Why are snails classified as a gastropod mollusks?

Answers

Answer 1

Answer: Snails have soft bodies and are protected by shells, which are the characteristics of gastropods mollusks.


Related Questions

Describe the relationship between the weight added and the force of gravity.

Answers

Answer:

D

Explanation:

The heavier somthing is than the gravatational pull is more heavy

What is the complementary strand for the following DNA segment? C A A G T T C G A T G A

Answers

GTTCAAGCTACTGTTCAAGCTACT

Help me guys!! (Giving brainliest)

Answers

Answer: C

Explanation:

C because the cell membrane is semi permeable which means only certain substances can enter and exit.

What 3 traits have led to human evolution? And why?

Answers

Answer: bipedalism, brain expansion, and culture

Explanation:

How can acids be neutralized? What can form?

Answers

A neutralization reaction is when an acid and a base react to form water and a salt and involves the combination of H+ ions and OH- ions to generate water. The neutralization of a strong acid and strong base has a pH equal to 7

Determine the identity of an atom

Answers

Answer:

The number of protons in one atom of an element determines the atoms identity.

Which type of rock does B represent?

Group of answer choices

Answers

I thing it is volcanic rock

5. Explain how interactions and trade with Europeans affected West Africa?​

Answers

European Exploration Study Guide

Why did European countries compete for power in North America?

Economic—Gold, natural resources, and trade

Religious—Spread Christianity

Competitions for empire and belief in superiority of own culture

What were the obstacles faced by the explorers?

Poor maps and navigational tools

Disease and starvation

Fear of the unknown

Lack of adequate supplies

What were the accomplishments of the explorations?

Exchanged goods and ideas

Improved navigational tools and ships

Claimed territories

What regions of North America were explored and settled by France, England, and Spain?

Spain: Francisco Coronado claimed the Southwest of the present-day United States for Spain.

France: Samuel de Champlain established the French settlement of Québec. Robert La Salle claimed the Mississippi River Valley for France.

England: John Cabot explored eastern Canada.

What regions were explored by Portugal?

The Portuguese made voyages of discovery along the coast of West Africa.

How did the American Indians and Europeans interact with each other?

Spanish

Conquered and enslaved American Indians

Brought Christianity to the New World

Brought European diseases to American Indians

French

Established trading posts

Spread Christian religion

English

Established settlements and claimed ownership of land

Learned farming techniques from American Indians

Traded with American Indians

American Indians

Taught farming techniques to European settlers

Believed that land was to be used and shared but not owned

The alpha tubulin side of a microtubule is the site of microtubule:

A. growth

OB. dissociation

OC. movement

D.adaptation

Answers

Answer: Movement

Explanation:

Tubulins are the building block of microtubule,there are five distinct forms: alpha, beta, gamma, delta, and epsilon tubulin, they exist as globular dimeric .

Alpha and beta tubulins assemble into heterodimers they come together to form the long microtubule filaments. Some organism cellular movements require microtubules this include the beating of cilia and flagella for movement, cytoplasmic transport of membrane vesicles.

The alpha tubulin side of a microtubule is the site of microtubule movement.

(option c)

Tubulins

Tubulins are the microtubule building block and they exist as globular dimeric proteins of alpha/beta chains. There are five different forms: alpha, beta, gamma, delta, and epsilon tubulin.3

Alpha Tubulin is a fundamental cytoskeleton protein with many roled

Tubulin-binding drugs kill cancerous cells by inhibiting microtubule dynamics, which are required for DNA segregation and therefore cell division.

Learn more about tubulins:

https://brainly.com/question/12884177

What is a piscivore?
O An animal that eats fish
O An animal that eats plants
O Any fish species
O Any plant species

Answers

An animal that eats fish

Which types of rocks can become metamorphic rock?

both igneous and metamorphic rock

clastic sedimentary rock

both igneous and sedimentary rock

clastic or chemical sedimentary rock

Answers

Answer:

both igneous and metamorphic rock I believe

Explanation:

I I learned this in fourth grade I'm not sure if I'm correct if I remember correctly then it's these two sorry if it's wrong also tell me if it's wrong I'll try to tell you the right answer if it is wrong okay

Answer:

igneous, sedimentary, metamorphic all can

Explanation:

according to the diagram the temperature where clouds form is?

