will giv brainly please help

Will Giv Brainly Please Help

Answers

Answer 1

Answer:

3,2,4,1 is the correct order.

Explanation:

3 would be cuz initially there were no life forms. 2 cuz bacteria came and then primitive and simple animals and plants evolved. Then 4 cuz simple life came from bacteria. Then 1 bc from those simple life an complexed life evolved.


Related Questions

PLEASE HELP
Match the monomer to the polymer.
A.Amino acid B.glycogen
C. Nucleotide.
D.phospholipid Monosaccharide.
E.DNA
F.Fatty acids and glycerol.
G.protein collagen​

Answers

Nucleotide (DNA)

Amino acid (protein collagen​)

Monosaccharide (glycogen)

Fatty acids and glycerol (phospholipid)

A friend says that all bacteria are harmful to people list three reasons this statement is incorrect.

Answers

-autotrophic bacteria give off oxygen (O2)
-flavor foods such as vinegar, yogurt, cheese, etc. (pasteurization)
-decomposers (bacteria)- recycle nutrients in food web
-enviromental clean-up- bacteria eat oil from oil spills
0health and medicine- bacteria break down food in your intestines/make

1. DNA base sequence: GACGATGTAGCATCGACCATTG.
What would the mRNA sequence for this sequence of DNA be?

Answers

CUGCUACAUCGUAGCUGGUAAC

In a sex linked trait, the recessive phenotype is most often found in males because...

Answers

Answer:

X-linked recessive diseases most often occur in males. Males have only one X chromosome. A single recessive gene on that X chromosome will cause the disease. The Y chromosome is the other half of the XY gene pair in the male.

Explanation:

Why are you learning this stuff anyways.Girl????????

Describe the two signals and pathways that are activated when you touch something and experience pain

Answers

The medial thalamus projects to widespread areas of the forebrain, including the somatosensory cortex. Thus there are two major ascending pathways for pain: a direct lateral spinothalamic pathway and an indirect medial spinoreticulothalamic pathway.

Put "Sympatric Speciation" in a sentence

Answers

Answer:

A 2008 study suggests that sympatric speciation has occurred in Tennessee cave salamanders.

Explanation:

Hope this helps

Which statement best explains how the gases of the atmosphere affect the temperature of Earth?

Answers

The atmosphere today contains more greenhouse gas molecules, so more of the infrared energy emitted by the surface ends up being absorbed by the atmosphere. Since some of the extra energy from a warmer atmosphere radiates back down to the surface, Earth's surface temperature rises.

Construct an argumentative paragraph. Do you believe it's ethical or unethical to artificially select traits in plants and or animals? Provide evidenco to suoport your claims. It doesn't matter what side you chose, but I need it asap.​I will give you any mark you want.​

Answers

Answer:

The ethics of artificially inserting traits in animals has been in the practice for years in the form of selective breeding, but should scientists really be editing DNA to the extent they are today? I don't believe they should. Life itself should construct itself without us interfering. Making a brand new plant just because it looks nice doesn't account for many factors, including the fact that it could be harmful to nearby plants if pollinated. In addition, generic engineering costs quite a lot of money, which should be used on other more cost effective methods, such as improving agriculture rather than creating a whole new plant that could harm entire crops. Genetic engineering isn't a necessity and humans should not play God with plant and animal life.

explain how the cells, tissue, and organs within the circulatory system work together to enable it to perform its function of pumping materials around the body and removing waste products such as carbon dioxide.

Answers

Answer:

the body has levels of organization that build on each other.Cells make up tissues,tissues make up organs,and organs make up organs system.

B cells can divide to form plasma cells. Each plasma cell contains many mitochondria
and an extensive endoplasmic reticulum. Referring to the function of plasma cells in your answer, explain why these features are important adaptations.

Answers

Answer:

Explanation:

The presence of mitochondria  and an extensive endoplasmic reticulum are the features that are important for adaptations of the plasma cell because plasma cells (white blood cells) secrete immune proteins also called antibodies which only formed due to the presence of endoplasmic reticulum whose function is to formed proteins for the cell so that's why plasma cells have large sized endoplasmic reticulum.

