WILL GIVE BRAINLIEST !! (question from ED20)

In this lab, you will explore the microscopic process of building proteins from RNA. Instead of working with variables, you will focus on the steps of that process. What investigative question will you answer by exploring this process? Write your question below.

Answers

Answer 1

Answer:

What steps occur inside the cell to build proteins?

Explanation:

Hope this helped

Answer 2

RNA is the single-stranded molecule that determines the sequence of amino acids to build up the polypeptides. Transcription and translation are the two processes through which the DNA will convert into the sequence of amino acids.

In the lab, the steps of processes are being focused on. The investigatory questions of the experiments include:

How are the proteins formed using the information given by the RNA molecule?

How are the processes of central dogma, transcription, and translation are involved in the formation of protein?

What are the steps involved in the building up of proteins within a cell?

Thus, the investigatory question in a laboratory experiment generally starts with 'how' and 'what.'

To know more about RNA, refer to the following link:

https://brainly.com/question/1423363


Related Questions

Most abundant element in the biomolecules studied (fats, proteins, carbohydrates, nucleic acids) was....
carbon
Monosaccharide
Amino acid

Answers

amino

acid

Explanation:

thats amino acid

amino acid ............

explain how darwin's journey to the galapagos islands contributed to his creation of the theory of evolutions.

Answers

Explanation:

During his visit to the islands, Darwin noted that the unique creatures were similar from island to island, but perfectly adapted to their environments which led him to ponder the origin of the islands' inhabitants.

Among those that struck Darwin so greatly were the finches that are now named in his honor. Darwin would later base some of his thought from the supposing that these finches were all descendents of the same lineage.

How do scientists plan to use copy number variants and identical twins to determine the roots of diseases? In your response, use the words: gene

Answers

Identical genes have the same genetic material and the same genes. So if they both have a disease it's likely that it's genetic.

Scientists plan to use copy number variants (CNVs) and identical twins to determine the genetic differences between them and the cause of genetic disease as CNVs are variations in the copies of a gene in an individual's genome.

What is the significance of copy number variants?

Scientists use copy number variants (CNVs) to study the genetic diseases in twins and CNVs are variations in the copies of a gene in an individual's genome, but in identical twins, they have the same genetic makeup. By analyzing the CNVs in twins, scientists can identify the genes that may be involved in the disease and how they contribute to its development.

Hence, scientists plan to use copy number variants (CNVs) and identical twins to determine the genetic differences between them and the cause of genetic disease as CNVs are variations in the copies of a gene in an individual's genome.

Learn more about the copy number variants here.

https://brainly.com/question/29844397

#SPJ2

Baby Brain Power
How does the bar graph on page 5 expand on
information presented in the passage?
It shows exactly how many synapses a person's
brain has at birth
Speech, emotional regulation, movement, and
vision-all of these extraordinary abilities and
many more are possible thanks to the organ
that serves as the body's control center. When
one thinks of "brain power, it is the faces of
adult inventors, professors, and novelists that
Ekely come to mind. Remarkably the most
critical time period with respect to brain
development occurs relatively soon after an
individual is bom.
A newborn enters the world as a fairly helpless
creature, but her brain hos billions upon
bitions of specialized cells coiled neurons.
It gives more information than the passage by
showing that the number of synapses returns to
what it was at birth.
It provides specific information about how many
synaptic connections are formed in each year of a
person's life.
It gives information about synaptic connections
beyond the time period described in the passage.
2
3
4
5

Answers

Answer:

C

Explanation:

Took it

Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide
chain, identifying the codons, anticodons, and amino acid sequence.
DNA: CGATACAATGGACCCGGTATGCGATATCC

Answers

I don’t feel like answering all that but....
C=G G=C T=A A=U
C=G A=T dont know the rest have a gcodocododd dday

HELP!!!!15 POINTS!!!!!!

i think it's f but idk..

Answers

Answer:

F is good

Explanation:

F is a very good choice

People are more likely to seek treatment if they
A. are in a minority
B. live in a rural community
C. have medical insurance
D. have a diagnosis

Answers

Answer:

C. have medical insurance

Explanation:

People are more likely to seek treatment if they D. have a diagnosis as it helps in the treatment of disease.

