Write the name of tourism sector related occupation and clarify its importance with reference to Nepal.​

Answers

Answer 1

Answer:

one among the main importance is the foreign exchange of currency since it has a very higher exchange value compared to other tourism spots. exports to other countries from Nepal are very cheap and several good are produced on a large scale. ... cheap way of lifestyle attracts a lot of tourists all over the world.

Explanation:

the top should explain as much as I think.


Related Questions

T/F There may be occasional reasons to go into debt, like real emergencies.

Answers

True, but could you elaborate on this ?

The advantages of personal financial planning include:
a. Increased effectiveness in obtaining, using and protecting your financial resources
b. Increased control of your financial affairs by avoiding excessive debt and bankruptcy
c. Improved personal relationships resulting from better communicated financial decisions
d. All of these
e. None of these

Answers

Answer:

d. All of these

Explanation:

Personal financing is the process of organizing and managing an individual or household's income to achieve set financial goals. It involves managing personal finance activities such as income, expenditure, savings, and investments. The primary objective of personal finance is to assist individuals maximize their current incomes and make future plans. As a result, they can achieve both short term and long term goals.


What are the two factors used to calculate productivity?
A. Goods produced and number of customers
B. Resources invested and goods lost
C. Goods produced and employees hired
D. Goods produced and resources invested

Answers

Goods produced and resources invested re the two factors used to calculate productivity.

How productivity is measured?

Productivity is measured from different factors in the organization like the profit generate from the sales, number of customer increases, the amount of money invested in the company, the goods that are consumed of sell within span of time and others.

Thus, option D is correct.

For more details about productivity is measured, click here:

https://brainly.com/question/12693045

#SPJ2

Answer:

Goods produced and resources invested

Explanation:

Explain why flexible price policy is not price discrimination.

Answers

Answer:

see below

Explanation:

Flexible pricing is a strategy that leaves room for negotiation between the seller and buyer. In this strategy, the seller does not set a fixed price. They set a range in mind, allowing for negotiations with the buyer. In flexible pricing, a seller will have the minimum amount they can accept and a maximum amount they can charge.

Price discrimination is a pricing strategy where a producer sets different prices for the same product to different groups of consumers.  The producer will segment or group customers depending on various traits such as social status or income levels.  A price will be set for each category depending on the producer's perception of their ability to pay.

In price discrimination, the price is already set for different categories of customers, but in flexible pricing, every customer has the opportunity to negotiate for the best price.

Pretend you make $500 worth of purchases on your credit card, your bill arrives saying your minimum payment due is $20, and you pay that amount before the due date. Describe how credit card interest works and what you can expect to happen next

Answers

Explanation:

One may ask: what is a credit card? In simple words, a credit card is a payment instrument (plastic card) that allows the cardholder to spend money they don't personally own in their account.

Hence, A typical credit card statement would inform me that I made a purchase worth $500, stating

The Payment Due Date: For example, it may be written that I must have made the credit balance by 31/12/XX. (Note, Failure to do so would in most cases lead to accruing of interest)The Minimum payment due: In this case, the $20 signifies a minimum payment that is significant enough to be recorded till the entire $500 balance is covered. However, it is not intended that only that amount be paid each month. If it were to be it would take me 25 months or 2 years 1 month ($500/$20) to complete the balance; which is not the best option likely considering the accrued interest to be paid.

Click this link to view the OOH qualities for Roofers. According to the OOH, what are common qualities Roofers need? Check all that apply.

balance
leadership
physical strength
stamina
sales skills
unafraid of heights
computer repair skills

Answers

1346

llvllf,tgrmgtopmopmtoptrmomopgtmopwgmg

Answer:

A.) balance

C.) physical strength

D.) stamina

F.) unafraid of heights

NOTE: if it's easier for you numbered, the answer are numbers 1, 3, 4, and 6.

what are creative products example flying water bottle

Answers

Answer:

Tesla’s self driving car

Or the waterproof speaker for showers

Explanation:

One common advantage of a long-term investment is

higher return.
no risk.
higher liquidity.
no liquidity.