I AM LITERALLY CRYING RIGHT NOW PLEASEE HELPPP WILL MARK BRANLIEST HELPPP MEE

Part 1: Explore

Based on your research and observations of the three common states of matter, answer the

following questions.

Out of the videos, animations, and images you researched, which was your favorite? Why?

Do you feel it accurately represented the differences between each state of matter


How does the space between the particles in each state of matter differ?

How do the particles in each state of matter move?

Part 2: Explain

Examine the heating curve of water below, and then answer the questions about it. If you require the use of a text reader, open the file Heating Curve of Water to receive the information.


Which three parts of the graph’s curve represent the solid, liquid, and gaseous state of water?

Explain your reasoning.

Which point of the graph’s curve represents the melting point of water? Explain your reasoning.

Which point of the graph’s curve represents the boiling point of water? Explain your reasoning.

What happens to the energy of water in Part B and Part D of the graph’s curve? How do you know?

Why does the temperature of the water stay the same when it melts and boils?

Now comes the hands-on part of your project! You will continue to explore phase changes by performing an experiment and creating your own heating curve. Before you begin your experiment, read over the following information.


The materials you will need for your experiment are listed below.


small pot

measuring cup (must have mL and oz markings)

spoon (wooden, plastic, or metal)

ice

water

stove

thermometer (should have units in °C

Time (min) Temperature of Water (°C) Observations of Water

0

1

2

3

4

5

6

7

8

9

10

11

12

13

14

15

Place 14 oz of crushed ice into a small pot. Then add about 125 mL of water to it.

Using the thermometer, measure and record the initial temperature of the ice water. List this temperature in °C in the “0” minutes row of your data table in the lab handout. *Do not allow the thermometer to touch the bottom of the pot when recording measurements.

Place the pot on the stove, and turn the knob to the medium-low setting.

Using the thermometer, measure the temperature every minute until the water begins to boil vigorously. Record this data in the table on your lab handout.

At each measurement, also record what is happening to the water. Be sure to record the times of these events:

The ice melts.

The water forms steam.

The water begins to boil.

Once the water has begun to boil, stir the water constantly with the spoon.

Continue to measure and record the temperature every minute until almost all the water has boiled and the pot is close to empty.

Record the last temperature, and turn off the stove. DO NOT TOUCH THE POT WITHOUT SAFETY EQUIPMENT.

Create the x-axis and y-axis of a graph.

Label the x-axis as follows: Time (min).

Label the y-axis as follows: Temperature of Water (°C).

Along the x-axis, create and label 15 marks, one for each minute of the experiment. (Hint: The origin starts at 0.)

Along the y-axis, create and label temperature markings for every 20 degrees. (Hint: The origin starts at 0.)

Refer to the data from your experiment to plot the points on your graph. Then connect each of the data points with a line.

Look over your graph to make sure it is clear and correctly labeled.

Either save your graph as a computer file, or take a picture of your graph and upload it as a file on your computer.

Describe your experience in performing the experiment. What went well? What could have been

improved?

Examine your line graph. How does the graph’s slope change over time?

Examine your line graph. Why does the slope change?

How could you apply the knowledge gained from this experiment in the real world?

Hint: Think of cooking.

Make a prediction. How do you think adding other substances to the water would affect its

heating curve?

THANK YOU SO MUCH

Answers

Answer:

think of cooking

Explanation:

the reason is that I just know it

When organisms

they increase in size.

Answers

Answer:

The increase in size and changes in shape of a developing organism depend on the increase in the number and size of cells that make up the individual. Increase in cell number occurs by a precise cellular reproductive mechanism called mitosis.

Explanation:

PLEASE ANSWER ALL QUESTIONS! THANKS!

Which of the following statements about salinity is true?
Question 1 options:

Ocean water near areas with low evaporation has higher salinity.


