Why forest and wild life are closely related​

Answers

Answer 1

Answer:

Wildlife and Forests are heavily dependent on each other since Wildlife forms forests and helps them sustain and grow. In return, Forests provide wild organisms with food, shelter and other resources. Wildlife that live in the forest require it for survival. The forest protects them, in many cases feeds them.

Explanation:

Wildlife and Forests are heavily dependent on each other since Wildlife forms forests and helps them sustain and grow. In return, Forests provide wild organisms with food, shelter and other resources. Wildlife that live in the forest require it for survival. The forest protects them, in many cases feeds them.


Related Questions

Which is an example of the use of plants in human societs?

Answers

Answer:

|

v

Explanation:

photosynthesis creates oxygen, water and glocose(starch) and we take in those and use it in our mitochondrias to create atp so it can hapen all over again.

Human uses of plants include both practical uses, such as for food, clothing, and medicine, and symbolic uses, such as in art, mythology and literature.

This stuff annoying!!!!!!!!!!!!!!!!!!!!

Answers

wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink  wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink wink

can u answer that question

Answers

Answer:

The synthesis of new proteins

Set of 25 green plants and 25 mushrooms were put in a cool, dark room for two weeks. Each set was watered daily with 50 mL of a 0.1% fertilizer solution. Which statement best explains why the green plants died and the mushrooms survived?

Answers

Answer:

This question lacks options, however, it can be answered based on general understanding.

The green plant died because of absence of LIGHT

Explanation:

Plants (green) are autotrophic organisms i.e. organisms that are capable of synthesizing their own food via a process called PHOTOSYNTHESIS. However, on the other hand, mushrooms (kingdom FUNGI) are heterotrophic organisms i.e. rely on other organisms for energy source and cannot make their own food.

Green plants strictly require light energy from the sun in order to perform the process of photosynthesis. According to this question, a set of 25 green plants and 25 mushrooms were put in a cool, dark room for two weeks and watered daily with 50 mL of a 0.1% fertilizer solution. The green plants, despite the nutrients and regular watering dies because they were not exposed to LIGHT in order to make their food via photosynthesis. However, since light is not a requirement for mushrooms to obtain food, they will surely survive.

4
_ is a component of soil made entirely of decomposed organic remains. This component increases soil fertility and _
the ability of soil to retain water.
A. Humus; increases
B.
Parent material; decreases
C.
Subsoil; increases
D
Topsoil; decreases

Answers

Answer:

The answer is A

Explanation:

am 100% sure

which of the following is not true about an allele?

A. alleles are found at the same place on a chromosome

B. alleles have a dominant and recessive form

C. an allele is never independently assorted and passed down randomly

D. and allele is one of two or more forms of a gene

Answers

Answer:

C

Explanation:

I guess it's C but not conform

C. An allele is never independently assorted and passed down randomly.

What is an allele?

Alleles are found at the same place on a chromosome, known as a locus. They can have a dominant and recessive form, meaning that one form of the allele may be expressed over the other in the phenotype of an organism. An allele is one of two or more forms of a gene, which are variations of a particular gene that can produce different traits in an organism.

However, alleles are not always passed down randomly. In meiosis, the process of cell division that produces gametes (sex cells), the alleles of a gene are independently assorted and passed down to the offspring. This means that each gamete receives one copy of each allele at random, which can result in a mix of alleles in the offspring. However, the exact combination of alleles that an offspring receives depends on the combination of alleles that its parents had, which can influence the probability of certain alleles being passed down.

Learn more about allele, here:

https://brainly.com/question/14206531

#SPJ2

Based on the graph in Figure 2, identify the environmental conditions (flower density AND proportion of deep flowers) where a short- tongued bee has the greatest relative advantage over a long tongued bee. Based on the graph in Figure 2, identify the range of proportion of deep flowers at which a long tongued- bee always has an advantage over a short tongued bee.

Answers

Answer:

The correct answer would be - low flower density and low deep flower proportion

Explanation:

To find the environmental conditions for a short-tongued bee has the greatest relative advantage over long-tongued bees it is required to find the highest value of relative advantage short-tongued bees has on long-tongued bees which is the point where flower density and deep flower proportion is lowest (near the zero) according to the graph. That is represented in the graph by the peak in the white shaded portion.