Answers

Answer:

higher than the temperature near mountains

Explanation:

Answer: C. lower than the temperature on the ground

Explanation: Because on the chart it shows the temp on the ground is 92° but then the temp where clouds form is 60°. This means that the temp at the ground is higher than the temp at 6000ft.

Examples of limiting factors

Answers

Are biotic , like food, mates and competition with other organisms for resources .

Which of the following processes is driven by gravity?
1.) Evaporation 2.) Condensation
3.) Precipitation 4.) Freezing

Answers

Answer:

Precipitation

Explanation:

The process which is driven by gravity is precipitation. In the process of precipitation, the clouds formed by evaporation of water drops off in the form of rain. Thus, the correct option is 3.

What is Precipitation?

Precipitation is one of the main processes of water cycle. Water cycle is a biogeochemical cycle which involves the flow of water in the atmosphere through different processes such as evaporation, precipitation, and in different phases such as solids, liquids, and vapors.

Precipitation is the process of water cycle in which the clouds formed by the evaporation of water drops off back to the land in the form of rain. This process is driven by the influence of gravitational force.

Therefore, the correct option is 3.

Learn more about Precipitation here:

https://brainly.com/question/18109776

#SPJ2

SOMEONE PLEASE HELP MEEEE you don’t have to explain just tell me if it’s true or false

Answers

Answer:

7. True

8. False

9. True

10. True

Explanation:

a. What is the major evolutionary advantage to producing an amnion?
b. What does that mean for embryonic development for the animal phylum as compared to the animal phyla?

Answers

WHAT IS THE MAJOR EVOLUTIONARY ADVANTAGE TO PRODUCING AN AMNION?

The main evolutionary advantage of producing an amnion is that the embryos of the amniotic membrane,the amniotes are made available with their own aquatic environment,this in-turn resulted to a lesser dependence on water for it's maturation and development therefore allowing or giving room for the amniotes to branch towards environments that are drier.

WHAT FOES THAT MEAN GOR EMBRYONIC DEVELOPMENT OF THE ANIMAL PHYLUM AS COMPARED TO THE ANIMAL PHYLA?

The embryonic development of animal phylum is also known as embryogenesis.

It is the development of the embryo from the point of fertilization of an egg,(the ovum) by a sperm cell ,this makes the fertilized egg a diploid cell otherwise known as a zygote.

This zygote undergoes mitosis,a mitotic division known as cleavage and a differentiation resulting in a multicellular embryo.

This embryonic development of animal phylum comprises of 36 animal phyla.

Let's suppose you were interested in developing drugs to prevent epigenetic changes that may contribute to cancer. What cellular proteins would be the target of your drugs?

Answers

Answer:

Potential targets:

1- DNA methyltransferases

2- Chromatin modifiers such as histone acetyltransferases, histone deacetylases, histone methyltransferases, etc.

3- Components of the RNA interference (RNAi) machinery such as Dicer, Argonaute, etc.

Explanation:

Epigenetics can be defined as the study of any heritable change in the phenotype that does not involve modifications in the DNA sequence. Epigenetic mechanisms can be classified into three major types: 1-DNA methylation, 2-histone modifications (e.g., acetylation, methylation, phosphorylation, etc), and 3-regulatory non-coding RNAs (e.g., miRNAs, lncRNAs, siRNAs, etc) that modulate target gene expression via the RNA interference pathway. There are different types of proteins that are involved in these complex epigenetic mechanisms, and those cited above represent only some examples that can be used as therapeutic targets.

A peptide has the sequence of Gly-Ser-Glu-Leu-Ala-His-Gly-Arg-Leu-Ala-PheCys-Leu. (pKR=4.25, 6.0, 8.2, 12.5. Assume pKa’s of amino terminus and carboxyl terminus are 9.6 and 2.3, respectively.) The PI of the peptide is close to:_______

a. 7.1
b. 7.8
c. 5.1
d. 8.2
e. 10.3

Answers

Answer:

The correct answer is option a. "7.1".

Explanation:

One easy way to determine if a peptide sequence is acidic, basic or neutral is to check for the number of amino acid residues that are acidic, basic or neutral. In this case, most amino acid residues are neutral, which mean that under neutral conditions they have a pKa close to 7.0. Particularly, the content of 3 leucine, 2 alanine and 2 glycine residues determines that the peptide have a pI of around 7.1.