Answers

Answer:

higher return.

Explanation:

When it comes to investing, time is is a good friend. Long-term investments are more profitable compared to short-term investments.

Time overcomes market volatility. Naturally, markets move up and down. On some occasions, the draw-downs may be big and rapid, which may erode short-term gains. Staying in the market longer allows the market to correct its self and return to profitability.

By taking long term investments, the investor enjoys the benefits of compound interests. The investment earns interests on interests earned, which increases the investor's wealth rapidly.

One common advantage of a long-term investment is a higher return. Thus, option A is appropriate.

Investments are made to create income or profit in the future. They are typically made with money. In plain English, it entails investing money in a business or asset with the hope of receiving a return on the investment.

Investments are traditionally defined as "commitments of resources to realize benefits in the future." If money is involved, an investment represents a "commitment to receive more money later."

Thus, option A is correct.

Learn more about the Investments here:

https://brainly.com/question/31781807

#SPJ6

Alejandro works nights at a restaurant. His job is to prepare drinks for customers. He serves drinks directly to customers who sit nearby, but he also makes drinks for waiters to take to customers throughout the restaurant. Alejandro is most likely a...

Mei works long hours in a restaurant. She plans the menu for the restaurant, supervises kitchen staff, and cooks food. Mei is most likely a...

Answer: Alejandro is a bartender and Mei is a Chef or cook

Answers

Answer:

Alejandro is a bartender and Mei is a Chef or cook

Explanation:

He wrote the correct answer but it wouldn't pop up first so I answered it.

Answer:

the guy above is correct.

Explanation:

What kind of firms manufacture and provide goods and services to consumers?

Answers

Answer:

Producers eg Bakeries, Motor assemblies and Consulting firms

Explanation:

There are three different groups in the economy. These are Customers, Producers and the Government.

Firms that manufacture and provide goods and services to consumers are called producers. Producers play a role in economics by deciding on what to produce and how to produce. This is because they use and control factors of production such as labor and machinery.

Answer:

producers

Explanation:

plato

The economic goal for most nations is to achieve a

Answers

Answer:

National economic goals include: efficiency, equity, economic freedom, full employment, economic growth, security, and stability.

The economic goal for most nations is to achieve a mutually beneficial trade balance.  

What is economics?

Economics can be defined as the study that is brought done with the relationship of the production or making of a product. It also depends upon the demand and conception theory related to price.

It is a way to find out the economic stability of the market also how the various resources are being used and to find an alternative option for the same

A mutually beneficial trade balance would employees that the mother country and the foreign country would get equal opportunities to on more amount of money and have lots of resources and technology that could be exchanged.

It will also improve the opportunity cost that the business, individual, or nation that can now get with import and export.

Learn more about economics, here:

https://brainly.com/question/28208676

#SPJ2

Consider Emily's balance statement:

Emily's supervisor asked her to revise the balance statement. What does she need to revise? Why?

A B
1 Assets FY 2014
2 Accounts Payable $2,000
3 Wages $75,000
4 Taxes Payable $10,000
5 Mortgage Payable $15,000
6 Total $102,000
7
8 Liabilities FY 2014
9 Cash $800
10 Inventories $36,000
11 Investments $25,000
12 Accounts Receivable $61,800
13 Total $122,800
14
15 Balance -$20,800

Answers

Answer:

see below

Explanation:

A balance sheet is prepared following the accounting principles of assets equal to liabilities plus equity. Assets are left side while equity and liabilities on the other.

Assets are valuable that a business owns. Liabilities refer to the debts or loans of the business. It is what the business owes others. Equity is the owner's contribution to the business.

In this balance sheet,  Emily has confused assets and liabilities.

The column labeled as liabilities represents assets. She should change that. This column should be the topmost column.  She has interchanged the labels for liabilities and assets. The difference between assets and liabilities should be equity.

Answer:

Emily has mixed up the assets and liabilities. All the cells under “assets” are really liabilities and vice versa.