Ocean water in regions with high levels of precipitation has higher salinity.


Ocean water near rivers has a lower salinity.


Ocean water in areas with high humidity has a higher salinity



How are latitude and temperature related?








Question 2 options:

Lower latitudes will have warmer water because it is closer to the equator.


Higher latitudes will have warmer water because it is closer to the equator.


Higher latitudes will have warmer water because it is closer to the poles.


Lower latitudes will have warmer water because it is closer to the poles


How does salinity vary with freezing and melting?









Question 3 options:

Both freezing and melting decrease salinity.


Both freezing and melting increase salinity.


Freezing decreases salinity, while melting increases salinity.


Freezing increases salinity, while melting decreases salinity.


How does salinity vary with evaporation?









Question 4 options:

When water evaporates, it takes salt with it, increasing its salinity.


When water evaporates, it leaves salt behind, increasing its salinity.


When water evaporates, it leaves salt behind, decreasing its salinity.


When water evaporates, it takes salt with it, decreasing its salinity.

Answers

Answer:

that guys answers are all wrong except for #3

Explanation:

i took the quiz and got 1/4

PLS HELP ASAP!!!!!!!

Answers

Answer:

3. A and B are true

4. oxygen, photosynthesis, I think oxygen, cellular respiration

Explanation:

Hope this helps! :) I am think all of my answers are correct.

How can a material at a certain temperature have all of its molecules at the same energy?

Answers

it can be frozen (32°F or 0°C) which would slow the energy of the molecules. or it could be boiled (212°F or 100°C) which would rapidly increase the speed of the molecules.

help me out girlies its due

Answers

the stereotype is that all australians are some sort of zookeepers? and wear clothes like that. also that they drink beer a lot.

Answer:

the stereotype is that all australians are zookeepers? and wear clothes like that.

Explanation:

Process performed by plants (producers) using the sun's energy to make their own food.
A. Conduction
B. Photosynthesis
C. Fission
D. Fusion

Answers

Answer: B.Fotosintesis

Explanation:

Answer:

option B

Explanation:

photosynthesis is the correct answer.

plz mark my answer as brainlist plzzzz.

hope this will be helpful to you.

Which of the following options best depicts the process of protein synthesis?

1. protein → RNA → DNA
2. DNA → amino acid → RNA → protein
3. DNA → RNA → protein
4. RNA → DNA → RNA → protein

Answers

During translation, the genetic code in mRNA is read and used to make a protein. These two processes are summed up by the central dogma of molecular biology: DNA → RNA → Protein.

HELP NEED THIS BY TODAY!
What did Mendel study that lead him to his discovery

Answers

Answer:

A monk, Mendel discovered the basic principles of heredity through experiments in his monastery's garden. His experiments showed that the inheritance of certain traits in pea plants follows particular patterns, subsequently becoming the foundation of modern genetics and leading to the study of heredity.

Explanation:

Answer:

Mendel studied the genetics of pea plants.

Explanation:

Mendel looked at the pea plants in his monastery garden to determine genetics. He found that some plants had white flowers, while some did not, and he used that discovery to determine the genetics of the plants.

Name one adaptation that allows desert plants to survive with little water?

Answers

Answer:

stomata

Explanation:

This adaptation helps cacti reduce water loss by keeping the hot, dry wind from blowing directly across the stomata. The leaves and stems of many desert plants have a thick, waxy covering.

How do living organisms return carbon to the atmosphere in the carbon cycle

Answers

Answer:

Carbon enters the atmosphere as carbon dioxide from respiration and combustion. Carbon dioxide is absorbed by producers to make glucose in photosynthesis

Living organisms return carbon to the atmosphere in the carbon cycle by two  process namely respiration and combustion. Carbon dioxide is absorbed by producers to make glucose in photosynthesis.

What is photosynthesis?

A photosynthesis is a biochemical process which occurs in plants, algae, and bacteria, when they are exposed to sunlight. During photosynthesis, water and carbon dioxide join to form sugars and give off oxygen.