Plz help I’ll mark brainliest

Answers

Answer:

C. The study of the interaction between living and nonliving factors in an environment

Explanation:

Ecology is the study of both living and nonliving things in an environment, the only answer that relates to this in significance is C.

Homeostasis: Response to Stimuli
From the examples below, select the examples of cells or organisms responding to stimuli in order to maintain homeostasis.
1.)A plant bending toward a light source
2.)A cell bursting because it takes up too much water
3.)A person shivering when their body temperature is low
4.)A unicellular organism beating microscopic hairs to escape a chemical pollutant in its environment
5.)A cell dying due to a chemical poison
6.)An animal growing larger
7.)Ants moving within their mounds depending upon the time of day
8.)Iguanas laying in the sunlight if their body temperature is low
9.)Birds migrating when seasons change
10.)A person or animal getting sick because of infectious bacteria
part2 fill in the blank
A state of biological balance, or ____________ , is important for the survival of individual cells and ____________ alike.
Physiological factors such as ____________ , water levels, and pH must remain within a certain ____________ for cells and organisms to remain healthy and functional.
Regulation of the ____________ environment of cells and organisms is carried out through ____________ and other control ____________ .
choice of words:
location
external
hormones
mechanism
homeostasis
internal
groups
feedback
oganisms
temperature
range

Answers

Answer:

3.)A person shivering when their body temperature is low.

7.)Ants moving within their mounds depending upon the time of day

1-A plant bending toward a light source.

.-Iguanas laying in the sunlight if their body temperature is low.

.-A unicellular organism beating microscopic hairs to escape a chemical pollutant in its environment

.-Birds migrating when seasons change.

The maintenance of relatively constant internal environment of an organism is called  Homeostasis.It is an automatic regulations of the body systems and organs controlled by the brain and some receptors, specific for certain body fluctuations.E.g Thermoreceptors Chemoreceptors etc.

The fluctuations in the body internal systems must be controlled within a narrow limits, for existence of living organism.The brain receives inputs from the receptors, and the outputs from the brain ensures the  homeostatic control.

The above examples are typical homeostatic responses by the organisms involved, because the inputs from the receptors  send signals to the brain ,and the organisms  responded to these with the example above.

Explanation:

Plzzzzz help I’ll mark brainliest

Answers

Answer:

Im pretty sure its B

Explanation:

Ecology.

The definition of ecology is: the branch of biology that deals with the relations of organisms to one another and to their physical surroundings.

This means that it is the study of how organisms interact with each other and their environment.

Not sure if it's right? Let's take a look at the other answers.

Definition of biosphere: the regions of the surface, atmosphere, and hydrosphere of the earth (or analogous parts of other planets) occupied by living organisms.

Definition of biotic: relating to or resulting from living things, especially in their ecological relations.

Definition of biome: a large naturally occurring community of flora and fauna occupying a major habitat, e.g. forest or tundra.

Hope this helps!

#LearnwithBrainly

Which of the three traits considered in this film (bipedality, extensive tool use, and large brains) were present in the 3.2-million-year-old Australopithecus fossil (Lucy)?.

Answers

Answer:

The bipedality

Explanation:

One of the things the discovered fossil signified was that human bipedality was more ancient than the large brain size because Lucy actually had a small skull which could indirectly be translated to small brain size.

NOTE: Bipedality can be described to mean the ability of an organism to move about with two legs. Hence, it must have been discovered that Lucy had two legs.

. How are mineral deposits formed around vents?​

Answers

Answer:

When hot, metal-laden water spews from vents and mixes with the cold ocean, the metals precipitate. Large piles of sulfide accumulate on the seafloor and are eventually buried by sediments, modified by heat and pressure in the crust, and uplifted. Some are exposed on land when erosion removes the overlying rocks.

particles is found in the nucleus of an atom

Answers

Answer:

protons and neutrons

Explanation:

Protons and neutrons have a positive and neutral charge, respectively. They are in the nucleus, while the negative electrons orbit the nucleus.

Answer:

Protons, neutrons, electrons

Explanation:

If you're asking about subatomic particles.