Explanation:

A new business should be based on an entrepreneur's individual interests because the entrepreneur must...
A. have sufficient confidence to succeed.
B. be willing to take personal responsibility.
C. have enough determination to work alone.
D. dedicate as many hours as needed to the work.
Will mark brainliest!

Answers

Answer:

A.................

Explanation:

look at my pokemon

Answer:

D

Explanation: because i said so but it might not be right

Maggie is a high school senior who just received her college financial aid
award packet in the mail. While her mom watches, Maggie excitedly opens the
envelope. She sees that she has received grants, scholarships and student loans.
The thought of taking on debt makes Maggie a little nervous. Her mom tells
her that student loans are normal and that she will have more time to focus on
studying rather than having to work a part-time job in college. Is her mom’s
advice the same as the advice you’d give her? Explain what your advice would be.

Answers

Answer:

I would definitely give the same advice. The income potential for a college graduate far exceeds those of a high school graduate. I would be determined to graduate from college, good get a great job and get the loans paid off.

Explanation:

With a great education and a great job it shouldn't take long to get the loans paid off

Businesses are important to a free enterprise system because they?

Answers

Answer:

A.provide consumers with goods and services

Multiple choices

A.provide consumers with goods and services

B. make legal decisions related to property rights.

C. prevent entrepreneurs from taking to many risks.

D. enforce economic regulations to protect citizens. ​

Explanation:

Production of goods and services is done by the private sector in a free enterprise system. A majority of the factors of production belong to the private sector. The government does not actively participate in economic activities.

In the free enterprise system, the private sector produces and distributes goods and services in the economy. In other words, all the goods and services consumed in a free enterprise system are produced by the private sector.

can a 14 year old work? where?

Answers

Answer:

Yes!!

Explanation:

They can work at Chick-Fil-A!!

They can be a babysitter

wash cars

and more!

Which of the following technologies makes it possible for employees to stay
in constant contact with the office?
O A. Company letterhead and envelopes
B. A list of all employee phone numbers
C. The Internet
D. A training manual about office policies

Answers

Answer:

C. The Internet

Explanation:

The internet has significantly improved communication in modern-day offices. It has enabled real-time transmission of messages to and from intended recipients. Through the internet,  employees can access office files and systems from home.

Internet technology has made it possible for an employee to work from home and stay in touch with colleagues in the office or other locations.

HELP


An example of soft skils that conveys ideas and influences change.

A.) Personal accountibility
B.) Hard skills
C.) Self-motivations
D.) Communication

Answers

I am pretty sure it is C

Leah has $300 in her checking account and her first bank credit card. She wants to purchase a couch for $250, and Christmas gifts for $200. What are her options? What should she do?

Answers

Answer:

see below

Explanation:

Leah can choose between the following two options.

Option 1:

Leah can withdraw $250 from her checking account and pay for the couch in cash. If she has a debit card on her checking account, she can use it to pay for the couch. The Christmas gift costs less than the couch. She can use a credit card to pay for the gift. Since credit card transactions are debts, she will incur a lower amount of debt.

Option 2:

Depending on her credit card limit, she can pay for the two items on credit. Once the credit statement is generated, she can use the money in her checking account to offset part of the credit card balance.

Answer:

Leah can withdraw $250 from her checking account and pay for the couch in cash. If she has a debit card on her checking account, she can use it to pay for the couch. The Christmas gift costs less than the couch. She can use a credit card to pay for the gift. Since credit card transactions are debts, she will incur a lower amount of debt.

Explanation:

Which of these is a financial service offered to business owners?
A.) Core Competencies
B.) Dividend payments
C.) Insurance
D.) Operational efficiencies

Answers

Answer:

C.) Insurance

Explanation:

Financial services include the services offered by banks, insurance companies, investment houses, real estate brokers, lenders, and finance companies. These services have a commercial aspect of either saving (pooling of resources), borrowing, or investing.

In this list, insurance is a financial service. Insurance is the purchase of protection or cover against risks. Insurance companies undertake to provide financial compensation in the event of loss arising from the risk insured against in exchange for premiums. Insurance companies pool resources together to compensate a member who has suffered a financial loss.