The clinical diagnosis lets in a clinical expert chart a listing of clinical signs after which evaluate them to different data. A high-quality fitness final result is primarily based totally one scale of being alive and not using a long-time period results to death.

What is the diagnosis?

The act of spotting a disorder from its symptoms and symptoms and signs the realization this is reached following and trying out .The prognosis turned into pneumonia.

Thus it is well explained.

To learn more about the medical insurance refer to link :

https://brainly.com/question/1941778

Hey, please answer the stuff under the orange line. Tysm.

Answers

Answer:

the best thing to do is don't copy anything from off the computer or from nobody else

what is an example of primary ecological succession?
a. plants and animals invading an abandoned crop field
b. lichen growth on rocks
c. minerals spurring rapid plant growth
d. mangroves stabilizing the soils on tropical coasts

Answers

Answer:

mangroves stabilizing the soils on tropical coasts.

Name two cell structures plant cells have that animals do not have and one structure that looks very different in a plant and animal cell (think size).

Answers

Answer:

Plant cells have a cell wall and chloroplasts and the cell wall gives the cell a rectangular shape unlike animal cells which have a round shape because we only have a cell membrane.

Answer:

plant cells have a cell wall . animals do not have and one structure that looks very different in a plant and animal cell

Explanation:

- Lee el siguiente párrafo y a continuación responde lo que se te pide.Los seres humanos primitivos comenzaron a clasificar las plantas y los animales tanto por su utilidad como por el daño que les causaban, luego fueron profundizando aún más en sus conocimientos sobre la flora y la fauna de su entorno, identificando los ciclos biológicos y hábitat, entre otros aspectos que facilitaron su producción y pronta disponibilidad. Con base en el párrafo anterior se puede afirmar que: * 1 punto A) Empezaron a entablar una relación más estrecha con el medio ambiente. B) Abandonaron su vida primitiva y nómada C) Incrementaron sus conocimientos únicamente sobre el ciclo del agua. D) Empezaron la agricultura y la piscicultura.

Answers

Answer:

A) Empezaron a entablar una relación más estrecha con el medio ambiente.

Explanation:

Desde el pasaje, podemos ver que la gente comenzó a prestar más atención a su entorno y cómo la fauna y la flora afectan la vida humana.

Incluso intentaron desarrollar un sistema burdo de clasificación biológica. Henec, se puede inferir que las personas desarrollaron una relación más cercana con su entorno.

In the United States, most racial discrimination comes in the form of ________ discrimination.

A. Direct
B. overt
C. indirect
D. extra​

Answers

Answer:

C, indirect because most people do not admit that they are racist and claim that they didn't do things because they're racist.

Explanation:

In the United States, most racial discrimination comes in the form of indirect discrimination. Therefore, option C is the correct option.

What is indirect discrimination?

Indirect discrimination involves the policies or practices that appear neutral on the surface, but deep down have adverse effects on the people belonging to a particular race.

Indirect discrimination can be seen in various areas, such as employment. During a job vacancy, the job applicant requires to speak a high level of proficient English which appears to be a reasonable requirement for the job, but it can lead to a significant impact on non-native English speakers.

Indirect discrimination can be seen in the education field where schools give admissions to only those students who will qualify for a specific education test which may seem unfair to students belonging to a specific race, and having different educational backgrounds.

Therefore, indirect discrimination is the most common form of discrimination observed in the United States.

Learn more about indirect discrimination here:

https://brainly.com/question/14710203

#SPJ7

how many blood vessels leave the heart?

Answers

Answer:

There are 5 great vessels that go into the heart and out.

Explanation:

So looking back to the lesson from my bio class, we learned  that there are 5 great vessels. The superior and inferior cava. The pulmonary artery, the pulmonary vein, and the atora.

I hope this helps!

Noriya~

What is a society that is able to survive and function over a specified time?​

Answers

Answer:because time and society are different

Explanation:

Is the troposphere high or low and what is the temperature there only answer if you know it

Answers

Answer: High

Explanation:

The average temperature of the troposphere is 62°F (17°C), Pls give thanks because I got hack

has anyone done this worksheet? i need help with it. thanks:)

Answers

I have done it I think
try scanning it with the google app with text and usually answer keys pop up good luck!