Respiration is defined as the inhaling of oxygen and the exhaling of carbon dioxide and combustion is defined as the process in which a substance burns in the presence of Oxygen, produce off heat and light in the process.

For more information regarding carbon cycle, visit:

https://brainly.com/question/10861032

##SPJ2

what is the relation between cell cycle disruption and cancer?
I need help!!!?

Answers

Cancer is the result of unchecked cell division caused by a breakdown of the mechanisms that regulate the cell cycle. The loss of control begins with a change in the DNA sequence of a gene that codes for one of the regulatory molecules. Faulty instructions lead to a protein that does not function as it should.
Cancer is the result of unchecked cell division caused by a breakdown of the mechanisms that regulate the cell cycle. The loss of control begins with a change in the DNA sequence of a gene that codes for one of the regulatory molecules. Faulty instructions lead to a protein that does not function as it should.

if epigenetic changes take place above the level of the genome , what would be an example of a change at the level of the genome ?

Answers

Answer:

epigenetics chamges take place.

Epigenetics is the examination of the way cells manipulate gene interest without converting the DNA series." Epi-"approach on or above in Greek, and "epigenetic" describes elements past the genetic code.

Epigenetic changes are adjustments to DNA that modify whether or not genes are grown to become on or off. These adjustments are connected to DNA and do now no longer alternate the series of DNA constructing blocks. Within the entire set of DNA in a (genome), all the adjustments that modify the interest (expression) of the genes are referred to as the epigenome.

Because epigenetic changes assist decide whether or not genes are grown to become on or off, they affect the manufacturing of proteins in cells. This law facilitates making sure that everyone produces the handiest proteins which might be essential for its function. For example, proteins that sell bone boom aren't produced in muscle cells.

What is the epigenetic pattern?

Patterns of epigenetic change range amongst individuals, in one-of-a-kind tissues inside an individual, or even in one-of-a-kind cells inside a tissue. Environmental influences, together with a person’s food plan and publicity to pollutants, can affect the epigenome. Epigenetic adjustments may be maintained from cell to as cells divide and, in a few cases.

Hence concluded that Epigenetics changes and causes cancers, by changing the genome, epigenome, or both.

To know more about epigenome referer link :

https://brainly.com/question/25660175

If one DNA strand reads CCGTAATGCAT, what will be the sequence of the complimentary strand?

Answers

The complimentary strand would be GGCATTACGTA

Biology Grade 8
Match correct terms/meaning given in column 'B' with their correct levels
given in column 'A' with Column 'B'

Column A
a.Cell
b.Plant
c.Tissue
d.nose
e.organelle

column B
a.Group of similar cells
b.Heart
c.Ova
d.Organ
e.Group of different cells
f.Nucleus
g.organism

Answers

Answer:

cell=ova

plant=organism

tissue=group of similar cells

nose=organ

organelle=nucleus

using the count data and observational data you acquired calculate the number of cfus in the original sample

Answers

Answer:

cuales son los datos ?

Explanation:

cuales son los datos

Which feature of chytrids makes them different from the other types of fungi? the material that strengthens their cell walls the special digestive material they release their use of budding to reproduce their ability to live in dry environments

Answers

Answer:

the material that strengthens their cell walls

Explanation:

Chytrids originate from the kingdom fungi and a division known as Chytridiomycota. They contain a feature of unique characteristics by the presence of the chitin and the cellulose cell wall. The chitin made up the component of their cell wall in fungi but in Chytrids, the cellulose helps to strengthens their cell walls.

Answer:

A. the material that strengthens their cell walls

Which answer choice accurately depicts the sequence by which blood moves from the pulmonary vein to the body tissues?

Answers

Answer:

See the answer below

Explanation:

Oxygen-rich blood flows from the lung through the pulmonary vein to the left atrium of the heart. From there, the blood is pumped through the mitral valve to the left ventricle. The contraction of the left side of the heart sends the oxygenated blood out of the left ventricle through the aortic arch to the major arteries designated to carry blood to the major parts of the body. From the arteries, blood moves to the capillaries and then to the various tissues of the body before returning back to the heart through the vein.

