Why are people convicted of a crime given prison sentences?



Choose all answers that are correct.


to protect the civil rights of criminal defendants


to serve as a warning to others


to protect society


to punish the person

Answers

Answer 1

Answer:

To punish the person and to serve as a warning to others.

Explanation:

First, they serve the goal of deterring future crime by both the convict and by other individuals contemplating a committal of the same crime. Second, a sentence serves the goal of retribution, which posits that the criminal deserves punishment for having acted criminally.


Related Questions

Who ever can answer this for me will get a brainly!!

Answers

Answer:

D. Russia

Explanation:

How did the geographic distribution of religions in Europe in the 17th century impact colonies in the Americas?

Answers

Answer:

BELOW.

Explanation:

Most attempted to enforce strict religious observance. Laws mandated that everyone attend a house of worship and pay taxes that funded the salaries of ministers. Eight of the thirteen British colonies had official, or “established,” churches, and in those colonies dissenters who sought to practice or proselytize a different version of Christianity or a non-Christian faith were sometimes persecuted.

Although most colonists considered themselves Christians, this did not mean that they lived in a culture of religious unity. Instead, differing Christian groups often believed that their own practices and faiths provided unique values that needed protection against those who disagreed, driving a need for rule and regulation.

In Europe, Catholic and Protestant nations often persecuted or forbade each other's religions, and British colonists frequently maintained restrictions against Catholics. In Great Britain, the Protestant Anglican church had split into bitter divisions among traditional Anglicans and the reforming Puritans, contributing to an English civil war in the 1600s. In the British colonies, differences among Puritan and Anglican remained.

Between 1680 and 1760 Anglicanism and Congregationalism, an offshoot of the English Puritan movement, established themselves as the main organized denominations in the majority of the colonies. As the seventeenth and eighteenth century passed on, however, the Protestant wing of Christianity constantly gave birth to new movements, such as the Baptists, Methodists, Quakers, Unitarians and many more, sometimes referred to as “Dissenters.”  In communities where one existing faith was dominant, new congregations were often seen as unfaithful troublemakers who were upsetting the social order.

Despite the effort to govern society on Christian (and more specifically Protestant) principles, the first decades of colonial era in most colonies were marked by irregular religious practices, minimal communication between remote settlers, and a population of “Murtherers, Theeves, Adulterers, [and] idle persons.” An ordinary Anglican American parish stretched between 60 and 100 miles, and was often very sparsely populated. In some areas, women accounted for no more than a quarter of the population, and given the relatively small number of conventional households and the chronic shortage of clergymen, religious life was haphazard and irregular for most. Even in Boston, which was more highly populated and dominated by the Congregational Church, one inhabitant complained in 1632 that the “fellows which keepe hogges all weeke preach on the Sabboth.”

Christianity was further complicated by the widespread practice of astrology, alchemy and forms of witchcraft. The fear of such practices can be gauged by the famous trials held in Salem, Massachusetts, in 1692 and 1693. Surprisingly, alchemy and other magical practices were not altogether divorced from Christianity in the minds of many “natural philosophers” (the precursors of scientists), who sometimes thought of them as experiments that could unlock the secrets of Scripture. As we might expect, established clergy discouraged these explorations.

In turn, as the colonies became more settled, the influence of the clergy and their churches grew. At the heart of most communities was the church; at the heart of the calendar was the Sabbath—a period of intense religious and “secular” activity that lasted all day long. After years of struggles to impose discipline and uniformity on Sundays, the selectmen of Boston at last were able to “parade the street and oblige everyone to go to Church . . . on pain of being put in Stokes or otherwise confined,” one observer wrote in 1768. By then, few communities openly tolerated travel, drinking, gambling, or blood sports on the Sabbath.

how many years African(s) ______ limited travel and trade. A- Rain Forests. B- Grasslands. C- Sahel. D- Deserts.​

Answers

Answer:

D

Explanation:

The idea of Manifest Destiny meant that

Answers

Answer:

The idea that the U.S. is destined-by God, its advocates believed-to expand its dominion and spread democracy and capitalism across the entire North American continent.

Who was the sea god?
O Apollo
O Artemis
O Zeus
Poseidon

Answers

Answer:

Poseidon

Explanation:

In ancient Greek religion, god of the sea (and of water generally), earthquakes, and horses.

Answer:

posiden

Explanation:

What significant event happened in 1933 that
related to coal miners and their rights?

Answers

Answer:

the coal mining strike in july of '33 should be your answer!!

Explanation:

Such country supplied most of the soldiers who defended the Alamo

Answers

Answer:

i believe it is the united states

Explanation:

You think I know bruuuuuuuuhhhhh

Is it true that Europeans in central america died of disease, overwork, and starvation?