Its easy! If right will give brainlist! Don't overthink..:) Just answer

The virtual image changes with the position of the mirror to the eye when the mirror is..............?
Fill in the blanks

Answers

Answer:

When the mirror is inside the focal point..?

What is an advantage to SMRs?
Select all that apply.


less atmospheric emissions


use fusion instead of fission

reduced cost


reduced construction time

Answers

Answer:

PLEASE MARK ME THE BRANIEST THANK YOU :)

Explanation:

The next decades are crucially important to putting the world on a path of reduced greenhouse gas emissions.

By the end of the century, demand for energy will have tripled under the combined pressure of population growth, increased urbanization and expanding access to electricity in developing countries. The fossil fuels that shaped 19th and 20th century civilization can only be relied on at the cost of greenhouse gases and pollution.

A new large-scale, sustainable and carbon-free form of energy is urgently needed. The following advantages make fusion worth pursuing.

Abundant energy: Fusing atoms together in a controlled way releases nearly four million times more energy than a chemical reaction such as the burning of coal, oil or gas and four times as much as nuclear fission reactions (at equal mass). Fusion has the potential to provide the kind of baseload energy needed to provide electricity to our cities and our industries.

Sustainability: Fusion fuels are widely available and nearly inexhaustible. Deuterium can be distilled from all forms of water, while tritium will be produced during the fusion reaction as fusion neutrons interact with lithium. (Terrestrial reserves of lithium would permit the operation of fusion power plants for more than 1,000 years, while sea-based reserves of lithium would fulfil needs for millions of years.)

No CO₂: Fusion doesn't emit harmful toxins like carbon dioxide or other greenhouse gases into the atmosphere. Its major by-product is helium: an inert, non-toxic gas.

No long-lived radioactive waste: Nuclear fusion reactors produce no high activity, long-lived nuclear waste. The activation of components in a fusion reactor is low enough for the materials to be recycled or reused within 100 years.

Limited risk of proliferation: Fusion doesn't employ fissile materials like uranium and plutonium. (Radioactive tritium is neither a fissile nor a fissionable material.) There are no enriched materials in a fusion reactor like ITER that could be exploited to make nuclear weapons.

I HOPE YOU LIKE MY ANSWER THANK YOU:)

Which of the following is not a technological way of improving air quality?
a.
using electrostatic precipitators
b.
installing solar panels
c.
composting
d.
building wind turbines

Answers

Answer:

c.

composting

Explanation:

Composting is not a technological way of improving air quality (Option C).

What is air quality?

Air quality refers to the absence of pollutant substances (e.g. monoxide carbon) in the air.

Air quality is fundamental for maintaining overall health and increasing the quality of life.

Air quality can be measured by using different devices or indicators (for example, by measuring the amount of carbon monoxide and nitrogen oxides).

In conclusion, composting is not a technological way of improving air quality (Option C).

Learn more about air quality here:

https://brainly.com/question/1211889

Question: Why do you deserve this scholarship? ...
Question: What are your career goals? ...
Question: Tell me about a mistake you made. ...
Question: Why did you choose this school? ...
Question: What activities are you involved in? ...
Question: Tell me about a personal achievement that makes you proud

Answers

Answer:

I deserve this scholarship because I work hard. I feel me getting this scholarship is my dedication paying off. My career goals are to be an orthopedic surgeon, so I can give back to my community, and help others. This has been my dream for a while. I chose this school because I feel it will help me better myself along the Journey of learning. I am involved in football, I was in the National Junior Honor Society in middle school, and I did some basketball. A personal achievement that makes me proud are all of the certificates on my walls of good grades and character badges.

 A scholarship is a form of financial support for students for further education. Scholarships are awarded based on various criteria such as academic merit, diversity and inclusion, athletic ability, and financial need.

 •  The award criteria typically reflect the values ​​and goals of the founder or sponsor of the award.

 • While grant recipients are not required to repay grants, the grants may require that the recipient continue to meet certain requirements throughout their support period, such as maintaining a minimum GPA or participating in a specific activity (e.g. recipient or as a teaching assistant for some graduate fellowships).

 • Scholarships may include a cash award, a non-cash award (such as a tuition or dormitory fee waiver), or a combination there of.

What is the purpose of scholarship for students?

