Why it said he used partial products to write 7 × 870 = 5600 + 49 explain why its error in use math to justify your explanation

Answers

Answer 1
The equation doesn’t equal each other
6090=5649
Answer 2

The person is wrong because instead of writing the product as 5600 + 49 he must write 5600 + 490.

The given equation is 7 × 870 = 5600 + 49.

What is multiplication?

Multiplication is an operation that represents the basic idea of repeated addition of the same number. The numbers that are multiplied are called the factors and the result that is obtained after the multiplication of two or more numbers is known as the product of those numbers.

Now, product of two numbers 7 and 870 is

7 × 870=6090

⇒ 7 × 870 = 5600 + 490

Hence, the person is wrong because instead of writing the product as 5600 + 49 he must write 5600 + 490.

Learn more about the multiplication here:

https://brainly.com/question/1562995.

#SPJ2


Related Questions

what is the nth term of 1,3,5,7,9,11

Answers

Answer:

11

Step-by-step explanation:

Here,

11 is the nth term as it is the last term shown in the sequence

-5/4c - 1/2 = -3/4 + 5/8c​

Answers

Answer:

c=2/15 have a great day! :D

Step-by-step explanation:

Step 1: Simplify both sides of the equation.

Step 2: Subtract 5/8c from both sides.

Step 3: Add 1/2 to both sides.

Step 4: Multiply both sides by 8/(-15).

HOW DO U SIIMPLIFY FRACTIONS!!!!!!!! IM NOT ON A TEST BUT I NEED TO KNOW I WAS ABSENT!!!!!!!!!!!!!!!!!!!!!PLZZZZZZZZZZZZZZZZZZZZZ HELP ASAP

Answers

Answer:

Following are the steps to simplify mixed fractions: Find the highest common factor (HCF) of numerator and denominator of the fraction part. Divide both the numerator and the denominator by HCF. The whole number part will remain the same.

Step-by-step explanation:

Please help me with this as soon as you can. I have no idea how to do it so please help me.

Answers

Answer:  60

Step-by-step explanation:

What is the equation for the line that passes through (3, 2) and has a slope
equal to 12
3

Answers

Answer:

Step-by-step explanation:

Remark

I'm not sure I know what you intend for the slope. I will take it as 12/3 = 4

If that is the case then what you have so far is

Solution

y = 4x + b

The given point determines b

Givens

x = 3

y  = 2

Given point

2 = 4*3 + b

2 = 12 + b

b = 2 - 12

b = -10

The equation is y = 4x - 10

∠1 and ∠2 are a linear pair. If the m∠2 = 33°, find the m∠1.

Answers

Answer:

157 degrees

Step-by-step explanation:

A linear pair is 180 degrees.

180-33 = 157

Answer:

m∠1 = 147°

Step-by-step explanation:

Since both angles are a linear pair, they both add up to 180°. This means that if m∠2 = 33°, then m∠1 would be 180°-33° which is 147°.

180°-33°=147°

Which statement could the expression 13 + x represent? Andrea has 13 eggs and bought 13 more. Victoria has 13 flowers. This is greater than the number of flowers Elisa has. Prakhar is 13 years older than his youngest sister. Kai is 13 blocks from home. Jack is a greater distance away.

Answers

Kai is 13 blocks from home. Jack is a greater distance away.

In this statement, 13 would represent the distance Kai is from home.... x would equal how much further away Jack is.

Hope this helps!!! Have an amazing day!!!! :)

Prakhar is 13 years older than his youngest sister. :) <3

Why is it important to read division problems carefully before giving the answer

Answers

Answer:

Because, like with any problem, it is possible to make mistakes. With division, if you place a number in the wrong order or forget to remove a negative sign, the answer will obviously be wrong.

Step-by-step explanation:

How do you divide decimals 10.305 divided by2.5?

Answers

♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️

[tex]10.305 \div 2.5 = [/tex]

[tex]10.305 \div \frac{10}{4} = \\ [/tex]

[tex]10.305 \times \frac{4}{10} = \\ [/tex]

[tex] \frac{10.305 \times 4}{10} = \\ [/tex]

[tex] \frac{41.220}{10} = \\ [/tex]

[tex]4.1220[/tex]

♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️♥️

Many professional schools require applicants to take a standardized test.
Suppose that 1000 students take such a test. Several weeks after the test,
Pete receives his score report: he got a 63, which placed him at the 73rd
percentile. This means that... *
Pete scored less than about 73% of the test takers.
Pete scored less than about 63% of the test takers.
Pete scored more than about 63% of the test takers,
Pete scored more than about 73% of the test takers,
Pete's score was below the median.

