Write your own accessor and mutator method for the Rectangle class instance variables. You should create the following methods: getHeight setHeight getWidth setWidth getArea getPerimeter toString- The output of a rectangle with width 10 and height 4 method should be:

Answers

Answer 1

Answer:

Public int getHeight(){

return height;

}

public int getWidht(){

return widht;

}

public int setHeight(int change){

height = change;

}

public int setWidht(int change){

widht = change;

}

public int getPerimeter(){

int perimeter = 2 ( getWidht() + getHeight ());

return perimeter;

If the width is 10 and height 4, the perimeter should be 28.

Explanation:

An accessor in Java is a method that is used to get the value of an object variable. The program above has three accessor methods, getHeight, getWidht and getPerimeter.

Mutators are methods that is used to change of mutate the value of object variables. They are denoted or identified by the set prefix in their names. From the class code, the mutator are setHeight and setWidht.


Related Questions

One vulnerability that makes computers susceptible to walmare is:
A. A using antimalware software
B. Using password software
C. Using old versions of software
D. Using encryption on sensitive files

Answers

C using old versions of software

What is the purpose of the Error Alert feature?

Answers

Answer:

When you add data validation to a cell, the Error Alert feature is automatically turned on. It blocks the users from entering invalid data in the cell.

Explanation:

There ya go.. -_-

Answer:

A) To alert the user to data entry mistakes  

Explanation:

Explain how the use of Git and a shared public Git repository simplifies the process of managing opensource development when many developers may be working on the same code. Support your answer with an appropriate visual that you find from the internet.

Answers

Answer:

Git is a collaborative software used by members of a group to share and work on the same projects. Github is a web application that uses git to link people working together on a codebase. With git and Github, opensource projects can be accessed and collaborated on by volunteers.

Explanation:

Opensource development is a collaborative group of developers working together on a software or platform with a general public license. When working on an opensource project, each developer is able to folk or get a copy of the repository downloaded to a local computer which they can work on and push or update to the actual online repository if the condition for a change is met.

How might use of computer and knowledge of technology system affect personal and professional success

Answers

Answer:

social media

Explanation:

Write a program that gives simple math quizzes. The program should display two random numbers that are to be added, such as:

Project 5-11 output

The program should allow the student to enter the answer. If the answer is correct, a message of congratulations should be displayed. If the answer is incorrect, a message showing the correct answer should be displayed.

Answers

Answer:

6

Explanation:

the answer would have to be 6

Your data warehousing project group is debating whether to create a prototype of a data warehouse before its implementation. The project group members are especially concerned about the need to acquire some data warehousing skills before implementing the enterprise-wide data warehouse. What would you recommend? Explain your recommendations.

Answers

Answer:

Hmmm, what would i recommand i think you Should learn skills and become innovative  

Explanation:

Sir i'm gonna go toilet and come back

What are stored procedures? What kind of attack do stored procedures protect from? Identify two reasons why stored procedures are a good mitigation against the specific attack. g

Answers

Answer:

Stored procedures or procedures are subroutines or subprograms in SQL written by the user to accomplish a certain task. it helps to mitigate SQL injection by using markers as placeholders for data input and it streams the query statement and data separately in the database.

Explanation:

The stored procedure used in SQL is a user-defined function. Unlike built-in functions like pi(), they must be called to use them.

SQL injection in query statements is written by hackers to bypass conditions, especially when trying to gain access to other user accounts. Stored procedures use markers or placeholders to prevent this.

Write an LC-3 assembly language program to read in a two-digit decimal number whose digits add up to less than 10 and display the sum of those digits in the next line.
Sample execution (user input underlined) : Please enter a two-digit decimal number > 27. The sum of the digits = 9

Answers

Answer:

Explanation:

.MODEL SMALL

.STACK 100H

.DATA

   STR1 DB 0AH,0DH, 'THE SUM OF TWO DIGITS PRENT IN THE GIVEN NUMBER'

   FNUM DB ?

   STR2 DB ' AND '

   SNUM DB ?

   STR3 DB ' IS '

   ANS DB ?