To find the range of deep flower proportion at which a long-tongued bee has an advantage take a closer look to the grey shaded area where if the deep flower proportion move from 0.6 to 1 the advantage of long-tongued bees over short-tongued.

Floral density with the graph shows the low flower density and low deep flower proportion. Floral density often influences the species composition of flower visitors.

This variation in visitor species composition has significant effects on pollination success and plant fitness, poorly understood, especially in the many pollination guilds dominated by non-territorial species.

How do flower visitors diverse the traits?

It explores how flower visitors with diverse traits should distribute themselves across resource patches differing in floral density.

The model predicts that species with low flower search speeds and low flower handling costs compared to competitors will usually dominate dense flower patches.

In addition, amongst flower visitors that have lower energy expenditure rates while handling flowers than while traveling, species maximizing energetic efficiency are associated with dense flower patches.

Therefore, the correct answer is low flower density and low deep flower proportion.

Learn more about the flower density here:

https://brainly.com/question/11253692

PLEASE HELP ME!!!


3) Describe a eukaryotic cell. Your description should include where you would expect to
find these types of cells.

4)Describe a prokaryotic cell. Your description should include where you would expect to
find these types of cells.

Answers

3)Eukaryotic cells have membrane-bound organelles. They have a nucleus. They are usually found in animals and plants. In all multicellular organisms and some unicellular(amoeba)

4)Prokaryotic cells don't have a nucleus. They don't contain membrane-bound organelles they only contain ribosomes.They are much smaller. Bacteria are prokaryotes.

Can a
Brain cell
Fat cell
Muscle cell
Red blood cell
Liver cell
Convert one type of fuel molecule to another

Answers

answer: yes

exanation:

Can you give me a slogan for using compost at home

Answers

Answer:

Mark my answer the brainliest if this helps,

A Partner with the Environment.

Because What You’ve Got is Not Waste.

Clean Up Your Act. Compost.

Compost On Your Mind?

Don’t Burn Our Future.

Eat Smart

Enriching the Soil Naturally.

Feed the Soil.

Fit Energy Saving Light Bulbs

Give Green a Chance

Greening the Hill.

It’s Easy to Do.

Lets Talk Dirty.

Local Composting Made Easy.

Making a Clean Scene.

Making a Compost Pile

Mother Nature Recycles.

Nature’s Way to Grow.

Plant a Garden

Plant Trees

Raking Leaves

Recycle All Recyclable Items

Recycle Your Grey Water

Reduce The Use of Energy

Replenish the Earth for Generations.

Reuse Stuff

Reuse Whatever You Can

Reuse, Reduce and Recycle

Save Water To Save Money

Shoveling The Driveway

Smells Like Green Spirit

So Hot Right Now.

Sustainability Stools.

The Compost People.

The Solution to Sustainable Soil and Water.

Think Before You Buy

Too Good to Waste.

Turn It Off When Not In Use

Use Less Electricity

Walk To Work or Take The Bus

Waste Wise.

We Speak Organic.

We’re Growing.

Zero Waste.

Answer:

mark ssydnie the brainliest

Explanation:

centricles play specific roles during the division of​

Answers

Answer:Centrioles play a notable role in cell division. ... These spindle fibers act as guides for the alignment of the chromosomes as they separate later during the process of cell division. Though centrioles play a role in the mitosis of animal cells, plant cells are able to reproduce without them

Explanation:

What are common changes
In an environment?

Answers

Answer:shelter, land, prey

Explanation:

Changes? Do you mean like temperature and humidity

6. Name the nitrogenous wastes excreted by the following organisms:-
(1) Desert mole
(ii) Marine fish
(111) Tilapia​

Answers

Answer:

Desert mole excretes concentrated urine with urea.

Marine fish excretes urine with uric acid.

Tilapia excretes dilute urine with amino acids.

Explanation:

The nitrogenous wastes that are excreted by the following organisms are as follows:

Desert mole: Urea.Marine fish: Uric acid.Tilapia: Amino acids.

What is Nitrogenous waste?

Nitrogenous waste may be defined as the compounds which are excreted by the organisms that contain an excessive amount of nitrogen or its derivative products.

Among the above-given organisms, Desert mole and Marine fish are Ureotelic organisms that excrete either concentrated or diluted urine with a significant amount of urea and uric acid respectively.

While Tilapia is an Ammonotelic organism that excretes diluted urine with a significant amount of amino acids.

Therefore, it is well described above.

