the thyroid gland enlarges or expands trying to create enough, resulting in a common type of goiter.

Which of the following can cause the extinction of a species?
climate change
catastrophic events
interactions with other species
human activities

Answers

Answer: human activities

Explanation:

Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide
chain, identifying the codons, anticodons, and amino acid sequence.
DNA: CGATACAATGGACCCGGTATGCGATATCC

Answers

I don’t feel like answering all that but....
C=G G=C T=A A=U
C=G A=T dont know the rest have a gcodocododd dday

Baby Brain Power
How does the bar graph on page 5 expand on
information presented in the passage?
It shows exactly how many synapses a person's
brain has at birth
Speech, emotional regulation, movement, and
vision-all of these extraordinary abilities and
many more are possible thanks to the organ
that serves as the body's control center. When
one thinks of "brain power, it is the faces of
adult inventors, professors, and novelists that
Ekely come to mind. Remarkably the most
critical time period with respect to brain
development occurs relatively soon after an
individual is bom.
A newborn enters the world as a fairly helpless
creature, but her brain hos billions upon
bitions of specialized cells coiled neurons.
It gives more information than the passage by
showing that the number of synapses returns to
what it was at birth.
It provides specific information about how many
synaptic connections are formed in each year of a
person's life.
It gives information about synaptic connections
beyond the time period described in the passage.
2
3
4
5

Answers

Answer:

C

Explanation:

Took it

Make a list of different weather patterns

Answers

Weather comes in all different forms, and it changes by the day. It could be sunny one day and raining the next. It could even be sunny, rainy, cloudy, and stormy in one day.

Common Types of Weather Elements

The weather has a lot of different factors. When someone asks how the weather is today, you need to think about temperature, humidity, precipitation, wind, cloudiness, and atmospheric pressure. All these different parts work together to create the weather you see when you walk out the door.

explain how darwin's journey to the galapagos islands contributed to his creation of the theory of evolutions.

Answers

Explanation:

During his visit to the islands, Darwin noted that the unique creatures were similar from island to island, but perfectly adapted to their environments which led him to ponder the origin of the islands' inhabitants.

Among those that struck Darwin so greatly were the finches that are now named in his honor. Darwin would later base some of his thought from the supposing that these finches were all descendents of the same lineage.

Which of the following statements is true?

Opportunistic bacteria only cause infection under certain conditions.
Most bacterial infections are caused by bacteria already in the body.
Leukocytes are the first line of defense against pathogenic microorganisms.
The flu and the common cold are treated with rest, fluids, and antibiotics.

Answers

Answer:

1 one is true

2 is true

3 is falase

Answer:

a

Explanation:

Vaporization is the reserve of what?

Answers

Answer:

Vaporization is the reserve water

Explanation:

Describe some of the properties of water and explain how the structure of water is responsible for these properties.

Answers

Answer:

The main properties of water are its polarity, cohesion, adhesion, surface tension, high specific heat, and evaporative cooling. A water molecule is slightly charged on both ends. This is because oxygen is more electronegative than hydrogen. ... The stream of water bends due to the polarity of water molecules.

Explanation:

What do the enzymes in excision repair systems do?

A destroy cancer cells
B cut off telomere sections
C replace dna damaged by chemicals
D replace rna primers with dna

Answers

B would be the answer I think

Its easy! If right will give brainlist! Don't overthink..:) Just answer

The virtual image changes with the position of the mirror to the eye when the mirror is..............?
Fill in the blanks

Answers

Answer:

When the mirror is inside the focal point..?

In the United States, most racial discrimination comes in the form of ________ discrimination.

A. Direct
B. overt
C. indirect
D. extra​

Answers

Answer:

C, indirect because most people do not admit that they are racist and claim that they didn't do things because they're racist.

Explanation:

In the United States, most racial discrimination comes in the form of indirect discrimination. Therefore, option C is the correct option.

What is indirect discrimination?

Indirect discrimination involves the policies or practices that appear neutral on the surface, but deep down have adverse effects on the people belonging to a particular race.