A milestone occurring in which of these increments of time will be the farthest to the left on a timeline? 4 months 5 days 3 weeks 2 years

Answers

Answer:

A milestone occurring in 3 years of increments of time will be the farthest to the right on a timeline.

Explanation:

Here in the given options the increments of time are given.

Here, 3 years > 8 months > 12 weeks > 60 days.

Because, 3 years ≡ (3 × 365) days ≡ 1095 days

8 months ≡ (8 × 30) days ≡ 240 days

12 weeks ≡ (12 × 7) days ≡ 84 days.

Therefore, a milestone occurring in 3 years of increments of time will be the farthest to the right on a timeline.

Select the correct answer.
Why are borrowing and lending money important in the United States?
A.
They ensure that people and businesses can buy what they need.
B.
They ensure that money is distributed equally and fairly to all.
C.
They ensure that the government's financial regulations are followed.
D.
They ensure that the nation can avoid an economic recession.

Answers

Answer:

A.

They ensure that people and businesses can buy what they need.

Explanation:

Borrowing involves requesting and receiving a huge sum of money in a lump sum. Households and firms borrow from lenders to finance business expansion or domestic consumption.

In the economy, borrowing is significant as it facilitates the acquisition of start-up capital, capital goods, and household developments. Without borrowing and lending, these investments and consumption would not be possible as they require large sums of money to initialize. If firms and households depended on savings for capital and consumption expenditure, the rate of economic growth would be very slow. It would take many years to achieve the substantial amount needed for expansion and development projects.

Answer:

A. They ensure that people and businesses can buy what they need.

Hope this helps!

Explanation:

Project: Current Event - Business Ethics
This project will focus on writing about a current event in ethics in the business world. The task is to first find an article that deals with business ethics and then write a summary of the article. In your summary, you should discuss what the ethical issue is and give your opinion of how the issue was handled. During this project, you'll accomplish the following:

Objectives

Find an article that deals with business ethics and write a summary of the article.
Current Event

Directions:

Use the Internet to find an article that deals with ethics in the business world. Once you have found and read your article on business ethics, record your summary using the following format. Upload it below.

Paragraph #1 - Summary of article including the link
Paragraph #2 - How it relates to entrepreneurship
Paragraph #3 - Your opinion of how the issue was handled
Question # 1

Long Text (essay)
Upload your three paragraphs here:

Paragraph #1 - Summary of article including the link
Paragraph #2 - How it relates to entrepreneurship
Paragraph #3 - Your opinion of how the issue was handled

Answers

Answer:

Signs of the boom are everywhere. Over 500 business-ethics courses are currently taught on American campuses; fully 90% of the nation’s business schools now provide some kind of training in the area. There are more than 25 textbooks in the field and 3 academic journals dedicated to the topic. At least 16 business-ethics research centers are now in operation, and endowed chairs in business ethics have been established at Georgetown, Virginia, Minnesota, and a number of other prominent business schools.

And yet, I suspect that the field of business ethics is largely irrelevant for most managers. It’s not that they are hostile to the idea of business ethics. Recent surveys suggest that over three-quarters of America’s major corporations are actively trying to build ethics into their organizations. Managers would welcome concrete assistance with primarily two kinds of ethical challenges: first, identifying ethical courses of action in difficult gray-area situations (the kind that Harvard Business School Lecturer Joseph L. Badaracco, Jr. has described as “not issues of right versus wrong,” but “conflicts of right versus right”); and, second, navigating those situations where the right course is clear, but real-world competitive and institutional pressures lead even well-intentioned managers astray.

The problem is that the discipline of business ethics has yet to provide much concrete help to managers in either of these areas, and even business ethicists sense it. One can’t help but notice how often articles in the field lament a lack of direction or poor fit with the real ethical problems of real managers. “Business Ethics: Where Are We Going?” asks one title. “Is There No Such Thing as Business Ethics?” wonders another. My personal favorite puts it wryly, “Business Ethics: Like Nailing Jello to a Wall.”