 Scholarships are designed to reward a student's academic achievement and educational programs.Whether you are starting your career or studying in high school to acquire new skills, receiving a scholarship is a great accomplishment.

Learn more about scholarship here.

http://brainly.com/question/904448

#SPJ2

34. Education, Fuel, Food and Clean water are all listed as important factors in limiting….
a. Human Development index
b. Gross Domestic Product
c. Infant Mortality
d. Carrying Capacity

Answers

Answer:

A. Human Development index

Explanation:

The Human Development Index is a statistic composite index of life expectancy, education, and per capita income indicators, which are used to rank countries into four tiers of human development.

hope i helped

its not gdp nor infant mortality nor carrying capacity

and much more

Answer: the answer is A

Explanation:

HELP! I NEED IT SOON! ILL GIVE BRAINLIEST

Answers

Answer: A: People with different goals can make contributions to scientific knowledge.

Schwann and Virchow both had different goals for what they were trying to discover, but both ended up adding to the same theory.

Hope this helps :)

Small aquatic organisms, such as coral, are the producers of the ocean.
Please select the best answer from the choices provided true or false

Answers

Answer:

true

Explanation:

on edg

Small aquatic organisms, such as coral, are the producers of the ocean. Thus, the given statement is true.

What is aquatic organism?

The term aquatic organism has been defined as the the organism lives in the water is known as the aquatic organism. The corals are essential part of the marine ecosystems. They are feeding upon zooplankton, but also their polyps get sugar that is produced by the algae living on them. Also, the corals provide much needed shelter for lots of marine animals, but also are on the menu of some, like the starfish for example.

Limestone is in form of sedimentary rock that is made up of skeletal fragments of marine organisms such as forams, corals and molluscs. However, limestone is formed from the shell of an organisms because the shell is made up of calcite or aragonite.

Due to the presence of nutrients that swipe from ocean to the shores along with tides which makes predators to be present along the shores which ultimately pose a threat to coastal aquatic organisms.

Therefore, Small aquatic organisms, such as coral, are the producers of the ocean. Thus, the given statement is true.

Learn more about  aquatic organisms on:

https://brainly.com/question/1397242

#SPJ6

Chemicals and proteins in the cell read the DNA ___________ for building that make cells, tissue and organs.
(A.Instructions
(B.Genes
(C.Recipe
(D. Life manual

Answers

You answer will be B!! Good luckkk!

Genes of DNA can be read by chemicals and proteins for building that can make cells, tissue, and organs. Therefore, option "B" is correct.

What are genes?

Genes are composed of  DNA which is the genetic material. Gene is the functional unit of heredity. Chromosomes are comprised of multiple genes. Genes code for a particular trait. More than one gene can code for a particular trait.

The function of DNA and RNA is controlled by genes. There are more than 3000 genes present. Mutation can occur in genes. Deletion and insertion are some types of mutation genes. Transposomes are called jumping genes. Sickle cell anemia and cystic fibrosis are some examples of gene mutations.

Genes code for the traits such as the color of eyes, height quality of hair, and more.

Learn more about genes, here:

https://brainly.com/question/31121266

#SPJ2

Which of the following problems are environmental indicators of acid deposition?


Decreased pH levels in lakes and rivers
Decreased concentration of aluminum in the soil
Changes in development of indicator organisms of an ecosystem
II only
III only
I and III
I and II

Answers

Answer:

I and III

Explanation:

Acid deposition will decrease pH levels in lakes and rivers since it contaminates them and lowers their pH, and organisms may be affected by the increased acidity in their immediate surroundings, but aluminum has nothing to do with pH levels at all.

Hope thish elped!

Option I and III shows the problems of environmental indicators of acid deposition.

The following information should be considered:

The acid deposition should reduce the level of pH in terms of lakes and rivers as it contaminates also the organisms should impact when the acidity should be increased for the surroundings. But the aluminum does not have any relationship with pH levels.

Therefore we can conclude that options I and III are correct.