Please check
Here’s the first one

Which statement is most supportive of the claim that genetic diversity is an advantage of sexual reproduction?

Genetic variation from sexual reproduction ensures that at least some individuals will have advantageous traits that help them survive.

Asexual reproduction results in the same genes being copied, which means the same vulnerabilities in the population.*******

Sexual reproduction creates genetic diversity, which results in a wide range of appearances in a population.




Lack of genetic diversity from asexual reproduction results in a diminished ability to survive changes to the environment.


What is the most likely explanation for a child exhibiting a heritable trait that neither parent exhibits?

The trait was passed on by a different biological parent, and one of the child's parents is not biologically related.

The trait was inherited from a more distant relative, like a great-grandparent.




The parents carried a second trait that masked the trait of interest.

The trait is recessive, so both parents carry it, and the child inherited each recessive allele.**********

Which statement has exceptions?

Sexual reproduction requires two parents, whereas asexual reproduction requires only one parent.

Sexual reproduction produces genetic variation, but asexual reproduction does not.

Sexual reproduction is more complex, while asexual reproduction is a simpler process.

Sexual reproduction involves parental care, while asexual reproduction does not.******

Assume a bacterial cell failed to replicate its DNA before it reproduced two daughter cells. The reproduction would result in

neither cell containing DNA.

both cells containing DNA.

one cell with DNA and one cell without DNA.*******

one cell with DNA and one cell with two sets of DNA.


A parent bacterial cell is able to survive in the presence of the antibiotic penicillin. Subsequent generations from this parent will be _______ penicillin.(1 point)

resistant to*****

killed by

dependent on

vulnerable to

Hydras are animals related to coral and jellyfish. Hydras can reproduce sexually or asexually. Why would hydras avoid reproducing asexually when conditions are difficult?

The lack of genetic diversity could mean that all of the hydras die, depending on the situation. ******

The high genetic diversity could mean that all of the hydras die, depending on the situation.

Reproducing more rapidly would be a good way to take advantage of plentiful resources.

Reproducing more slowly would be a good way to take advantage of plentiful resources.

Answers

Answer:

yeah the first one

Explanation:

just because

7. Chemical or physical factor that determines the number
of organisms in a population

Answers

Answer:INTERSPECIFIC COMPETITION

Explanation:

The physical factor that determines the number of organisms in a population is ;   Interspecific competition

Interspecific competition in a population is a competition that exists between organisms of different species, while the competition that occurs within organisms of the same specie is termed intraspecific competition.

During Interspecific competition the different species compete for food, water and Habitat which every organism needs to survive, and in most cases the stronger specie overruns the weaker species and this will lead to the depletion in the number of the organisms of the weaker specie and an increase in the number of the stronger specie within the population.

Hence we can conclude that The physical factor that determines the number of organisms in a population is ; Interspecific competition .

Learn more : https://brainly.com/question/1638475

1. Does a scientific theory ever become a law? Explain
the difference between scientific theory and law.

Answers

Answer:

a theory cannot become a law

Explanation:

the difference between a scientific theory and a scientific law because a theory is an in depth explanation of an observed phenomenon. a law is a statement about an observed phenomenon or an unifying concept (i.e.: newtons law or gravity - no explanation on how it works or what it is just that it exists.)

No a theory can not be a law

The increase in the reproductive success of a species will have the greatest impact on the - size of that species’ population. competition within other communities in the biosphere.. success of other populations in the community. tissues that comprise organisms of that species.

Answers

Answer:

size of that species’ population.

Explanation:

The increase in the reproductive success of a species will have the greatest impact on the size of that species’ population.

A reproductive success rate means more individuals survive birth and get added to the existing population. The more the number of individuals added to a population, the more the size of the population of the species.

An increase in the population size of a species will only increase intra-species competition for resources but have no real impact on the success of other populations in the community.

Which purpose does a cell membrane play in eukaryotic cells?

Answers

The cell membrane controls the movement of substances in and out of cells and organelles. In this way, it is selectively permeable to ions and organic molecules.

A strategy for fighting bacterial infections uses viruses. Viruses that infect bacteria are called bacteriophages. Phage comes from the Greek word for “eater.” Explain why it is not accurate to call a virus that kills bacteria a “bacteria eater." What happens when a virus attacks a cell?
help!!