Explanation:

Answer:Signs of the boom are everywhere. Over 500 business-ethics courses are currently taught on American campuses; fully 90% of the nation’s business schools now provide some kind of training in the area. There are more than 25 textbooks in the field and 3 academic journals dedicated to the topic. At least 16 business-ethics research centers are now in operation, and endowed chairs in business ethics have been established at Georgetown, Virginia, Minnesota, and a number of other prominent business schools.

And yet, I suspect that the field of business ethics is largely irrelevant for most managers. It’s not that they are hostile to the idea of business ethics. Recent surveys suggest that over three-quarters of America’s major corporations are actively trying to build ethics into their organizations. Managers would welcome concrete assistance with primarily two kinds of ethical challenges: first, identifying ethical courses of action in difficult gray-area situations (the kind that Harvard Business School Lecturer Joseph L. Badaracco, Jr. has described as “not issues of right versus wrong,” but “conflicts of right versus right”); and, second, navigating those situations where the right course is clear, but real-world competitive and institutional pressures lead even well-intentioned managers astray.

The problem is that the discipline of business ethics has yet to provide much concrete help to managers in either of these areas, and even business ethicists sense it. One can’t help but notice how often articles in the field lament a lack of direction or poor fit with the real ethical problems of real managers. “Business Ethics: Where Are We Going?” asks one title. “Is There No Such Thing as Business Ethics?” wonders another. My personal favorite puts it wryly, “Business Ethics: Like Nailing Jello to a Wall.”

What is the matter with business ethics? And more important, what can be done to make it right? The texts reviewed here shed light on both questions. They point to the gulf that exists between academic business ethics and professional management and suggest that business ethicists themselves may be largely responsible for this gap.

Far too many business ethicists have occupied a rarified moral high ground, removed from the real concerns and real-world problems of the vast majority of managers. They have been too preoccupied with absolutist notions of what it means for managers to be ethical, with overly general criticisms of capitalism as an economic system, with dense and abstract theorizing, and with prescriptions that apply only remotely to managerial practice. Such trends are all the more disappointing in contrast to the success that ethicists in other professions—medicine, law, and government—have had in providing real and welcome assistance to their practitioners.

Does this mean that managers can safely dismiss the enterprise of business ethics? No. In the past year or two, a number of prominent business ethicists have been taking stock of their field from within. Much like managers trying to reengineer their companies’ business processes, they have called for fundamental changes in the way the enterprise of business ethics is conducted. And they are offering some promising new approaches of value to both academic business ethicists and professional managers.

What follows, then, is a guide to business ethics for perplexed managers: why it seems so irrelevant to their problems and how it can be made more useful in the future.

Revenue, Expense, and Drawings are all examples of owner’s equity accounts.

Answers

Answer:

True

Explanation:

Equity is the owner's interest in a business. It is made up of the owners' contribution plus any gains or losses realized from the business.

Equity is increased by additional capital or when the business makes a profit. It decreases when the owner makes some drawings or when the business incurs losses.

Equity accounts include drawing because they reduce equity. Revenue account increases profits and capital and expenses accounts that reduce equity.

What inspired Selfridge to ensure that customers in his store could browse at their leisure?

Answers

Answer:

the strict policies at other stores that took away the pleasure of shopping inspired Selfridge to ensure that other customers at his store could browse at their leisure

The worst economic time of the last century was during_____.
A.) The Great Recession
B.) The Great Depression
C.) The Industrial Revolution

(B. is wrong, I took the test)

Answers

Answer:

A. The Great Recession

Explanation:

I hope this helped

Compare these costs.
48 paper plates for $2.99
75 paper plates for $3.99

Answers

Answer:

the $3.99 one cost less per unit

Explanation:

the $2.99 = $0.06 per unit

the $3.99 = $0.05 per unit

QUESTION 6 of 10: Your staff consists of 7 cashiers, 3 stockers, and 5 salespeople. The cashiers are paid $12 per hour;
paid $10 per hour; the salespeople are paid $15 per hour. What is the average hourly wage across all your workers?