Answers

Answer:

if pete placed in the 73rd percentile, this means that his score was better than 73% of the other test takers, so the fourth option: he scored more than about 73% of the test takers

Step-by-step explanation:

hope this helps :)

The meaning is Pete scored more than about 73% of the test takers.

What is data?

Data is information that has been translated into a form that is efficient for movement or processing.

Given situation:

Pete receives his score report: he got a 63, which placed him at the 73rd

percentile.

Percentile is a comparison score between a particular score and the scores of the rest of a group.

So,  73 percentile shows he had done better then 73% of people.

Hence, Pete scored more than about 73% of the test takers.

Learn more about data here:

https://brainly.com/question/15403824

#SPJ2

Slope pls help I really need help I will do anything this is due tonight

Answers

Answer:

I believe that the answer is 1/2 but I cannot see the numbers on the axis's.

Step-by-step explanation:

Go up 1 and over 2.

Rise over run

Sorry if it isn't right but I can't see the numbers on the axis's.

It’s 1/2 the reason for this is find two points on the line that is not a decimal. Then do rise over run. Rise is y and run is x when u do that it should be 1/2

Which function translates each point on the graph of y=mx+b so that the slope of the segment from the original point to the translated point is 32?

Answers

Yep nice one for you guys it’s ok i love

Answer:

g(x)=m(x−2)+b+3

An ant starts walking along a parabola, y(x)=x^2 starting from the point where x=3 He walks until a point where x=3+a where a is a positive number. What is the y-coordinate of the point that he is at now?
plz no bs answers

Answers

Answer:

the y co-ordinate > 9

Step-by-step explanation:

I just graphed y = x^2 found the point where the x - axis was 3, found that the y co-ordinate was 9 and if you were to add any positive number the y co-ordinate would only get larger!

Hope this helps!

7(4p+2q+3r)
equal what

Answers

Answer:

Answer : 28p + 14q + 21r

The word distributive property is a rule or method that states that every term inside grouping symbols may be multiplied by a term outside grouping symbols to yield the equivalent expression.

Here is the formula for this question

a(b+c) = ab + ac

7(4p+2q+3r)

=28p + 14q + 21r

Also subscribe to Random Topics Trending On YouTub

Step-by-step explanation:

The ordered pairs in the table below define a function.

X Y
-2 9
0 5
2 1
4 -3

Select ALL of the equations that describe a function that is less steep than the function defined in the table.

⭕️ Y= 5
⭕️ Y = -3x
⭕️ Y = -x+6
⭕️ Y= -6x+3
⭕️ Y = -1/2x-4

Answers

Answer:

The 1st, the 4th, and the 5th ones are the answer :)

Step-by-step explanation:

A certain brand of coffee comes in two sizes. An 11.3-ounce package costs $2.88. A 27.8-ounce package costs $6.48.
Find the unit price for each size. Then state which size is the better buy based on the unit price.
Round your answers to the nearest cent.

Answers

Answer:

unit price for 11.3-ounce package = $0.25

unit price for 27.8-ounce package =  $0.23

27.8-ounce package is the better buy

Step-by-step explanation:

An 11.3-ounce package costs $2.88. A 27.8-ounce package costs $6.48.

a) 11.3-ounce package

11.3 ounces = $2.88

1 ounce = $2.88 ÷ 11.3

1 ounce = $0.25

b) 27.8-ounce package

27.8 ounces = $6.48

1 ounce = $6.48 ÷ 27.8

1 ounce = $0.23

$0.25 > $0.23

Check all the equations that apply to meet the Segment Addition Postulate in segment OQ. OP = 6x + 5, PQ = 4x and OQ = 45.

Answers

Answer:

[tex]6x + 5 + 4x = 45[/tex]

[tex]10x = 40[/tex]

Step-by-step explanation:

Given

[tex]OP = 6x + 5[/tex]

[tex]PQ = 4x[/tex]

[tex]OQ = 45[/tex]

The given parameters show that P is a point between O and Q.