Answers

Answer:

Viruses are not living organisms, and for that reason a bacteriophage virus does not feed on bacteria, but uses them to replicate, producing lysis of the bacterial cell in the process.

Explanation:

Viruses are structures formed by genetic material —DNA or RNA—covered by a protein envelope called the viral capsid. These structures do not perform the vital functions of a cell, so they are not considered living organisms.

A bacteriophage virus is characterized by using prokaryotic cells to replicate, destroying them in the process.

Viruses need a living cell to be able to replicate, so they introduce their viral genome into them to replace the genetic material of their nucleus and be able to multiply. They can do this:

Introducing the genetic material from outside the cell. Entering directly into the cell to be able to replicate.

Bacteriophage viruses do not eat the bacteria, they simply use it to reproduce, and then happens the lysis of the bacterial cell.

Answer:

Viruses are not living organisms, and for that reason a bacteriophage virus does not feed on bacteria, but uses them to replicate, producing lysis of the bacterial cell in the process.

Explanation:

Other Questions
Who is responsible for electing the president in South Africa? Why might you use figurative language please helpWhich values of k would cause this system of equations to have no solution? Check all that apply.6x + 4y = 14,3x + 2y = k-2571021 Complete the dialogue with the present perfect or past simple form of the verbs in brackets.Jack: How long ______ (your dad/be) collecting musical instruments, Kate?Kate: He _____ (begin) collecting them in the 1980s. Now he's got 1500 instruments.Jack: That's amazing! Does he keep them all at home?Kate: Yes. But we _____ (just/ move) to a bigger house because we ____ (not have) enough space for this collection in our old place.Jack: What is his favourite musical instrument in the collection?Kate: He _____ (buy) many amazing instruments, but I think his favourite is a Navajo drum. My dad ______ (find) it in Arizona about five years ago. State whether the given pair of sets are equal, equivalent, both, or neither. {0,9}; {8, 1) Which type of pronoun is used in the sentence?Select Intensive or Reflexive. ALSO if you have a steam account add me Im trolldier with a frog as my avatar picture. :D Which of the items below is a colloid? a.fruit salad b.gelatin c.lacquer When aqueous solutions of AgNO3 and KI are mixed, AgI precipitates. The balanced net ionic equation is ________. When aqueous solutions of AgNO3 and KI are mixed, AgI precipitates. The balanced net ionic equation is ________. AgNO3 (aq) + KI (aq) AgI (s) + KNO3 (aq) Ag+ (aq) + I- (aq) AgI (s) AgNO3 (aq) + KI (aq) AgI (aq) + KNO3 (s) Ag+ (aq) + NO3 - (aq) AgNO3 (aq) Ag+ (aq) + NO3 - (aq) AgNO3 (s) Differentiate between the clothing of the poor and the clothing of the wealthy. One package of blackberries costs $3. How many packages of blackberries can you buy for $15? uestion 1:Damon wants to sell his motorcycle that he paid $4,000 for 3 years ago. The motorcycle depreciated (decreased in value) at a constant rate each month over a 3-year period. If x represents the monthly depreciation amount, write an expression that shows how much Damon can sell his motorcycle for today. PLEASE HELP I WILL MARK YOU BRAINLIEST into the value of 5/6 + (-4/9)-(-2) simplify the fraction 15/45 The slope of the line whose equation is 3 x - 2 y = 4 is:A. 2/3B. -2C. 3/2 how did the national debt increase to 54 million?a. It included state debts and interest amounts b. It included the cost of paying off bonds at higher costc. It included the cost of paying off the original creditorsd. It included the cost of shifting the capitale. It included the cost of setting up the federal bankhelppp I just need this answerrrr identify the biomes on the map and then answer the questions that follow which biome has the warmest temperatures and the most rainfall In 2001, a school population was 1696. By 2007 the population had grown to 2614.1) How much did the population grow between the year 2001 and 2007? students2) How long did it take the population to grow from 1696 students to 2614 students? years3) What is the average population growth per year?students/year4) What was the population in the year 2000? students5) Find an equation for the population, P , of the school t years after 2000.P = 6) Using your equation, predict the population of the school in 2011. students what is Inhabited prefix suffix and root 1. There are infinite black and white dots on a plane. Prove that the distance between one black dot and one white dot is one unit.