Thus, the sequence of flow of blood from the pulmonary vein to the body tissues can be summarized as:

Pulmonary vein -> Left atrium -> Arteries -> Capillaries -> tissues

Despite his fear of germs, Howard Hughes neglected his own hygiene despite having those around him follow strict cleanliness practices. Hughes had these odd behaviors because __________.
A.
he believed he was unable to escape any infection
B.
he developed obsessive-compulsive disorder at an old age
C.
he thought he would be contaminated from the outside
D.
his paralysis at a young age prevented him from being self-sufficient

Answers

Answer: it’s c he thought he would be contaminated from the outside

Explanation:

I took the test

Howard Hughes neglected his own hygiene despite having those around him follow strict cleanliness practices. Hughes had these odd behaviors because he thought he would be contaminated from the outside.

What is importance of cleanliness?

Cleanliness gives rise to a good character by keeping body, mind, and soul clean and peaceful. The cleanliness only which helps to improve our personality by keeping clean externally and internally.

Thus, option "C" is correct.

To learn more about cleanliness click here;

https://brainly.com/question/4279403

What is the universe made of

Answers

Answer:

composition

Explanation:

the universe is composed almost completely of dark energy, dark matter , and ordinary matter

Answer: matter , atoms

Explanation:

Other Questions
Summarize Lincoln's 3 three reasons for the Ten Percent Plan. Can someone please help me with this ? Determine the type of air mass that typically plays a role in the weather in your area. Describe the type of weather that commonly is associated with the air mass and where the air mass originates. Describe the seasons in your area which result from that air mass. if there are 10 birds for 4 dogs,what is the ratio of birds to dogs? 4.- Un vehculo ha tardado 23 minutos en recorrer 86 Km. Si suponemos que no cambi develocidad en el trayecto, qu velocidad llevaba cada segundo?5.- Hemos dado la vuelta a un circuito en 34 segundos, llevando una velocidad constante de 13 The dielectric constant of the interior of a protein is considerably smaller than that of water. How would this difference in dielectric constants affect the strength of an electrostatic interaction between two opposite charges with the same distance between them if the charged groups were located in the interior of the protein rather than on its surface Are moons 1-4 waxing are waning ? Is the relation below a function?-3-1-130123 all life would come to an end if there are no green plants.Explain What statement is true for life insurance coverage?O A. The policy only covers beneficiary's future needs, funeral costs should not be included in thepolicy amountB. Debt is forgiven at death, so insurance policies do not need to cover this cost.OC Life insurance policy amounts should factor in how much it would take to maintain the standardof living for the beneficiariesD. Generally speaking, $10,000 is the recommended amount for a life insurance policy PLZ help me i will give u many points CAN SOMEONE ANSWER PLEASEEEEEE I SUCK AT MATH NEED HELP ASAP! Answers pleas!!!! how did nations participating in world war 1 control opinion? why was this important Excercise :.* * Fill in the blanks withsuitable conjuctions2. He enjoys the movie dash he see it3. I will go to the foreign dashyou alow me4 Rajeuh is a sweet child dash naughty also5 Do you like tea dash coffee 5. What are the values of x and y? O x=2sqrt3 y=4 O x=8sqrt7 y=4sqrt21 O x=8sqrt3 y=8sqrt3 O x=4sqrt21 y=8sqrt7 Which of the following is a key element in the criminal act of arson?A. The intent to do harm or defraudB. Physical harm done to othersC. The location on the private property of another partyD. Business property destroyedSUBMIT Given the expression below, identify its factors.3a + 4b 7c - 12 What 2 factors is potential energy (PE) dependent upon Terrell brought $5.00 to spend at the rink's concession stand. Hot dogs cost $0.65, French fries cost $0.80, nachos cost $1.25, and drinks cost $0.95. If Terrell buys French fries and a drink, what is the maximum number of hot dogs he can purchase?