Answers

Yes because of the long voyage their were a lot of complications such as a lot of sickness which resulted in people dying, and also because of the lack of food.

What is one of the three powers of the
House of Representatives?

Answers

Answer:

A representative’s primary duties include introducing, debating, and voting on bills.

Explanation:

plz help i need it :) will mark brainliest :D

Answers

Answer:

I believe the answer is D

Explanation:

Answer:

I think either it is oil or gold....

Fill in the blank: The Koran is to Islam as ______ is to Christianity.

Answers

the koran is to islam as the BIBLE is to christianity

Answer:

The Bible

Explanation:

Without Korea There's No Islam

Without The Bible There's Not Christianity!

Hope This Helps

Doh! My Brian Hurts

Oklahoma farm restructuring occurred throughout the late 20th century, indicative of the rise of corporate _________.

Answers

Answer:

The fourth comprises the energy boom and bust of the late twentieth century, along with ... The growth of the non-Indian population grew remarkably. ... In contrast, throughout much of the nineteenth and early twentieth centuries ... War II and postwar recovery, and the dramatic restructuring of the farm economy in the 1950s.

Explanation:

Answer:

crop prices

Explanation:

In the 1500s, the Council of Trent was led by a group of

Lutheran ministers who wanted to spread their ideas.
Catholic cardinals who wanted to reform the Church.
German princes who wanted to end a peasants’ rebellion.
Calvinists who wanted to make laws that followed their beliefs.

Answers

Answer:

Correct answer is Catholic cardinals who wanted to reform the Church.

Explanation:

First and last option cannot be correct because it was a council of Catholic church, therefore Lutherans and Calvinists couldn't led it.

Also, this was a church council, so the answer princess cannot be taken into account.

On the other side, Catholic church needed to introduce certain changes to fight of Protestants, and therefore they decided to introduce certain changes in the church that were leading factor in the process of Counter Reformation.

According to the passage, an eon
A. Is shorter than an age.
B. Is longer than a era.
C. Always lasts 2 billion years.
D. Must contain at least four epochs.
QUICKK

Answers

The answer is B. Hope this helped! <3

Why were the poor in Germany discontented with the Weimar Government?

Answers

Answer:

For right now imma say A (i looked in the textbook) but if im wrong ill update

Explanation:

The poor in Germany were discontented with the Weimar government because only the rich were given employment and groceries. Thus, option 'A' is the correct option.

Why were Germans unhappy with the Weimar government?

After Germany's defeat in World War One, a period of instability and anarchy led to the establishment of the Weimar Republic. There was famine, the Kaiser had escaped, and the fledgling Republic had a difficult beginning for two reasons:

Many Germans despised the administration and referred to them as "November criminals" because they had signed the armistice in November 1918. The German people were greatly surprised by the outcome of the war, which gave rise to the conspiracy belief that the politicians had "stabbed in the back" the valiant German troops.Many Germans believed the Treaty of Versailles had given their nation a terribly unfair bargain. They were angry with the administration for signing it and accepting its terms despite being coerced into doing so by the Allies.

Learn more about the Weimar Government, here:

https://brainly.com/question/474341

#SPJ2


Help plzzzzzzzzzzzz

Answers

Answer:

I believe it would be B. to define the articles

Explanation:

4. Which issues in France in the 1780s would have been addressed if the Declaration of the Rights of Man and the
Citizen were enforced?

Answers

Answer:

The French Revolution resulted from two state crises which emerged during the 1750s–80s, one constitutional and one financial, with the latter providing a 'tipping point' in 1788/89 when desperate action by government ministers backfired and unleashed a revolution against the 'Ancien Regime.' In addition to these, there was the growth of the bourgeoisie, a social order whose new wealth, power, and opinions undermined the older feudal social system of France. The bourgeoisie were, in general, highly critical of the pre-revolutionary regime and acted to change it, although the exact role they played is still hotly debated among historians.

Maupeou, the Parlements, and Constitutional Doubts

From the 1750s, it became increasingly clear to many Frenchmen that the constitution of France, based on an absolutist style of monarchy, was no longer working. This was partly due to failures in government, be they the squabbling instability of the king's ministers or embarrassing defeats in wars, somewhat a result of new enlightenment thinking, which increasingly undermined despotic monarchs, and partly due to the bourgeoisie seeking a voice in the administration. The ideas of 'public opinion,' 'nation,' and 'citizen' emerged and grew, along with a sense that the state's authority had to be defined and legitimized in a new, broader framework which took more notice of the people instead of simply reflecting the monarch's whims. People increasingly mentioned the Estates General, a three-chambered assembly which hadn't met since the seventeenth century, as a possible solution that would allow the people—or more of them, at least—to work with the monarch. There wasn't much demand to replace the monarch, as would happen in the revolution, but a desire to bring monarch and people into a closer orbit which gave the latter more say.

that i i got my fingers hurt brainly plz

Explanation:

I NEED THIS RIGHT NOW WILL GIVE 60 POINTS AND BRANLIEST!!!!!!