Learn more: brainly.com/question/13107711

BRAINLIEST:
in which month is a hurricane most likely to occur: October or December? explain

Answers

Answer:

October

Explanation:

October is one of the hurricane season months

What is the function of the flower in plant reproduction?

disperses seeds


captures sunlight

protects the stem

attracts pollinators​

Answers

Answer:

attracts pollinators

PLSSSSS HELP ILL GIVE U A BRANLIEST

Answers

Answer:

C

Explanation:

the anser is c plz mark me

Answer:

I would say its D

Explanation:

To achieve which of the following goals would rotational grazing be most appropriate? (3 points)
-To maximize livestock populations while minimizing costs
-To preserve vegetation and soil fertility of land
-To involve townspeople in the operations of a nearby farm
-To transform an abandoned city lot into a neighborhood garden

Answers

Answer:

To preserve vegetation and soil fertility of land

Explanation:

.

A person with a low number of white blood cells could have difficulty in fighting infections and A decrease in the number of lymphoid stem cells could result in a decrease in red blood cell.

What is nucleotide?

It is the sub units and buIlding blocks of DNA. It is made up of a five-sided sugar, phosphate group and then a nitrogen base.

These groups make the backbone of the DNA helix. If you look at a DNA helix, they make the side of the ladder or the side portion. They connect to a nitrogen base which make the steps of the ladder.  The type of sugar that is used in a DNA helix is called deoxyribose.

Nitrogen bases are the molecules that make up the steps of the ladders. There are four different nitrogen bases, namely; Guanine, Thymine,Adenine and Cytosine.

Pyrimidines are compounds that make a single 6-sided ring. Examples of pyrimidines are Cytosine and Thymine. Purines on the other hand make 5-sided and 6-sided rings.

Therefore, A person with a low number of white blood cells could have difficulty in fighting infections and A decrease in the number of lymphoid stem cells could result in a decrease in red blood cell.

Learn more about white blood cells on:

https://brainly.com/question/19202269

#SPJ5

Which statement best describes homeostasis in a cell?

A. Molecules are in equilibrium (balance) inside and outside the cell

B. Active transport causes molecules to move from low to high concentration the molecules are un-equal

C. Pathogens enter cells and infect those cells, causing them to malfunction

D. Cells do not maintain homeostasis with their external environments.

Answers

Answer:

I believe the answer is A. The cell is in an equilibrium inside and out when it goes through homeostasis.

Explanation:

Other Questions
I know I put An answer I dont know if thats it I just accidentally put it What is 1/3 + 4/9 and how to solve find the value of of x sin(4x+30)=cos(-2x+54) What helps cause Mongolia's cold winter temperatures? Name the rhetorical device"We've got the iPod, best music player in the world. We've got the iPod Nanos, bnew models, colors are back. We've got the amazing new iPod Shuffle." A- anaphora B- allusion C-oxymoron D- rhetorical question all of these part of what amendmentA.firstB.secondC.fifthD.seventh Drag and drop the constant of proportionality into the box to match the table. If the table is not proportional, drag and drop "not proportional" into the box.x 0 1 2 3y 0 2 3 4A.2/3 B.1/2 C.0 D.not proportional Water flows through a hose and fills a 100-gallon tank in eight minutes. When represented as a rate, in gallons per minute, what is the unit rate?8000.081812.5 what was the first ever powered heavier-than-air aircraft to ever fly? A. Apollo 11 B. Archytas steam powered bird C. Hydrogen filled airship. D. kite W. Weight brothers aircraft. what is y - 7 = -12 ? Justify this statement "Density of the impure water is greater than of pure water. IF ANYONE CAN PLEASE HELP ME QUICK ID APPRECIATE IT What would be the most likely effect of adding wolves to the park?A. Increased balsam fir populationB. Decreased cottonwood populationC. Increased snowshoe hare populationD. Increased moose population What is the act of gathering information relative to a company's action and the factors that affect the space in which the company operates? Which graph best represents a system of equations that has no solution? When a single broker represents both parties in a real estate transaction, a _______ agency may exist. the theme of The Setting Sun and the Rolling World What is the revelace of knowing the music genres of baroque period Select the correct answer.What should be done to take care of what the sentence describes?Le sol est trs sale.A. il faut nourrir le chienB. il faut faire le repassageC. l faut faire la vaisselleD.il faut passer le balai A 0.98 gram sample of a volatile liquid was heated to 348 k. the gas occupied 265 ml of space at a pressure of 0.95 atm. what is the molecular weight of this gas? Expand and simplify(3x + 2)(x - 1)