To learn more about Nitrogenous waste, refer to the link:

https://brainly.com/question/9517408

#SPJ2

1. Peer review allows others in the field to assess a scientist's investigations and results.
a. True
b. False

Answers

Answer:

False.

Explanation:

Peer review provide others scientist in the field to assess a scientist's investigations and results.

Peer Review:

It is the reviewing or evolution of the work by many professionals and experts in the field.

For example-  A scienfic manuscript is send to the many scientist for evolution before publication.

This peer review is unbiased because the reviewer does not know the name or other information about writter.

To know more about  Peer Review:

https://brainly.com/question/10853815

The movement of water in or out of the cell membrane without the use of ATP.

Diffusion

Facilitated diffusion

Osmosis

Excoytosis

Answers

The answer is Osmosis because its the only one that has anything to do with water

I need help with number 3​

Answers

O2 (oxygen) is a covalent compound

How would a geologist use absolute dating to determine the age of sedimentary layers? by dating the age of intrusions and extrusions near a sedimentary rock layer by comparing the relative ages of several sedimentary rock layers by identifying fossils in nearby intrusion and extrusions and determining their age

Answers

Answer:

Radiometric dating methods

Explanation:

Absolute dating is the process of determining an age on a chronological or specified time scale in which events occurred in archaeology and geology. Absolute dating can be determined by using properties of the atoms that make up materials.

The most common method of absolute dating uses by geologists is radiometric dating methods which is based on the natural radioactive decay of certain elements such as potassium and carbon found in the rocks. By comparing the ratio of parent isotope with a known half-life to daughter product in the rock, the age of the rock can be determined.

The carbon-14 isotope is used in radiocarbon dating, but is only useful for measuring recently formed rocks in the geologic past. The decay of Potassium-40 isotope known as potassium-argon (K-Ar) method allows dating of materials that up to 1,000 billion years old.

Answer:

by dating the age of intrusions and extrusions near a sedimentary rock layer

Explanation:

got it right on the assighment

someone pleaseee help me with this !!

Answers

lizards and snakes!

What structure is responsible for the suction created by the
starfish's tube feet?

Answers

I believe it’s A or the first answer. Hope this helps :)

describe and explain how the rate of photosynthesis is affected by light intensity​

Answers

Increasing the light intensity increases the rate of photosynthesis, until some other factor - a limiting factor - becomes in short supply. At very high light intensities, photosynthesis is slowed and then inhibited, but these light intensities do not occur in nature.

Write a summary statement for saturated fats including whether they are solids or liquids at room temperature and weather they have all single carbon-to-carbon or at least one carbon-to-carbon bond

Answers

Answer:

A saturated fat is a type of fat in which the fatty acid chains have all or predominantly single bonds. A fat is made of two kinds of smaller molecules: glycerol and fatty acids. Fats are made of long chains of carbon atoms. Some carbon atoms are linked by single bonds and others are linked by double bonds. Double bonds can react with hydrogen to form single bonds. They are called saturated because the second bond is broken and each half of the bond is attached to a hydrogen atom.

Explanation:

Answer:

saturated fats consists of single covalent bond and they are solid at room temperature and their melting point increases with increasing chain length

hope it helps

Explanation:

Adhesion occurs when water is attracted to other polar substances. Which of the following is an example of adhesion in organisms?
a. Capillary action of liquid in plant stems b. Release of sweat to reduce body heat
C. Movement of ions to maintain homeostasis
d. Pumping of blood through the circulatory system​

Answers

Answer:

a. Capillary action of liquid in plant stems

C. Movement of ions to maintain homeostasis

d. Pumping of blood through the circulatory system​

Explanation:

Hope this helped!

In organisms, an important example of adhesion is the: a. Capillary action of liquid in plant stems.

What is Adhesion?

Adhesion can be described as the attraction that occurs between molecules as a result of molecular mechanism, which is also known as capillary action.

In plants, capillary action occurs when the molecules of water cling to the xylem cell walls. This is known as adhesion.

Therefore, an example of adhesion in organisms is: a. Capillary action of liquid in plant stems.

Learn more about adhesion on:

https://brainly.com/question/14457491

#SPJ2

5 tips to improve your critical thinking - Samantha Agoos

Watch the Video and make a summary

Ps: They don't let me paste the link lookup what it says above

Answers

Answer:

that one is hard because we did not see the vidoe

Explanation:

what is a cell membrane?