Indirect discrimination can be seen in various areas, such as employment. During a job vacancy, the job applicant requires to speak a high level of proficient English which appears to be a reasonable requirement for the job, but it can lead to a significant impact on non-native English speakers.

Indirect discrimination can be seen in the education field where schools give admissions to only those students who will qualify for a specific education test which may seem unfair to students belonging to a specific race, and having different educational backgrounds.

Therefore, indirect discrimination is the most common form of discrimination observed in the United States.

Learn more about indirect discrimination here:

https://brainly.com/question/14710203

#SPJ7

Which of the following statements regarding prokaryotic and eukaryotic cells is true

Answers

Answer:

I would need the statements to answer that. however prokaryotic cells are plant cells and eukaryotic cells are animal cells

Answer:

They are typically smaller than eukaryotic cells. The DNA of a prokaryotic cell is contained in the nucleoid. There are several ways in which prokaryotic cells are different from eukaryotic cells. Firstly, they are generally smaller in size, their organelles are not membrane bound, and they have no nucleus. They, however, share commonalities with eukaryotic cells including the presence of a bilipid plasma membrane, presence of ribosomes and DNA.

Hope this helps, have a great day/night, and stay safe!

Which of the following processes begins when a star enters the main sequence?
a


Nuclear fission
b


Nuclear fusion
c


Condensation of a nebula
d


Appearance of a supernova

Answers

Answer:

i believe it is B: Nuclear Fusion

Explanation:

Answer:

C. Nuclear Fusion

Explanation:

I am 1000000000% sure this is correctamundo, stay cool, and have a great day!

Which of the following problems are a result of acid deposition?


Nitrogen depletion in soils
Decreased pH levels in lakes and rivers
Corrosion of monuments and metal structures
I and III
II and III
I only
II only

Answers

Answer:

II and III

Explanation:

Acid will decrease pH levels in water and corrode monuments like marble statues and rust metals, but has no correlation to nitrogen depletion.

Hope this helped!

Bacteria cannot survive in deep ocean areas where no light is present. true or false

Answers

Answer:

false on edge

Explanation:

Why are packed juices contaminated with yeast

Answers

Answer:

It is because yeast is responsible to fix the carbon dioxide.

Because of o2
Is responsible

when benedicts solution is added to a sucrose solution and put into a boiling water-bath , no change in color is observed

state why no color change is observed

Answers

Answer:

b

Explanation:

A 100 kg box is initially at rest on a level surface. One 10 N force acts on the box , directed toward the right. A second 10 N force acts simultaneously on the box , directed toward the left , as shown.

Answers

The box would stay at rest where it lies since the same amount of force is pulling it in opposite directions :)

Since 10 N forces are acting from both sides, these are balanced forces and the box will not move because balanced forces are acting on it. So the correct option is D.

What are balanced forces?

Forces that are equal in magnitude and opposing in direction are said to be balanced forces. Equilibrium is seen as a condition of balanced forces. There is no shift in direction when the forces are in balance.

Balanced combined forces have always been equal to zero. These are vectors for merging. Balance forces cannot alter an object's momentum or direction.

An item is kept traveling at a constant speed by a balanced force. In it, Newton's First Law of Motion is explained. A good illustration of a balanced force is a book on the table. The normal force (support force) of the table balances out the weight of the book. The two forces are exactly equal and opposed to one another.

While forces that are balanced can keep an item at rest or move at a steady speed, unequal forces can cause things to accelerate.

Therefore the correct option is D.

Read more about balanced forces, here

https://brainly.com/question/19127263

#SPJ5

- Lee el siguiente párrafo y a continuación responde lo que se te pide.Los seres humanos primitivos comenzaron a clasificar las plantas y los animales tanto por su utilidad como por el daño que les causaban, luego fueron profundizando aún más en sus conocimientos sobre la flora y la fauna de su entorno, identificando los ciclos biológicos y hábitat, entre otros aspectos que facilitaron su producción y pronta disponibilidad. Con base en el párrafo anterior se puede afirmar que: * 1 punto A) Empezaron a entablar una relación más estrecha con el medio ambiente. B) Abandonaron su vida primitiva y nómada C) Incrementaron sus conocimientos únicamente sobre el ciclo del agua. D) Empezaron la agricultura y la piscicultura.

