WILL MARK BRAINLIEST!!: Answer the following in several complete sentences:

Explain how the following concepts apply to the Little Albert experiment: stimulus generalization, stimulus discrimination, extinction, and spontaneous recovery.

Answers

Answer 1

Answer:

How the Stimulus Generalization Process Is Conditioned

Explanation:

In the conditioning process, stimulus generalization is the tendency for the conditioned stimulus to evoke similar responses after the response has been conditioned. For example, if a child has been conditioned to fear a stuffed white rabbit, it will exhibit a fear of objects similar to the conditioned stimulus such as a white toy rat.

One famous psychology experiment perfectly illustrated how stimulus generalization works.


Related Questions

hard question plz help

Answers

Answer:

create economic reform

Explanation:

Positive and Negative effects of spanish colonization on the philippines

Answers

Answer:

The looting & plunder of cultural treasures, the systematic destruction of native civilizations and as well as colonial mentality umong modern Filipinos are probably some of the most negative effects of the Spanish colonization.

Explanation:

hope it helps you.

have a wonderful day!

Compare the emergence of advanced civilizations in Meso and South America with the four early river valley civilizations.

How were the Aztecs and ancient Egyptians alike?

Answers

Answer:

Explanation:

Both civilizations had a social class system. The Aztecs and ancient Egyptians were great civilizations and had a very strict social structure. Aztecs had the nobles who were leaders, priests, and officials in the government, then they had the commoners who would be farmers or artisans, and then they had the slaves or serfs. For Ancient Egypt on the top was the Pharoh, then the government officials, then came the soldiers for protection, scribes that kept records and other work, merchants, peasants, and at the very bottom there were slaves.

Answer:

1 example: teaching of cuneiform

Explanation:

Hope this helps! :)

What were the causes and effects of political and economic changes in Latin America in the late 1800s and early 1900s?

Answers

Answer:

Explanation:

It increased prosperity in Latin America caused by increased exports led to the growth of a middle class that sought reform and looked to the United States as a model; the causes of the Mexican Revolution and how the middle class and peasants in Mexico affected change during and after the revolution; U.S. involvement in Latin America and how this may have influenced the Mexican Revolution and the rebellion in Panama.

It grew a middle class that sought reform and looked to the United States as a model due to increased prosperity in Latin America brought on by increased exports; the reasons behind the Mexican Revolution and how the middle class and peasants in Mexico influenced change both during and after the revolution.

What is revolution ?

When the populace rebels against the government, usually because of perceived oppression (political, social, or economic), or governmental incompetence, a revolution (Latin: resolution, "a turn around," or "a fundamental change in political authority and political organization") takes place.

Revolutions have taken place throughout human history, and they can differ greatly in terms of their tactics, length, and underlying ideologies. Major alterations in culture, the economy, and sociopolitical institutions are the result of their actions, which typically follow perceptions of excessive

The current knowledge of this complicated phenomenon has greatly benefited from the many opposing hypotheses that have emerged through several generations of scholarly study on revolutions.

To know more about culture

https://brainly.com/question/14726265

#SPJ2

6. How would you characterize the actions of these gods?

Answers

Answer:

If it were Hera I would say her actions following the birth of Hercules would be characterized as Jealous and Angry

Explanation:

just an example

How does lumumba describe belgian colonialism?

Answers

Answer:

The speech at the ceremony of the proclamation of the Congo's independence, was just a  short political speech given by Patrice Lumbago at the ceremonies making the independence of the Republic of Congo from Belgium.

Lumumba, the first Congolese Prime Minister, who gave the adress during the official independence commemorations at the Palais de la nation in Léopoldville.

The ceremony was intended to mark the harmonious end of Belgian rule which was attended by both Congolese and Belgian Dignitaries, including King Baudouin.

Lumumba's speech, which itself was unscheduled, and it was in a large part of a response to Baudouin's speech which was argued that the end of colonial rule in the Congo has been depicted as the culmination.  

The speech itself has since been praised for its use of political rhetoric, and is considered a landmark moment in the independence of the Congo.

Explanation:

Which effects of World War 1 helped the rise of socialism in Russia? Select Three Options.

1. Food and other resources were scarce in Russian Cities.

2. Workers protested the government and politics.

3. Citizens wanted revenge for their defeat in the war.

4. Workers wanted to play a greater role in ruling Russia.

5. Citizens resented the government and the war.

Answers

Answer:

1, 2, 5 / A, B, E

ワンツーとファイブ

Uno due e cinque

一二五

Uno, dos y cinco

Hope this helped! <3

The effects of World War 1 helped the rise of socialism in Russia, Was Food and other resources were scarce in Russian Cities, Workers protested the government and politics, and Citizens resented the government and the war.