How did Archibald Murphey plan to improve infrastructure in North Carolina? Check all that apply.

by using tolls on roads and waterways to fund development
by cleaning existing canals and waterways
by constructing rail lines to connect the mountains and the coast
by building new roads and canals
by dredging rivers to provide better access for boats

I think that E is one of the answers

Answers

Answer:by dredging rivers to provide better access for boats . by building new roads and canals .by using tolls on roads and waterways to fund development.by constructing rail lines to connect the mountains and the coast.

Explanation:give brainlest

Archibald Murphey plan to improve infrastructure in North Carolina

-by building new roads and canals.

-by constructing rail lines to connect the mountains and the coast.

-by dredging rivers to provide better access for boats.

Archibald Murphey planed to improve internal infrastructure in the 19th century in North Carolina. He proposed investment in transportation projects such as railroads, harbours, roads, canals, and rivers.North Carolina was isolated and poor in the early 19th century, which allowed Murphey to plan to improve the transportation condition to improve the economy of the state.Murphey recommends the government undertake transportation projects, develop markets, and drain swamps to create farmland.

Therefore we can conclude that Archibald Murphey plans to improve infrastructure in North Carolina.

Thus option C,D,E are the correct answer.

Learn more about "Archibald Murphey " here:

brainly.com/question/14251393

What factors caused the Greeks to be known as reliable navigators​

Answers

At any one time in the year at any one point on the globe, the sun and stars are found above the horizon at certain fixed heights at a distance that mariners can measure with as simple an instrument as one's fingers, laid horizontally atop one another and held at arm's length.

What was one of the weaknesses of the United States government under the Articles of Confederation?

1-Small states did not have independence
2-The large states had also done it. many votes
3-The Supreme Court has too much power
4-Congress cannot collect taxes

Answers

Answer:

4

Explanation:

The articles didn't have the power to regulate or give taxes.


Who became the first governor to be inaugurated in the New Capitol in 1904?

Answers

Answer:

John Motley Morehead was an American lawyer and politician who became the 29th Governor of the U.S. state of North Carolina.

Explanation:

Is it this one?

Answer:

Azikiwe, Nnamdi

Explanation:

What would most Americans see as a disadvantage of globalization?
Consumer goods cost less to buy.
Jobs move to cheaper labor markets.
O Businesses import cheaper materials.
Overseas markets remove most tariffs.

Answers

Answer:

Jobs move to cheaper labor markets.

Explanation:

The major disadvantage of globalization that most Americans see is Jobs moved to cheaper labor markets.

What do you mean by Globalization?

Globalization refers to the process of integration and interaction among people, companies, and governments.

Despite the major advantages of globalization, the major disadvantage of globalization that Americans see is that jobs are lost and transferred to lower-cost countries.

Therefore, B is the correct option.

Learn more about Globalization here:

https://brainly.com/question/12646918

#SPJ2

What was the trend in immigration and birth region between 1900 and 1990?

Answers

Answer:

ewan ko huh di ko gets tangaaa kaaaaa bat ka pa kaseee nag tatanongggggg

which of the following physical properties is not typical of a non-metal?
-poor conductors
-they are very shiny
-not malleable​

Answers

Answer:

Not malleable

Explanation: just trust me

Answer:

they are very shiny

Explanation:

if it is not typical for non- metals than its typical for metals

Jews were which of the following?
O Banned from leaving the country.
O Banned from returning to the country.
Not allowed to travel throughout the country.
Not allowed a passport.
O Unable to hold religious services.

Answers

Answer:

Banned from leaving the country

Explanation:

I assume you are talking about the holocaust?  

Which purpose is best for writing a friendly letter?

sharing a memory
reflecting an opinion
requesting a document
registering a complaint

Answers

the best purpose would be to share a memory!

hope this helps!

Answer:

c

Explanation:

i know it is right 99.99

In your own words, explain the significance of the Magna Carta signed by King John.

Answers

Answer:

Gonna have to stop you there-

Explanation:

In your OWN words! ^^  The document was a peace treaty between John and his barons. That's all the help I'm going to give!