   STR4 DB ' $'

.CODE

MAIN PROC

   MOV AX, "at" DATA       PLEASE NOTE: your "at" need to be in symbol

   MOV DS,AX                    It is because this text editor who allow the sub-

                                            mission of this answer if i use the symbol format

   MOV AH,2                       that is why put it in bold and parenthesis

   MOV DL,3FH

   INT 21H

   MOV AH,1

   INT 21H

   MOV BL,AL

   MOV FNUM,AL

   INT 21H

   MOV SNUM,AL

   ADD BL,AL

   SUB BL,30H

   MOV ANS,BL

   MOV AH,9

   LEA DX,STR1  

   INT 21H

   MOV AH,4CH

   INT 21H

   MAIN ENDP

END MAIN

Suppose that you have the following declaration:
stack Type stack(50); double num; and the input is
25 64-3 6.25 36-4.5 86 14 -129
Write a C++ code that processes this input as follows: If the number is non-negative, it pushes the square root of the number onto the stack; otherwise it pushes the square of the number onto the stack. After processing these numbers write a C++ code that outputs the elements of the stack.

Answers

Answer:

Explanation:

The code is written in C++:

#include <iostream>

#include <stack>

#include <math.h>

#include <iomanip>

using namespace std;

/*

* Supporting method to print contents of a stack.

*/

void print(stack<double> &s)

{

if(s.empty())

{

cout << endl;

return;

}

double x= s.top();

s.pop();

print(s);

s.push(x);

cout << x << " ";

}

int main(){

// Declaration of the stack variable

stack<double> stack;

//rray with input values

double inputs[] = {25,64,-3,6.25,36,-4.5,86,14,-12,9};

/*

* For each element in the input, if it is positive push the square root into stack

* otherwise push the square into the stack

*/

for(int i=0;i<10;i++){

if(inputs[i]>=0){

stack.push(sqrt(inputs[i]));

}else{

stack.push(pow(inputs[i],2));

}

}

//Print thye content of the stack

print(stack);

}

OUTPUT:

5     8     9     2.5     6     20.25     9.27362     3.74166     144     3

-------------------------------------------------------------------------

Process exited after 0.01643 seconds with return value 0

Press any key to continue . . . -

In C 11, the ________ tells the compiler to determine the variable's data type from the initialization value.

Answers

Answer:

auto key word

Explanation:

the auto keyword in c++11 can be regarded as one of the features of

“Type Inference” . It should be noted that in In C ++11, the auto key word tells the compiler to determine the variable's data type from the initialization value.

12. The best method of protecting the residential user with an Internet connection from intruders out on the Internet is to use

Answers

Answer:

Updated OS software patches

Explanation:

Firstly we need to know that patches are those software updates as well as operating system updates that addresses the vulnerabilities In a program or a products security. Software operators may decide to roll out new updates which have the power to fix performance bugs in a program as well as providing more enhanced methods of security.

What are the advantages and disadvantages of using steganography versus symmetric or asymmetric encryption

Answers

Explanation:

Steganography is a technique used in securing or hiding sensitive information by encrypting the information in a non-hidden file like a JPEG format. A major advantage of this method is that it reduces the risk of attack or break-in since the data is enclosed in a non-secure file; thereby reducing threats of any hack. One main disadvantage of this method is that the hidden message may become difficult to recover if the source file (non-secure file) used, is edited or deleted.

In symmetric or asymmetric encryption they both employ cryptographic encryption method. While symmetric encryption uses one key to encrypt and decrypt data, asymmetric encryption uses two keys (one for encryption, the other for decryption) of the data. A major advantage of using these methods is that they provide more security. Although while symmetric encryption is faster, asymmetric encryption is slower (eg using separate keys to gain access), a disadvantage.

A strategy for concealing critical information as well as ensuring its secure communication everything in non-hidden storage is steganography.

Advantage:

Because the content is contained throughout a non-secure file, the above strategy decreases the chance of an assault on classified info.

Disadvantage:

This approach has the disadvantage that concealed information might be able to retrieve if somehow the documents have been changed or deleted as of a non-secure file.

Once again to encrypt as well as decode information, symmetric encryption employs a unique key, but asymmetric encryption utilizes two different keys, something for encryption as well as someone else for decryption.

Advantage:

One such approach is superior to steganography throughout the level of protection.

Disadvantage:

Because distinct keys have been needed to get access, such techniques of asymmetric encryption are considerably slower.

Thus the approach above is correct.