What is government?

The term government refers that the system which was governed by a state or a country in it, we see there are different governments are being there in states the government is made by the people and govern for the people also in it. There is a system being made and under the system, the government is being run.

The movement That was declared before the war was the socialist, By the war, the mean workers are killing each other. in the interests of their bosses. Once the war was declared, most socialists and most of trade unions decided to back the government of their country and support the war.

Therefore, option (B) is correct.

Learn more about the government here:

https://brainly.com/question/16940043

#SPJ5

What goes around and around and around in the Circular Flow Model?

a-resources
b-Time
c-goods and services
d-money

Answers

Ancwer is , A resources


Explanation is , What do the two loops in the circular flow model represent? One loop represents the flow of resources and goods/services. The second loop represents the flow of money between the households and firms. ... The second loop represents the flow of money between the households and firms.

Answer:

c-goods and services is the answer.

How was the roman empire and republic different?

Answers

Answer:

The Republic was ruled by elected representatives and the Roman Empire was not.

Explanation:

Why was Germany able to defeat France so quickly in World War II

Answers

Answer:

Because  German army developed the Blitzkrieg tactics.

I hope this helps

Enjoy the rest of this day

During WWII, Germany was able to defeat France by using the Blitzkrieg tactics on them.

What was WWII?

WWII was the second most warfare happened between the powerful countries of that time starting from the year 1939 with its ending in 1945.

The blitzkrieg tactics were used by the military troops of Germany which was concerned with hitting the weaker sections of France by initiating mobile attacks on them. This led to devastation and destruction of France in highly manner.

Therefore, the use of blitzkrieg tactics helped the Germany in defeating France very easily and in quick manner.

Learn more about WWII in the related link:

https://brainly.com/question/27112836

#SPJ2

How did the separation of Salem Village from Salem Town cause more strife between the communities

Answers

Answer:

Salem Town and Salem Village were the same political unit, but the village was much poorer and rural. Salem Town was getting the food and taxes from the village, so when they asked for separation the conflict began. This escalated with the bewitching accusation of the wealthy families that benefited from the bad status of Salem Villagers.

Explanation:

Salem Village and Salem Town used to be the same political unit, although economically and socially they were very separated. Salem Village was mostly rural land focused on farming and its inhabitants were rather poor. On the other hand, Salem Town presented more sophisticated, wealthy, and prosperous, while getting the food and taxes from the village’s crops.

The conflicts between the two parts of the settlement were often until finally, Salem Village started to urge for the separation from the town in the sense of politics and the church. Salem Town did not want this in fear they won’t have enough food and tax money. Reverend from the town started to spread the idea that there was a devil in the Salem Village.

Reverend's daughters soon became sick and the cause was rumored to be bewitching by the Reverend’s slave. Soon, many women in the Salem Town were accused of being witches. These women were often wealthy, living in good families, and had higher status than most. By accusing these families, their land would be taken.

Therefore, we can see that the property and revenge because of the disbalance had to do with the infamous witch trials.

im not smart help me :)
What role did de Boré play in the Louisiana colony?
A. He was the first governor of Louisiana.
B. He was the first mayor of New Orleans.
C. He created new rights for enslaved workers.
D. He led the largest slave revolt in US history.

Answers

Answer:

The answer is B he was the first mayor of New Orleans

Explanation:

James Wilkinson was the first governor of Louisiana.

And I don't think he was involved with the other two answers.

i will give the crown

Stilt houses protect from:

heat
enemies
water
high winds

Answers

Answer:

Water

Explaination:

Answer:

Water

Explanation:

This map shows the Middle East around 1600. Which region was ruled by the
Mughal emperor?

Answers

Answer:

D

Explanation:

the Mughal empire was located in India

Hope this helps :)

Answer:it's region D

Explanation:

4 of 6
Which of the following is NOT an example of a retail payment?
a. An auto debit from your bank account to pay your mortgage
b. Paying your power bill online
Co. Purchasing a meal at a restaurant with your credit card
d. A social security payment made by the U.S. Treasury

Answers

D I just took tha quiz
“Just reaching the 20 mark”

The Nile River affected Nubian and Egyptian civilizations by: O A. allowing them to trade goods. B. giving them huge amounts of gold and silver. O C. preventing them from farming. O D. destroying their largest monuments. SI​

Answers

Answer:

Correct answer is: A. allowing them to trade goods.