Answers

Answer:

$12.6 per hour

Explanation:

There are total of 15 workers, ( 7 + 3 + 5).

The total earning per hour is as below

Cashiers : 7 x $12 = $84

Stockers : 3 x $10 = $30

Salespeople : 5 x $15 = $75

Total earning per hour

= $84 +$30 +$75

=$189

Average earning = $189/15

=$12.6 per hour

A country decides to impose a tax to reduce the external cost created by carbon emissions. Prior to the tax,____
and as a result of the tax,_____
A. marginal cost equals marginal benefit, marginal cost will be less than marginal benefit
B. there was no deadweight loss; a market failure occurs because taxes reduce production
C. market failure occurred; the deadweight loss is reduced
D. market failure occurred producer surplus will equal consumer surplus
E. producer surplus equals consumer surplus; marginal cost equals marginal benefit

Answers

Answer:

C. market failure occurred; the deadweight loss is reduced

Explanation:

Carbon emissions produce externalities: they affect others not involved in the transaction, in the form of pollution, or in the form of contributions to climate change. Externalities are a form of market failure because in this situation, the market fails to allocate resources in a way that produces the best social benefit (the Pareto Optimum).

To correct the externality, a tax is imposed, this type of tax is known as a Pigouvian tax. The Pigouvian tax reduces the deadweight loss caused by the externality.

Mark wants to be a web designer. He recently found out that a local company is
providing a certification program in web design. The program is free and if he
does well, the company will offer an entry-level position upon completion. Mark
likes the idea of hands-on learning and has never been excited about college.
He would rather avoid having to sit through the basic freshman and sophomore
college classes and go directly into doing what he loves. This opportunity will
allow him to do just that. The only problem is that his parents think that a four-
year college education is the only way to secure a good income. Are his parents
right? Explain what you think Mark should do in this situation.

Answers

Answer:

No his parents aren't exactly right, a college is far more expensive, not only money wise, but also time wise. These programs/bootcamps can get you started in web design, and make sure you pass with a certificate and fully understand the topic, and they only take around a 2 - 5 months.

Other Questions
-8t = 64Answer:t = ?Answer the ? Mark pls How did technology contribute to the expansion of European power through imperialism? Hey guys can one of you help me pls its only one small question Does (3,4) satisfy the equation-5x + 2y = 23? aA stone 'X' of mass 2 kg is at the height of 2 m from the ground levelAnother similar stone 'Y' of mass 4 kg is at the height of 4 m from the groundlevel. What is the difference between their potential energy?un minutes Calculate The plugin that changes Jenkins to use green balls instead of blue for successful builds is ________. Decide whether the pronunciation is correct or incorrect. Drag and drop the word into the correct column.encourage en-KUR-Correct PronunciationIncorrect Pronunciationexplain ik-SPLAYNjustity JUHS-tun-tahyplayful PRET-tuhmspecial SLISP-uhtheroic hi-ray-IT An architect draws a plan for a wheelchair ramp on the plan, the ramp is 2cm high and 24cm long what might the dimensions of the actual ramp be (use equivalent ratios) slope of 2,11 and 5,2 Hey guys please help!! What is the definition of fourteen points? breakout edu keyla winter wonderland questioni CAN'T DO THIS I've tried so many times how do you do it What became of most of the Central powers colonies after World War I? They became independent nations. They remained colonies of Central Powers nations. They became League of Nations mandates. They were run by the League of Nations. Express 10 : 12 as a decimal.(Round to the nearest hundrerdth) TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA Why did debates among civil rights activists increase after 1965? What were the causes and effects of these debates? (Look into SNCC, CORE, Black Power, and the SCLC, Stokeley Carmichael, Huey Newton &/or Bobby Seale) 1 1 The slope of the line below is -1/7. Write a point-slope equation of the lineusing the coordinates of the labeled point. What might be the consequences of your choice? Political: Economic: Social: What are the two ways a subduction zone can be generated? The local lighting company found that 2 out of every 10 lightbulbs was defective. Ifthere are a total of 120 bulbs in a box, how many can they predict will be defective?