Answers

Answer:

The cell membrane is the semipermeable membrane of a cell that surrounds and encloses its contents of cytoplasm and nucleoplasm.

Explanation:

Answer:

Short. The semipermeable membrane surrounding the cytoplasm of a cell.

Long. The cell membrane is the semipermeable membrane of a cell that surrounds and encloses its contents of cytoplasm and nucleoplasm. The cell membrane separates the cell from the surrounding interstitial fluid, the main component of the extracellular fluid.

Explanation:

what occurs in a chemical reaction

Answers

Answer:

options on. D is write answer

What do RNAs do in the cell?

Group of answer choices

Answers

Answer:

A wide range of functions are performed by RNA, from translating genetic information into molecular machines and cell structures to controlling gene activity during development, cellular differentiation, and changing environments.

Explanation:

None

Tay-Sachs disease is a rare inherited disorder that progressively destroys nerve cells
in the brain and spinal cord. The allele for having Tay-Sachs is recessive written as t
and the functional allele is written as T. If two heterozygous parents have four
children, how many of the offspring will most likely inherit and develop Tay-Sachs
disease?

Answers

Answer:

B and C

Explanation:

I just took the test and it was right

plants Which part of the carbon cycle occurs when plants, trees, or fossil fuels are burned?
A. Transpiration B. Oxidation C. Photosynthesis D. Combustion

Answers

I believe C- photosynthesis but I could be wrong.

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

Answers

Thymine(T) pairs with adenine(A)

Adenine(A) pairs with uracil(U)

Cytosine(C) pairs with guanine(G)

therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT

is

AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA

I'll give you a brainliest if is right or at least shows some effort
(thanks & i hope your having a good day)

In your own words, explain how background noise detected in space provides evidence for the Big Bang Theory.

Answers

Answer:

Celestial microwave radiation found a strange microwave signal causing background noise in the radio telescope. The signal came from every direction. The young universe would have been very hot. The microwave background radiation is the remaining heat from the Big bang.

I tried my hardest and this is what I put on MY test so good luck

Other Questions
Completa las oraciones conjugando correctamente en pretrito los verbos del banco de palabras.cenardesayunarviajarvervisitar1. Anoche mis amigos y yo ___ una pelcula2. El ao pasado mi padre ____a Machu Picchu.3. El lunes pasado ____en un restaurante elegante.4. Hoy por la maana mi hermano y yo _____juntos5. Ayer mis padres ___el Museo de Historia Natural. Whats A Definition For Binge Drinking ? please help!!!! im really confused and no one is answering my questions What rhetorical strategies and techniques does Ilya Kaminsky use in Deaf Republic? it is for a grade please help asap In 3 hours Jon can walk 5 miles. At thissame rate, how long can he walk in 5hours? Bill and Ted are each saving money for a trip to Europe. Bill started with $75 and saves an additional $15 per week. Ted began with $120 and saves an additional $10 per week. After how many weeks, x, will they have the same amount of money saved? Explain how you arrived at your answer. WILL GIVE BRAINLIEST Write an equation in slope-intercept form with the given slope and y-interceptIMAGE BELOW Which identifies the realationships between photosynthesis and cellar respiration SOMEONE HELP ME PLEASE ILL GIVE BRAINLY What was the name of the time period between 1880 and 1920 that was meant to move America forward during the Industrial Age? (7.8 x 10) x (1.0 10) = ?Scientific notation Can anyone help Im struggling with this Find the coordinating conjunction in the sentence the team members felt the task would be difficult but they areaccepting the challenge. PLZ HELP ME I BEGG YOU Cuba was a colony of which country?BritishFrancePortugalSpain please help will give brainliest If 3a + b + c = -3, a+3b+c = 9, a+b+3c = 19 find a*b*c Tom O'Brien has a 2-stock portfolio with a total value of $100,000. $65,000 is invested in Stock A with a beta of 0.75 and the remainder is invested in Stock B with a beta of 1.42. What is his portfolio's beta in Germany, the head of government the Chancellor- serves a four year term, and takes office upon winning a majority of thevote in the Federal Partiament.Based on this sentence, you can classify Germany's political system as being aA)presidential democracyB)parliamentary democracyC)constitutional monarchyD)benevolent oligarchy Mark drew a line to fit the data in a scatter plot as shown What is the equation of the line that Mark drew?