How do the reasons for U.S. entry into the war given by President Wilson differ from those given by Senator Norris

Answers

Answer:

Senator Norris was not in favor of United States entering into war with Germany.

Explanation:

President Woodrow Wilson was an academic and American politician who served the President of America from year 1913 to year 1921. He was the 20th president of the USA. While George W. Norris was a former senator of United States. He served 5 terms as Senate in the House of the Representatives and is considered as the greatest Senator of the history of United States.

President Wilson during the world war I, gave a speech and declared that USA should enter into war with the Allies against the Central power. While Senator Norris gave a speech in the senate the oppose he idea of US entering into a war with Germany. The reasons that President Wilson gave in favor of his speech are  :

1. Wilson claimed that Germany may pose to be a new threat to the World democracy.

2. Germany was going to recommence Submarine warfare.

This excerpt describes an instance of deportation during the 1930s as part of a repatriation effect. Why did the federal government implement repatriation

Answers

This question is incomplete. Here's the complete question.

"They wanted us out of the country. I didn't understand why when we'd been born here."

Emilia Castaneda was born in Los Angeles to Mexican parents. In 1935, she and her father and brother were forced to board a train bound for Mexico.  

This excerpt describes an instance of deportation during the 1930s as part of a repatriation effort. Why did the federal government implement repatriation?

To fulfill the terms of a global peace treaty

To protect national security

To reduce competition for jobs

To prevent communist influence on labor unions

Answer: To reduce competition for jobs

Explanation:

The repatriation was part of several actions aligned with the prevailing anti-Mexican idea that claimed that the solution to the growing unemployment of the US population caused by the Great Depression was to leave non-Americans out of the job competition. In addition to laws restricting employment opportunities to native-born or naturalized citizens, the repatriation sent around a million people of Mexican origin out of the United States.

This excerpt describes an instance of deportation during the 1930s as part of a repatriation effect. The federal government implements repatriation to reduce competition for jobs. C is the right option.

During the Great Depression, the government organized the Mexican Repatriation, a campaign to expel Mexicans and Mexican Americans from the United States.

The repatriation was intended to lower the unemployment rate in the country and provide Americans with more employment opportunities. Because Emilia Castaneda and her family are Mexican Americans and were accused of displacing American people from their occupations, they were deported.

A contentious issue was the repatriation of Mexican citizens. Deporting persons who were born in the United States or who had lived there for a long time, according to many, was unjust.

The Mexican economy suffered as a result of the repatriation. When their loved ones were deported, many Mexican families became divided.

Hence, the correct option is C. To reduce competition for jobs.

Learn more about repatriation, here:

https://brainly.com/question/30243897

#SPJ6

The given question is incomplete below is the full question

"They wanted us out of the country. I didn't understand why when we'd been born here."

Emilia Castaneda was born in Los Angeles to Mexican parents. In 1935, she and her father and brother were forced to board a train bound for Mexico.  

This excerpt describes an instance of deportation during the 1930s as part of a repatriation effort. Why did the federal government implement repatriation?

A. To fulfill the terms of a global peace treaty

B. To protect national security

C. To reduce competition for jobs

D. To prevent communist influence on labor unions

"Between 1750 and 1760, an intricate interlocking of circumstances set coal to rule the world, not through new discoveries of coal itself but rather through improvements in spinning and weaving machinery which made possible the massing of large numbers of spinners and weavers for large-scale production. . . . It was at the call of the master weavers and spinners of England that the steam engine was set to run the machines; then to furnish a blast so that coal might be used to cheapen the smelting of iron and steel so that more machines might be made; then to pump out the deepening mines so that more and more power to keep the machines running might be won. Steam raising was coal's first great play for power and it is the work through which it still holds its industrial supremacy. Between 1800 and 1900 coal-driven engines multiplied until . . . they were producing energy equivalent to seventy million horse-power; during the first twenty years of the twentieth century, their power-producing capacity more than doubled. So coal wrought the industrial revolution, the greatest revolution in all human history, which transformed social and economic life as radically as the geographical revolution transformed the earth's surface.”

Robert W. Bruère of the Bureau of Industrial Research in America, The Coming of Coal, 1922

a) Identify ONE specific example of the environmental influences and consequences of the Industrial Revolution that would support the author's argument.

b) Explain ONE specific example of how coal helped power new inventions that would support the author's argument.

c) Explain ONE specific example of how mining coal helped transform social and economic life that would support the author’s argument.

Answers

Answer:

A) Between 1750 and 1760 many improvements were made. Improvements such as spinning and waving the coal on machines were examples of this.

B) Improvements such as said above helped dramatically. They helped by using their power to smelt iron and steel. Because of this, economic life improved.