Explanation:

A is the correct answer as this two civilization were able to connect themselves, to trade and spread even their culture to other regions.

B is not the correct answer because Nile didn't gave them this territories, but it actually provided them to trade these gods across the river itself.

C is not correct as Nile actually allowed them to farm, not the other way.

D is not correct as Nile didn't affect this civilizations i

Answer:

a

Explanation:

In revising the federal system we ought to inquire 1. into the properties, which such a government ought to possess, 2. the defects of the confederation, 3. the danger of our situation & 4. the remedy.The Character of such a government ought to secure 1. against foreign invasion, 2. against dissensions between members of the Union, or seditions in particular States, 3. to procure to the several States various blessings, of which an isolated situation was incapable, 4. to be able to defend itself against encroachment, & 5. to be paramount to the state constitutions."-Edmund Randolph, as recorded in James Madison’s journal, 1787Based on the text, what statement would the author most likely agree with?

Answers

Answer:

Stronger central government

Explanation:

Edmund Randolph, the former United States Secretary of State wrote in James Madison’s journal, 1787 the various shortcomings of Confederation style of government by referring to the drawback of Articles of Confederation that was in use in the United States at the time.

Hence, the statement would the author (Edmund Randolph) most likely agrees with is that "The United States would benefit from a stronger central government."

Answer:

The development of a new national Constitution

Explanation:

Khan Academy

How does F. W. Evans's passage explain how the context surrounding the
Shakers changed from the movement's early years to the mid-19th century?

A. By describing the many misconceptions early Americans held
toward the Shakers and their leaders

B. By criticizing early American views toward the Shakers as
examples of intentional ignorance

C. By noting that popular early misconceptions about the Shakers
were no longer widely believed

D. By explaining the changes the Shakers made to become a more
mainstream American religion

Answers

The correct answer is C - By noting that popular early misconceptions about the Shakers  were no longer widely believed.

Hope this helps! Have a great day!

Answer: C

By noting that popular early misconceptions about the Shakers were no longer widely believed.

Explanation:

I took the test

how many countries in the usa

Answers

Answer:

35 countries

Explanation:

How many countries are there in the Americas? America is shared by 35 countries (sovereign states) and several dependent territories (see the list below). Pop.

What is the purpose of government?
A. to protect our rights
B. to collect taxes and control trade
C. to defend the people from invading armies

Answers

Answer:

A

Explanation:

They all can be argued to be correct in some way but A seems to be the best choice for me.

what was Thomas Hobbes's view about government?

Answers

Answer:

Absolutism. Although Hobbes offered some mild pragmatic grounds for preferring monarchy to other forms of government, his main concern was to argue that effective government—whatever its form—must have absolute authority. Its powers must be neither divided nor limited.

Explanation:

Hope this helped!

Absolutism hope this helps

When was Australia made​

Answers

Answer:

January 26, 1788

Answer:

26 January 1788 is the answer

Women were active in the revolution and were responsible for what

Answers

Answer:

The women where resopnisble for helping the wounded an the women aslo gave them food.The woman stiched up clothes to.

Explanation:

Which of the following contributed to the Whiskey Rebellion?
Which of the following contributed to the Whiskey Rebellion?

1 Farmers could not afford the tax on whiskey.
2 Farmers found whiskey difficult to transport
3 Spain was blocking trade along the Mississippi River.
4 The federal government was overprotective of the settlers.

Answers

Answer:

A whiskey tax imposed by Congress in 1791 was the reason for the Whiskey Rebellion. ... Secretary of the Treasury Alexander Hamilton (1755–1804) proposed that the federal government assume responsibility for all the debts and pay them off with funds collected from various taxes, including the whiskey tax.

Explanation:

2. How did women participate in Latin American Revolutions?
A. Contributing financially
B. Protesting revolution
C. Acting as messengers
D. Fighting in combat

Answers

the answers A my guy

Answer:

A. contributing financially

Explanation:

correct if PF student

Trading centers in the cities of Timbuktu and Jenna connected Africa, Europe, and
A. China
B. Egypt
C. the Middle East
D. North America

Answers

Answer: c

Explanation: the middle east

Answer:

C. The Middle East

Explanation:

The guy up there is correct

What was the important difference between the Supreme Court's rulings in Plessy v, Ferguson and Brown v. Board of Education?
A. The Court's willingness to apply intermediate scrutiny to cases dealing with race
B. The Court's interpretation of whether the equal protection clause allowed racial segregation
C. The Court's recognition of the importance of affirmative action programs
D. The Court's acceptance of African Americans' right to equal protection

Answers

B. The Court’s interpretation of whether the equal protection clause allowed racial segregation

What was the XYZ Affair and why were Americans so upset with the XYZ Affair?

