Answer:
Number 2
Explanation:
The more people, the more resources that will need to be used. Hope this helps :)
Answer: B)An increase in the human population means more natural resources will be used.
Explanation: The more people there are on the planet, the more things people will need and therefore increasing the amount of resources used.
Can a
Brain cell
Fat cell
Muscle cell
Red blood cell
Liver cell
Convert one type of fuel molecule to another
answer: yes
exanation:
I'll give you a brainliest if is right or at least shows some effort
(thanks & i hope your having a good day)
In your own words, explain how background noise detected in space provides evidence for the Big Bang Theory.
Answer:
Celestial microwave radiation found a strange microwave signal causing background noise in the radio telescope. The signal came from every direction. The young universe would have been very hot. The microwave background radiation is the remaining heat from the Big bang.
I tried my hardest and this is what I put on MY test so good luck
Which is an example of the use of plants in human societs?
Answer:
|
v
Explanation:
photosynthesis creates oxygen, water and glocose(starch) and we take in those and use it in our mitochondrias to create atp so it can hapen all over again.
For each of the following nitrogenous base sequences, write the complimentary sequence on the line provided.
a) A – T – C – C – T – A – G – A – A – G – G – T __________
b) C – G – T – T – G – C – A – G – A – A – C – T __________
c) T – A – C – G – G – A – T – C – G – T – C – A __________
What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT
Thymine(T) pairs with adenine(A)
Adenine(A) pairs with uracil(U)
Cytosine(C) pairs with guanine(G)
therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT
is
AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA
Which is a term for a type of detritivore?
Carnivore
Decomposer
Herbivore
Omnivore
Answer:
Decomposer
Explanation:
Decomposers eat dead organsims carnivores rarely
Answer:
C. Decomposer
Explanation:
A.P.E.X
Question 4 of 10
Which of the following best describes cost-benefit analysis?
Answer: a) a process of maximizing benefits and minimizing costs. b)a way to predict how much someone will earn in the future. c)a calculation of how much profit will result from a certain level of spending. d)a method of calculating money spent on a project.
Explanation:
6. Name the nitrogenous wastes excreted by the following organisms:-
(1) Desert mole
(ii) Marine fish
(111) Tilapia
Answer:
Desert mole excretes concentrated urine with urea.
Marine fish excretes urine with uric acid.
Tilapia excretes dilute urine with amino acids.
Explanation:
The nitrogenous wastes that are excreted by the following organisms are as follows:
Desert mole: Urea.Marine fish: Uric acid.Tilapia: Amino acids. What is Nitrogenous waste?Nitrogenous waste may be defined as the compounds which are excreted by the organisms that contain an excessive amount of nitrogen or its derivative products.
Among the above-given organisms, Desert mole and Marine fish are Ureotelic organisms that excrete either concentrated or diluted urine with a significant amount of urea and uric acid respectively.
While Tilapia is an Ammonotelic organism that excretes diluted urine with a significant amount of amino acids.
Therefore, it is well described above.
To learn more about Nitrogenous waste, refer to the link:
https://brainly.com/question/9517408
#SPJ2
Which of the following IS NOT a part of the cell theory? *
All organisms are made of one or more cells
All cells contain nuclei and membrane bound organelles
Cells arise from pre-existing cells
Cells are the basic units of structure and function
Answer:
all cells contain nuclei.
Explanation:
prokaryotes dont have a nuclei
What number go in each circle ?
What number go in both circle?
Answer:
1 goes in the middle of all of the circles. 2 goes in animal cell. 3 goes in plant cell. 4 goes in between animal and plant cell. 5 goes in The middle of all of the circles. 6 goes in the middle of all of the circles. 7 goes in the bacteria circle. 8 goes in bacteria. 9 goes in bacteria.
Also:
8 and 9 I'm not completely sure of. Let me know if I'm wrong. Good Luck! :D
What are non- examples of an electromagnetic wave?
Describe how the circulatory system allows the endocrine system to do its job?
Answer:
The circulatory system is the transport system for endocrine info. The endocrine chemicals and hormones must circulate through the body via blood vessels.
Hemoglobin is found in red blood cells and carries oxygen from your lungs to the rest of the body. Insulin is a hormone used to regulate blood sugar levels. Since hemoglobin and Insulin are made of chains of amino acids, they are examples of which type of organic molecule?
A. Lipid
B. Protein
C. Carbohydrate
D. Nucleic acid
Answer:
B
Explanation:
Proteins are made of chains of amino acids.
The movement of water in or out of the cell membrane without the use of ATP.
Diffusion
Facilitated diffusion
Osmosis
Excoytosis
1. Peer review allows others in the field to assess a scientist's investigations and results.
a. True
b. False
Answer:
False.
Explanation:
Peer review provide others scientist in the field to assess a scientist's investigations and results.
Peer Review:
It is the reviewing or evolution of the work by many professionals and experts in the field.
For example- A scienfic manuscript is send to the many scientist for evolution before publication.
This peer review is unbiased because the reviewer does not know the name or other information about writter.
To know more about Peer Review:
https://brainly.com/question/10853815
plants Which part of the carbon cycle occurs when plants, trees, or fossil fuels are burned?
A. Transpiration B. Oxidation C. Photosynthesis D. Combustion
An air mass that originates over land in Central America is most likely
Answer:
An air mass that originates over land in Central America is most likely warm & dry.