C) Mining coal helped transform social and economic life. It transformed life because it pumps out deepening mines. Because of this, more and more power transfers to keep the machines running.

Explanation:

Person in comments didn't post the answer. Credit goes to them

The above scenario where coal played an important part was during the times of the Industrial Revolution the scenario took place. Between 1800 and 1900 coal-driven machines came into existence.

What is the Industrial revolution?

The transition to new industrial processes that occurred in Great Britain, mainland Europe, and the U.S. between approximately 1760 and 1820–1840 is known as the Industrial Revolution. The First Industrial Revolution began in England around 1750–1760 and continued there until between 1820 and 1840. One of the most notable turning points in the history of mankind occurred around this time.

The shift from manual to machine production was known as the "Industrial Revolution." Scholars disagree much about when it began and ended, although the time frame mainly covered the years 1760 to 1840.

During the Industrial Revolution, agricultural production gave way to an industrial one in which machines as well as humans were used to make goods. As a result, there was an increase in productivity and efficiency, a rise in the production of products and services, a decline in prices, greater incomes, and a movement of people from rural to urban areas.

Learn more about The Industrial revolution here:

https://brainly.com/question/855594

#SPJ2

Other Questions
Help plzzzzzzzzzzzz d)Rajendra is visiting to his uncle. (simple present tense) 10080100 mLwater vaporWhich statement describes what will happen if a student pushes the plungerto compress the water vapor?A. The total number of water particles will increase.B. The amount of energy in the water particles will decrease.C. The amount of empty space between the water particles willdecreaseD. The total volume of the water particles will increaseI will mark brainliest What is the acceleration of the the object during the first 4 seconds? pls help me with this thank u Which of the following is an arithmetic sequence?A.3, 9, 81, 6561, B.4, 1, 2, 5, C.2, 2, 2, 2, D.4, 1, 4, 7, A high school basketball team scored 60 points in last weeks game. The team scored a total of 27 baskets; some were two-point shots and some were three-point shots. How many two-point shots did they make? How many three-point shots did they make?x + y = 27,2x + 3y = 60What is the solution of the system of equations, and what does it represent?options:(6, 21); 6 two-point shots and 21 three-point shots(6, 21); 6 three-point shots and 21 two-point shots(21, 6); 21 two-point shots and 6 three-point shots(21, 6); 21 three-point shots and 6 two-point shots on a beautiful day there are 65 cars in the beach parking lot 26 more cars park in the parking lot before noon but 17 car slept how many cars are in the beach parking lot what would happen to new orleans lose if slavery was abolished how do i solve this? Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC An idea,theme,or image that begins and ends a text can be referred to as a Galaxy B moves away from galaxy A at 0.577 times the speed of light. Galaxy C moves away from galaxy B in the same direction at 0.731 times the speed of light. How fast does galaxy C recede from galaxy A? Will mark brainiest!!!1. A __ is caused by a sudden shift in the ocean crust which displaces the water. *2. A tsunamis is possible, but unlikely at a __ plate boundary where two plates are moving sideways past each other. *3. A Shallow __ is a good indicator of tsunamis, but sends data very slowly and cannot detect earthquakes. *4. Tsunamis are common at __ plate boundaries, since large earthquakes release the built up pressure, resulting in a quick vertical movement of the plate. *5. The Indonesian Earthquake of 2004 had a 9.1__, which was the third largest ever recorded in human history. *All possible answers:A. EarthquakeB. TsunamiC. MagnitudeD. SensorE. TransformF. ConvergentG. Divergent Question 11. You must build a ramp with a rise of 15 inches to rollsome lab equipment into your school. If you follow theADA specifications, what is the horizontal length (the "run")of the shortest ramp you can build? What is the ramp'stotal length? 1.) Which war was not fought by the United States in the 1900s?A. World War I B. World War II C. Spanish-American War D. Vietnam War2.) Under our Constitution, some powers belong to the states. What is ONE power of the states?A. Print Money B. Create an army C. Issue passports D. Provide Public Education In the 1500s, the Council of Trent was led by a group ofLutheran ministers who wanted to spread their ideas.Catholic cardinals who wanted to reform the Church.German princes who wanted to end a peasants rebellion.Calvinists who wanted to make laws that followed their beliefs. plz help i need it :) will mark brainliest :D A work element in a manual assembly task consists of the following MTM-1 elements: (1) R16C, (2) G4A, (3) M10B5, (4) RL1, (5) R14B, (6) G1B, (7) M8C3, (8) P1NSE, and (9) RL1. (a) Determine the normal times in TMUs for these motion elements. (b) What is the total time for this work element in sec Community health problems can be addressed through the provision of health education. Justify it