So:

[tex]OQ = OP + PQ[/tex]

Substitute values for OP, PQ and OQ

[tex]45 = 6x + 5 + 4x[/tex]

[tex]6x + 5 + 4x = 45[/tex] --- This is an equation

Collect Like Terms

[tex]6x + 4x = 45 - 5[/tex]

[tex]10x = 40[/tex] ------ This is another

Make x the subject

[tex]x = \frac{40}{10}[/tex]

[tex]x = 4[/tex]

What is 2 1/2 feet to inches?

Actual question:
1 foot=12 inches
2 1/2 feet= blank inches


IREADY!!
thanks :)

Answers

Answer: 30 inches

Explanation: since there is 2 feet you do 12x2. This gives you 24. Then since there is a half foot and a half foot is equal to 6 inches you add that to your 2 feet (24 inches) to get 2 1/2 feet or 30 inches. Hope this helps have a nice day!!!

Anthony is laying concrete for a driveway. The driveway is to be 24 feet long by 11 feet wide by 8 inches deep. Answer parts (a) through (c)

(a) Determine the volume of concrete needed in cubic feet.

(b) If 1 cubic yard = 27 cubic feet, how many cubic yards of concrete are needed?

(c) If the concrete costs $36 per cubic yard, what is the cost of the concrete? Concrete must be purchased in whole cubic yards​

Answers

Answer:

a) The volume of concrete needed in cubic feet is 2,112. b) The number of cubic yards of concrete needed in cubic yards is about 79. c) The cost of the concrete using cubic yards is $2,844.

Step-by-step explanation:

a) The formula of the volume is l*w*d. 24 * 11 * 8 = 264 * 8 = 2,112.

b) The way to find this is that you take 2,112 and divide it by 27. Since the answer is 78.2 repeating, you round it up to 79 so it will fill up all of the concrete.

c) Since you need 79 cubic yards of concrete, you do 79 multiplied by $36 to get the total cost of $2,844.

There is 2 parts. but , help​

Answers

Answer: B

Step-by-step explanation:

5.
4. 3(4x - 5) < 8x + 3

Answers

Answer:

12x -15  < 8x + 3

   +15        +15

12x   <  8x + 18

-8          -8

  4x  <  18

    x  < 4.5

 

What is the fraction of 41.66667

Answers

Answer:

[tex]41\frac{2}{3}[/tex]  

I hope this helps!

Answer:

41.66 repeating or 41.67

Step-by-step explanation: hope this helps

Enter the range of values for x:​

Answers

Answer:

¿¿¿???

Step-by-step explanation:

first what is the question no only x = i didn´t see your computer

Answer:

yeah i don't see anything

Step-by-step explanation:

Six plus five times a number is more than the
number plus eight. Write an inequality and
solve it.

Answers

Answer:

x > 0.5

Step-by-step explanation:

Let the number be x.

6 + 5x > x + 8

4x > 2

x > 0.5

This is a question on inequalities. If you wish to venture further into it/understand this topic better, you may want to follow my Instagram account (learntionary), where I post some of my own notes on certain topics and also some tips that may be useful to you :)

What is the slope of the line?answer

Answers

Answer:

1

Step-by-step explanation:

the rise is 1

and the walk is 1

Each bottle of perfume contains 2.1 fluid ounces of perfume. The store sells 30 bottles. How many fluid ounces of perfume did the store sell in total

Answers

Answer:

63

Step-by-step explanation:

Answer:

Step-by-step explanation:so did u pass the edulastic test

work out the value of 7^4

Answers

Answer:

2401

Step-by-step explanation:

7^4

7 • 7 • 7 • 7

49 • 49

2401

Answer:

2401

Step-by-step explanation:

Pretty sure this is the answer. Have a good day!

I suck at math so can you help with this is a test so Yh

Answers

The correct answer is option D:)

On a blueprint, the diagram of a building has a height of 23 cm.
The height of the building is x times the height of the diagram.
Which equation represents the height, h, of the building?
A h = 23+x
B X = 23=h
C h = 23x
D
X = 23h

Answers

Answer:

C h = 23x

Step-by-step explanation:

The height is h, so we want h = something.

The blueprint height is 23 cm.

The real height is x times 23 cm, so it is 23x.

h = 23x

Answer: C h = 23x

Please help I’ll number 12!