Learn more about steganography here:

https://brainly.com/question/15187715

hello hello . please help me​

Answers

Answer:

#include <iostream>  

using namespace std;  

int main()  {  

 int num, check=0;  

 for(int num = 1; num<=100;num++){

for(int i = 2; i <= num/2; i++)  {

     if(num % i == 0)   {  

         check=1;  

         break;         }     }  

 if (check==0)  {       cout <<num<<" ";     }

 check = 0;

 }

 return 0;  

}

Explanation:

This line declares num as integer which represents digits 1 to 100.

A check variable is declared as integer and initialized to 0

 int num, m=0, check=0;  

This for loop iterates from 1 to 100

 for(int num = 1; num<=100;num++){

This iterates from 2 to half of current digit

for(int i = 2; i <= num/2; i++)  {

This checks for possible divisors

     if(num % i == 0)   {  

If found, the check variable is updated to 1

         check=1;  

And the loop is terminated

         break;         }     }  

The following if statement prints the prime numbers

 if (check==0)  {       cout <<num<<" ";     }

 check = 0;

 }

Write a method that reverses the sequence of elements in an array. For example, if you call the method with the array 1, 4, 9, 16, 9, 7, 4, 9, 11, then the array is changed to 11, 9, 4, 7, 9, 16, 9, 4, 1. Use one or more loops in your solution (do not use the Array Reverse method).

Answers

Answer:

The method written in Java is as follows:

   public static void ArrayReverse(int myarray[]){

       for(int index = myarray.length-1; index>=0;index--)

           System.out.print(myarray[index]+" ");

}

Explanation:

This line defines the method

   public static void ArrayReverse(int myarray[]){

This line iterates through the array from highest to least index

       for(int index = myarray.length-1; index>=0;index--)

This prints the array elements in reverse

           System.out.print(myarray[index]+" ");

}

To call the method from the main, use the following:

ArrayReverse(myarr);

However, myarr must be declared and populated as an integer array before the method is called

See attachment for illustration of the complete program (the main and the array reverse method)

Multiple Choice
Which method adds an element at the beginning of a deque?
appendleft
O insertleft
O popleft
addleft

Answers

Answer: appendleft

Explanation: Edge 2021

The method that adds an element for the information at the beginning of a deque is append left. Thus option (A) is correct.

What is an information?

An information refers to something that has the power to inform. At the most fundamental level information pertains to the interpretation of that which may be sensed.

The digital signals and other data use discrete signs or alogrithms to convey information, other phenomena and artifacts such as analog signals, poems, pictures, music or other sounds, and the electrical currents convey information in a more continuous form.

Information is not knowledge itself, but its interpretation is important. An Information can be in a raw form or in an structured form as data. The information available through a collection of data may be derived by analysis by expert analysts in their domain.

Learn more about information here:

brainly.com/question/27798920

#SPJ5

WILL MARK BRAINILY!!

Muriel's program is supposed to show flashing lights to test the user's vision, but the lights don't flash for the right
amount of time. What should Muriel do?
O assess the program
O edit the program
O debug the program
O renew the program

Answers

Answer: He/she should debug the program

Explanation: If it's not right, it's edit or renew the program.

Answer:

he should edit the program

Which item is essential to know before sketching a navigation menu flowchart?
template specifics, such as horizontal or vertical menu layout
whether or not the site will implement a search feature
all of the pages in the site and the content each page will contain
who will be using the site and the design theme selected for them

Answers

Answer:

A, template specifics, such as horizontal or vertical menu layout

Explanation:

Answer:

D. who will be using the site and the design theme selected for them

Explanation:

I am doing the exam right now.

write c++ program from 1to 100 to find prime numbers using statement.​​

Answers

#include <iostream> using namespace std; int isPrimeNumber(int); int main() { bool isPrime; for(int n = 2; n < 100; n++) { // isPrime will be true for prime numbers isPrime = isPrimeNumber(n); if(isPrime == true) cout<<n<<" "; } return 0; } // Function that checks whether n is prime or not int isPrimeNumber(int n) { bool isPrime = true; for(int i = 2; i <= n/2; i++) { if (n%i == 0) { isPrime = false; break; } } return isPrime; }

high level languages are closer to machine language than humans yes or no​

Answers

they are closer to human languages and further from machine so, no.