Answers

Answer:

The French demanded that the United States provide France with a low-interest loan, assume and pay American merchant claims against the French, and lastly pay a substantial bribe to Talleyrand. The U.S. envoys were shocked, and also skeptical that any concessions would bring about substantial changes in French policy.

Governments and businesses use incentives to

Answers

Answer:

Governments can offer financial assistance to private businesses making investments through the use of economic incentives. Incentives can include tax abatement, tax revenue sharing, grants, infrastructure assistance, no or low-interest financing, free land, tax credits and other financial resources.

What effect did the change in railroads have on he industrial revolution?

Answers

Goods are being able to be transported much faster
* Fuel economy
* Unemployed people were given more opportunities for jobs
* Since its one of the first big corporation made larger profit and gave others ideas of corporations
Other Questions
SOMEONE PLZ HELP ME WITH THIS?!?!? What does r-a-c-e mean How to do this question plz answer me 1. Adjacent angles are two angles in the same plane with a commonand a commonbut no common interior points. Why is the U.S. not a member of the International Criminal Court in The Hague in the Netherlands? 1. What type of logical fallacy is contained in this passage?A highly respected local doctor has spoken out in support of this candidate for mayor. Why not trust the judgment of one of our smartest and most prominent citizens?O appeal to authorityO circular argumentO appeal to popular opinionO non sequitur Which item most likely symbolizes danger?O A. A lightning stormB. A lightbulbO C. A four-leaf cloverO D. A snake In 1792 the radicals took control of the Assembly, abolished the monarchy, and A.) Rejected the constitutional governmentB.) Declared France a republicC.) Surrendered to the Prussian ArmyD.) Ended the war with the other nations of Europe why did Naacp support lawsuits against public institutions such as university of oklahoma? how did these lawsuits realated to the issue of intergation Who are most likely the suspects Steve refers to in the following passage (Paragraph 24)?STEVE. Go ahead, whats my wife said? Lets get it all out. Lets pick out every idiosyncrasy of every man, woman, and child on the street. And then we might as well set up some kind of kangaroo court. How about a firing squad at dawn, Charlie, so we can get rid of all the suspects? Narrow them down. Make it easier for you.A. Neighbors who appear different from other neighborsB. Criminals who have been caught in the neighborhoodC. City officials that control the neighbors lightsD. A family that moves into a new house can someone please help me with a proof for this. you can use HL thereom, ASA, SSS, etc. please write it as statements and reason like; 1. KL=NM 1. Given paragraph on water cycle Recent research by Ravizza and colleagues suggests that students may spend as much as one-typical class hour browsing the internet.halfthirdfifthquarterNeed help on this question? Help me ASAP please Extending voting rights to include more groups of citizens has made the United States more? Solve the system of equations algebraically.5x - 3y = 66x - 4y = 2a. many solutionsC.no solutionb. (8, 14d. (9. 13)Please select the best answer from the choices provided A skier rides horizontally off of a 200 meter high cliff. If he lands 25 meters away from the base of the cliff, how fast was he skiing as he went off the edge?A. 0.91 m/sB. 2.91 m/sC. 3.91 m/sD. 25.91 m/s write the short note on durable and non durable materials The following DNA is being replicated and the origin of replication is in the middle of the sequence and marked with three stars ***. 5'ATCGGGCTACCCATGAAATGCTAGCATT***TAAGATCTTAAGCTAGCTAGTTCGATCTGA3'What is the sequence of the primer for the LEADING strand? Your answer should be 8 nucleotides long, written from 5' to 3' and only include the nucleic acid sequence (ex: ACTACTAC).note: there are two answers for this question Two cards are drawn in succession from a standard 52-card deck.1. What is the probability that the first card is red and the second card is black(A) If the cards are drawn without replacement?(B) If the cards are drawn with replacement?2. Two balls are drawn in succession out of a box containing 3 red and 5 white balls. Find the probability that at least 1 ball was red, given that the first ball was(A) Replaced before the second draw(B) Not replaced before the second drawContext Header: Conditional ProbabilityContext Section:Conditional Probability is a calculation of the likelihood of an occurrence provided that another event has already occurred. Conditional probability A provided B is generally written as:P(A/B)=P(AB)P(B)