Explanation:
Answer:
Warm and Dry
Explanation:
A P E X answer
PLEASE ANSWER!! The city council of Jacksonville, Montana, is considering turning some of its grassy areas into large ponds. Farmers have argued against this idea because they are concerned that taking away too much of the grassy areas will hurt the sheep. Write a claim to counter the farmers’ argument, using the data above. Make sure to include a rebuttal in your answer.
Answer:
As the city council of Jacksonville, Montana is thinking of turning grassy areas into large ponds which is not acceptable by the farmers because they are concerned it will affect the sheep population. Farmers are right because grassy areas form a habitat for the sheep population in that area and make a balance between predators and prey.
As we can see the data of the relationship between predators and prey, growth in grassy areas in years maintains a balance of predators and prey where wolfs are not harming many sheep but if grassy areas will be detroyed, it will be easy for wolfs to dominate sheep population.
What are two ways in which cells use the energy temporarily stored in ATP?
Answer: Energy provided by ATP is used in active transport, to contract muscles, to make proteins, and in many other ways
The two main ways in which cells use the energy temporarily stored in the form of ATP is in active transport, and to make proteins.
What is Active transport?
Active transport is the movement of molecules, ions, solutes, solvents against the concentration gradient. The flow of material takes place from the region of their lower concentration to the region of their higher concentration. The transport is against the gradient and hence requires energy to proceed which is given by ATP.
ATP is required to synthesize proteins in the ribosomes of the cell through the process of translation. This is a highly energy-consuming energy and thus required large amount of ATP.
Learn more about ATP here:
https://brainly.com/question/14637256
#SPJ2
Give SOME EXAMPLES OF NATURAL CYCLE CHECKPOINTS .
Answer:
For example, delays in mitosis are often ascribed to 'activation' of the mitotic checkpoint, a descriptor that fails to recognize that the checkpoint by definition is active as the cell starts mitosis. Conversely, the completion of mitosis in the presence of misaligned chromosomes is often automatically interpreted to indicate a defective checkpoint, even though in the absence of critical testing alternative interpretations are equally likely. In this article, we define the critical characteristics of checkpoints and illustrate how confusion generated by the inconsistent use of terminology may impede progress by fostering claims that mean very different things to different researchers. We will illustrate our points with examples from the checkpoint that controls progression through mitosis
Explanation:
Answer:
Below
Explanation:
G1 checkpoint, also known as the Start or restriction checkpoint or Major Checkpoint; the G2/M checkpoint; and the metaphase-to-anaphase transition, also known as the spindle checkpoint.
How does soil erosion affect streams and rivers?
Explanation:
The effects of soil erosion go beyond the loss of fertile land. It has led to increased pollution and sedimentation in streams and rivers, clogging these waterways and causing declines in fish and other species. And degraded lands are also often less able to hold onto water, which can worsen flooding.
1. what is an organelle?
2. give me an example of an organelle.
3. Which organelle is the "command center" of
the center?
Answer:
1. a subcellular structure that has a job to do within the cell
2. mitochondria
3. the nucleus
What are common changes
In an environment?
Answer:shelter, land, prey
Explanation:
What three things regarding cell organelles are different between plant and animal cells?
Answer:
Plant cells have a cell wall, but animals cells do not. ...
Plant cells have chloroplasts, but animal cells do not. ...
Plant cells usually have one or more large vacuole(s), while animal cells have smaller vacuoles, if any are present
Pls I need badly help
Answer:
medusa
Explanation:
describe and explain how the rate of photosynthesis is affected by light intensity
What is the series of processes in which a plant converts sunlight into a useful simple sugar called?
division
choloplasts
photosynthesis
mitosis
Answer: Photosynthesis
Explanation: I had this question to and it should be correct. I’m sorry if not.
4
_ is a component of soil made entirely of decomposed organic remains. This component increases soil fertility and _
the ability of soil to retain water.
A. Humus; increases
B.
Parent material; decreases
C.
Subsoil; increases
D
Topsoil; decreases
Answer:
The answer is A
Explanation:
am 100% sure
what is a cell membrane?
Answer:
The cell membrane is the semipermeable membrane of a cell that surrounds and encloses its contents of cytoplasm and nucleoplasm.
Explanation:
Answer:
Short. The semipermeable membrane surrounding the cytoplasm of a cell.
Long. The cell membrane is the semipermeable membrane of a cell that surrounds and encloses its contents of cytoplasm and nucleoplasm. The cell membrane separates the cell from the surrounding interstitial fluid, the main component of the extracellular fluid.
Explanation:
A group of students studied heat transfer by placing a hot block of metal into a Styrofoam cup of room temperature water what method of heat transfer with the student studying
Radiation
Convection
Conduction
Thermal energy
Answer: Thermal Energy
Explanation:
i worked it out tell me if im right
Method of heat transfer which is being studied by the student is thermal energy.
What is thermal energy?
Thermal energy is defined as a type of energy which is contained within a system which is responsible for temperature rise.Heat is a type of thermal energy.It is concerned with the first law of thermodynamics.
Thermal energy arises from friction and drag.It includes the internal energy or enthalpy of a body of matter and radiation.It is related to internal energy and heat .It arises when a substance whose molecules or atoms are vibrating faster.
These vibrating molecules and atoms collide and as a result of which heat is generated in a substance , more the collision of particles , higher is the thermal energy. There are 3 types of thermal energy 1) conduction 2) convection 3) radiation
Learn more about thermal energy,here:
https://brainly.com/question/11278589
#SPJ2