Answer:

yes

Explanation:

because they were built from humans

Insert the missing code in the following code fragment. This fragment is intended to implement a method to set the value stored in an instance variable.
Public class Employee
{
Private String empID;
Private boolean hourly;
) . .
_______
{
Hourly = isHourly;
}
}
A) public void setHourly(String isHourly)
B) public void getHourly()
C) public boolean getHourly()
D) public boolean setHourly(boolean isHourly)

Answers

Answer:

A)

Explanation:

In this code example the missing piece of code would be...

public void setHourly(String isHourly)

This piece of code is creating a function called setHourly which takes in one String variable as it's parameter. Based on the rest of the code, the function takes that parameter variable and places it into an instance variable called Hourly which can be used when the function is called.

Professor Gig A. Byte needs to store text made up of the characters A with frequency 6, B with frequency 2, C with frequency 3, D with frequency 2, and E with frequency 8. Professor Byte suggests using the variable length codes:
Character Code
A 1
B 00
C 01
D 10
E 0
The professor argues that these codes store the text in less space than that used by an optimal Huffman code. Is the professor correct?

Answers

Answer:

This is not true

Explanation:

The optimal Huffman code is used to encrypt and compress text files. It uses fixed-length code or variable-length code for encryption and compression of data.

The professor's character code is similar to Huffman's variable-length coding which uses variable length od binary digits to represent the word strings. The file size of the text file above is;

= 6 x 1 + 2 x 2 + 3 x 2 + 2 x 2 + 8 x 1 = 28 bits

This would be the same for both cases.

The encrypt would be the problem as the encoded and decoding of the characters B and E may cause an error.

Define a toString prototype method that returns the cat's name, gender, and age separated by semicolons.

Answers

Answer:

Following are the program to this question:

import java.util.*;//import package for user input

public class Main//defining main class

{

public static String Cat (String name, String gender, int age)//defining string method Cat that accept parameter value

{

return name + ';' + gender + ';' + age;//return parameter value

}

public static void main(String[] args) //defining main method

{

   String name,gender;//defining String variable

   int age;//defining integer variable

   System.out.println("Enter name, gender and age: ");//print message

   Scanner obx=new Scanner(System.in);//creating Scanner class object for user input

   name=obx.next();//input name value

   gender=obx.next();//input gender value

   age=obx.nextInt();// input age value

   System.out.println(Cat(name,gender,age));//print return method value

}

}

Output:

Enter name, gender and age:  

dani

Female

12

dani;Female;12

Explanation:

In the above-given code, a string method Cat is declared, that accepts three variable "name, gender, and age", inside the method return keyword is used that returns the parameter values.

In the main method, the above parameter variable is declared, which is used to input value from the user-end, and used the print method to print its return value.

write the code that writes access granted if the correct password, swordfish is entered and access denied! otherwise

Answers

In python 3.8:

if input("Enter password: ") == "swordfish":

   print("access granted")

else:

   print("access denied!")

In dreamweaver name two attributes

Answers

Answer:

Explanation:

add an id and class

what is meant by resources of computer

Answers

This question is not specific enough. However, a computer helps you listen to music, read articles and even novels, draw using online platforms, play games, etc.

Assuming int numbers[SIZE]; is initialized somehow, write a function counter() that you can send the array to, plus an extra integer, and the function will return the number of times that value is found in the array. For example, if the array of SIZE 7 contains {1,2,3,2,3,3,3}then the call
x=counter(numbers,SIZE,3); will put 4 into x.

Answers

Answer:

Explanation:

The following function is written in Java and takes in three parameters the array, its size, and the chosenNumber that will be counted. The function then creates an instance variable called Counter and loops through the given array looking for the chosenNumber. Every time that the number is found in the array it adds 1 to the counter. Once the loop is done it returns the total value of the counter variable.

 public static int counter(int[] numbers, int Size, int chosenNumber) {

       int counter = 0;

       for (int x = 0; x < Size; x++) {

           if(numbers[x] == chosenNumber) {

               counter++;

           }

       }

       return counter;

   }

Many electronic devices use a(n) ?, which contains all the circuit parts in a miniature form.

Answers

Answer:

An integrated circuit is a single, miniature circuit with many electronically connected components etched onto a small piece of silicon or some other semiconductive material. (A semiconductor is a nonmetallic material that can conduct an electric current, but does so rather poorly.)

Explanation:

Many electronic devices use a(n) integrated circuit which contains all the circuit parts in a miniature form.