Answers

Answer:

A) Empezaron a entablar una relación más estrecha con el medio ambiente.

Explanation:

Desde el pasaje, podemos ver que la gente comenzó a prestar más atención a su entorno y cómo la fauna y la flora afectan la vida humana.

Incluso intentaron desarrollar un sistema burdo de clasificación biológica. Henec, se puede inferir que las personas desarrollaron una relación más cercana con su entorno.

Chemicals and proteins in the cell read the DNA ___________ for building that make cells, tissue and organs.
(A.Instructions
(B.Genes
(C.Recipe
(D. Life manual

Answers

You answer will be B!! Good luckkk!

Genes of DNA can be read by chemicals and proteins for building that can make cells, tissue, and organs. Therefore, option "B" is correct.

What are genes?

Genes are composed of  DNA which is the genetic material. Gene is the functional unit of heredity. Chromosomes are comprised of multiple genes. Genes code for a particular trait. More than one gene can code for a particular trait.

The function of DNA and RNA is controlled by genes. There are more than 3000 genes present. Mutation can occur in genes. Deletion and insertion are some types of mutation genes. Transposomes are called jumping genes. Sickle cell anemia and cystic fibrosis are some examples of gene mutations.

Genes code for the traits such as the color of eyes, height quality of hair, and more.

Learn more about genes, here:

https://brainly.com/question/31121266

#SPJ2

Other Questions
Proper Paints Company has a target capital structure of 35% debt and 65% common equity with no preferred stock. Its before tax cost of debt is 8% and its marginal tax rate is 25%. The current stock price is P0 = $22. The last dividend was D0 = $2.25 and it is expected to grow at a 5% constant rate. What is its cost of equity and it's WACC? Find the value of y:8y(4y+24) Solve for a!!!!!!!!!! Please have a look at the screenshot below Why do Komodo dragons and red-tailed boas have so many differences, even though they share acommon ancestor?Komodo dragon differences legsjagged teetharmored skinsomewhat flexible bodyjaw not flexibleRed tailed boas differencesno legsteeth not jaggedno armored skinvery flexible bodyflexible jaw that can open very wide Ronnie had a balance of $50 in his savings account. On Monday, he deposited $75.Two days later he withdrew $20. He then deposited $220 on Friday afternoon.How much should he deposit if he wants to have at least $400 in his savingsaccount? What is the political cartoon BEST illustrating? A. Protectionism B.nativismC.isolationism D.imperialism Why is the issue of whether monuments of confederates and slave owners should be taken down or not so controversial?Please help! what was one effect of the state colonization law of 1825 what vegetation is commonly found in the flat low-lying areas ? An example of statistical inference is a. a population mean b. hypothesis testing c. calculating the size of a sample d. descriptive statistics Integrated science please help ASAP!... thanks guys i only got one question wrong Please help! Thanks! What is the distance between a 900 kg compact car and a 1600 kg pickup truck if the gravitational force between them is about 0.0001 N? Before we dig into Home Safety... Why is home safety important to learn about? In what ways can being educated inhome safety help you as you begin to purchase a home, move into a new home, and observe new homes that you visited? The Confederate states' most important advantage entering the Civil War is generally considered to be thatA)their Navy was almost twice the size as that of the Union.B)the South was much more industrial than the North and thereforeproduced more weapons.Ctheir soldiers knew how to ride horses and use firearms better than anynortherners did.D)they only had to fight a defensive war and outlast the Union's will to fightin order to win. This month, a marching band has 60 musicians. If the number of musicians in the band last month was 51 members, what percent of increase was this? (Round to the nearest percent) What is the common difference for this arithmetic sequence?45, 40, 35, 30, 25, ... What is President Roosevelts primary purpose in his speech?? A -To inspire listeners to lead lives of action and courage.B - To describe a commonly accepted belief and show that it is misguided.C - To attack his political opponents for being overly critical while accomplishing little.D - To offer an objective, dispassionate take on human nature and the meaning of life