Answers

Answer: y = -3/4x - 0.75

Step-by-step explanation:

The slope needs to be negative so that it's perpendicular to

y = 3/4x - 1

The equation then looks like this

y = -3/4x

We can get an exact y intercept number by using the cordinates

Lets input cordinates (3,-3)

-3 = -3/4(3)

-3 = -2.25 - 75 ( I inferenced )

-3 = -3

now that we got the y intercept lets put it all together

y = -3/4x - 0.75

Other Questions
why did Naacp support lawsuits against public institutions such as university of oklahoma? how did these lawsuits realated to the issue of intergation Who are most likely the suspects Steve refers to in the following passage (Paragraph 24)?STEVE. Go ahead, whats my wife said? Lets get it all out. Lets pick out every idiosyncrasy of every man, woman, and child on the street. And then we might as well set up some kind of kangaroo court. How about a firing squad at dawn, Charlie, so we can get rid of all the suspects? Narrow them down. Make it easier for you.A. Neighbors who appear different from other neighborsB. Criminals who have been caught in the neighborhoodC. City officials that control the neighbors lightsD. A family that moves into a new house paragraph on water cycle Recent research by Ravizza and colleagues suggests that students may spend as much as one-typical class hour browsing the internet.halfthirdfifthquarterNeed help on this question? Help me ASAP please Extending voting rights to include more groups of citizens has made the United States more? Solve the system of equations algebraically.5x - 3y = 66x - 4y = 2a. many solutionsC.no solutionb. (8, 14d. (9. 13)Please select the best answer from the choices provided A skier rides horizontally off of a 200 meter high cliff. If he lands 25 meters away from the base of the cliff, how fast was he skiing as he went off the edge?A. 0.91 m/sB. 2.91 m/sC. 3.91 m/sD. 25.91 m/s write the short note on durable and non durable materials The following DNA is being replicated and the origin of replication is in the middle of the sequence and marked with three stars ***. 5'ATCGGGCTACCCATGAAATGCTAGCATT***TAAGATCTTAAGCTAGCTAGTTCGATCTGA3'What is the sequence of the primer for the LEADING strand? Your answer should be 8 nucleotides long, written from 5' to 3' and only include the nucleic acid sequence (ex: ACTACTAC).note: there are two answers for this question Two cards are drawn in succession from a standard 52-card deck.1. What is the probability that the first card is red and the second card is black(A) If the cards are drawn without replacement?(B) If the cards are drawn with replacement?2. Two balls are drawn in succession out of a box containing 3 red and 5 white balls. Find the probability that at least 1 ball was red, given that the first ball was(A) Replaced before the second draw(B) Not replaced before the second drawContext Header: Conditional ProbabilityContext Section:Conditional Probability is a calculation of the likelihood of an occurrence provided that another event has already occurred. Conditional probability A provided B is generally written as:P(A/B)=P(AB)P(B) Isabel company offers other programs and incentives to help employees with their savings and expenses. To be tilted to the side is? in art/dance class You have been mowing grass in the hot sun and perspiring heavily, and depletion of liquids from your body has made you very thirsty. This state of arousal is referred to as: a. an incentive. b. homeostasis. c. a need. d. a drive. Hamburger meat sells for $6 for every 3 pounds. If Alicia buys 10 pounds of hamburger meat, how much will she pay? can somone help me please A car is traveling at 60 mph. If the rate of speed increases 4 mph each hour,how long will it be before the car is traveling at a rate of 80 mph?A) 4 hoursB) 5 hoursC) 6 hoursD 7 hours Galileo Galilei was the first scientist to perform experiments in order to test his ideas. He was also the first astronomer to systematically observe the skies with a telescope. Galileo made four key observations that challenged the widely accepted philosophical beliefs on which the geocentric model was based, thus providing support for the heliocentric model. From the following list of observations, which are the key observations made by Galileo that challenged widespread philosophical beliefs about the solar system?a) Jupiter has orbiting moons.b) The Sun has sunspots and rotates on its axis.c) The Moon has mountains, valleys, and craters.d) Venus goes through a full set of phases. what does this even mean Help please If there are 10 moles of HCl gas occupying 15L at 350C, what is the pressure? Be sure to show the setup andthe final answer and unit.Show Your Work