The use of  integrated circuit is known to be a kind of a single, miniature circuit that has a lot of electronically connected parts that are designed onto a small piece of silicon or semi conductive material.

A lot of electronic components are known to be capacitors, inductors, resistors, diodes, transistors and others.

Learn more about electronic devices from

https://brainly.com/question/11314884

turns on her laptop and gets the error message "OS NOT FOUND." She checks the hard disk for damage or loose cable, but that is not the case. What could be a possible cause?

Answers

It needs an Operating System like a cable or something that will help it operate look for more and double check

________________ are piece of programs or scripts that allow hackers to take control over any system.

Answers

Answer:

Exploits

Explanation:

Exploits can be explained to be a piece of programmed softwares or scripts that can give hackers the opportunity to take control over any system and exploit this system's vulnerabilities. The vulnerability scanners that hackers use includes, Nessus, Nexpose e.tc.

They use these scanners above to search for vulnerabilities.

active cell is indentifed by its thick border true or false​

Answers

Answer:  It's identifed by its thick border so its true

Answer: true is correct
Other Questions
How can you identify a linear nonproportional relationship from a table, a graph, and an equation? help! Container ships sail all over the world to deliver cargo from port to port. Even though such ships canweigh as much as 400,000 tons, they stay afloat because of the buoyant force exerted on them by thewater.Below is a diagram of a container ship floating in the water. Its weight is represented by a downwardarrow and a negative number because the weight exerts a downward force on the boat. The buoyantforce of the water balances out the weight of the ship, so the ship can float. Describe an arrow thatwould represent the buoyant force. What value should be associated with this arrow? Explain how thissituation relates to the concept of combining a number with its additive inverse. The scale on a map says that 4 cm represents 5 km. What distance on the map (in centimeters) represents an actual distance of 4 km? A high school basketball team scored 60 points in last weeks game. The team scored a total of 27 baskets; some were two-point shots and some were three-point shots. How many two-point shots did they make? How many three-point shots did they make?x + y = 27,2x + 3y = 60What is the solution of the system of equations, and what does it represent?options:(6, 21); 6 two-point shots and 21 three-point shots(6, 21); 6 three-point shots and 21 two-point shots(21, 6); 21 two-point shots and 6 three-point shots(21, 6); 21 three-point shots and 6 two-point shots on a beautiful day there are 65 cars in the beach parking lot 26 more cars park in the parking lot before noon but 17 car slept how many cars are in the beach parking lot Anyone know the answer to this? There are 32 Drama DVD's. The ratio of Drama DVD's to Mystery DVD's is8:5. How many Mystery DVD's are there? what would happen to new orleans lose if slavery was abolished Read this excerpt from a works cited page for an informative essay.Works CitedFerry, Christopher. Racial Change in Civil War America. New York: Sunspot Press, 2011. Print. Underground Railroad. World Book Online. 2012. Web. 20 December 2012. .Which best describes the two citations? 5. Briefly explain the first steps towards economic imperialism in China. how do i solve this? find the equation of the line that passes through the point (1,8) and is parallel to the line y=3x+6. write the equation using the slope-intercept form. -Democracy was introduced in Athens-The Romans created a representative democracy-the British implemented representative democracy-the United States has the longest running democratic republic in theworld.The list above describes the geographic concept of -a) cultural divergence b) spatial diffusionc) spatial assimilationd) human-environment interaction Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC 5x-7=3 whats the answer An idea,theme,or image that begins and ends a text can be referred to as a New- Muhammad taught the belief that there is only one god and believed that the other Two Semitic religions (Judaism and Christianity) were ________.not relevant to current society.valid revelations from God but were distorted by man.not truly monotheistic religions.believed in the wrong God. What is one conclusion that can be synthesized from this selection?A) Students are usually hesitant to express their opinions to teachers. B) School administrators are out of touch with the needs of their students. C) Guidance counselors can offer helpful advice about a variety of life issues. D) Teachers are reluctant to listen to students' opinions about the books they teach. 2- some of your mates like Chinese cousin, don't they?Why we use some of at the first of the sentence!! Galaxy B moves away from galaxy A at 0.577 times the speed of light. Galaxy C moves away from galaxy B in the same direction at 0.731 times the speed of light. How fast does galaxy C recede from galaxy A?