Answer:
While plant cells have chloroplasts to photosynthesize, they also require ATP for cellular functions, and do use oxygen to break down some of the sugar they produce in order to generate that ATP. They need mitochondria for this.
In particular, at night when there is no light, plants undergo cellular respiration since there is no sunlight to photosynthesize.
They do, however, produce far more sugar and oxygen through photosynthesis than they use up in respiration.
The type of plant cells that receives glucose from other plant cells are NON-PHOTOSYNTHETIC plant cells.
Photosynthesis is a group of metabolic reactions by which plant cells generate simple carbohydrates (i.e., glucose) and oxygen by using the energy from the sun, carbon dioxide and water.In consequence, non-photosynthetic cells cannot produce glucose and thus need to receive this nutrient from photosynthetic cells.An example of non-photosynthetic cells is the root cells found underground.In conclusion, the type of plant cells that receives glucose from other plant cells are NON-PHOTOSYNTHETIC plant cells.
Learn more in:
https://brainly.com/question/1388366
TEST - chapter 8
32 of 32
POSSIBLE POINTS: 3
What are the three factors that affect the rate of photosynthesis? (Hint: These are clearly listed toward
the end of your notes).
Answer:
light intensity, carbon dioxide concentration and temperature
though water is a big one too but would be 4th on the list imo
CO2 is an interesting one as it's amounts go down precipitately over say a corn field or other mass of photosynthesizing organisms during the day and increases at night when photosynthesis stops
Explanation:
Type Newton's Second Law of Motion as it is written.
Answer:
I hope you understand please give brainliest
Explanation:
Newton's second law of motion can be formally stated as follows: The acceleration of an object as produced by a net force is directly proportional to the magnitude of the net force, in the same direction as the net force, and inversely proportional to the mass of the object.
Answer:
Yes it is written that second law of Newton is motion of an object
Choose which statement best describes an element.
A. Anything that takes up space
B. A pure substance that cannot be broken down into other substances by chemical means.
C. Water
D. Atom has a nucleus with neutrons and protons in it.
Answer:
B
Explanation:
Elements are pure substances that cannot be broken down into other substances by chemical means .
Give advantages and disadvantages of asexual reproduction.
Answer:
Advantages and Disadvantages Of Asexual Reproduction
Advantages Of Asexual Reproduction Disadvantages Of Asexual Reproduction
The process requires less energy. Since the offspring is an exact copy of the parent, any negative mutation will also pass on to the offspring
Super easy. Please help
Answer:
Identical twins tend to be more similar to each other than fraternal twins do.
Explanation:
how does the cell work
______ is the transfer of energy through spaces as electromagnetic waves in all directions?
A. Conduction
B. Radiation
C. Fission
D. Convection
Answer:
electromagnetic radiation Transfer of energy by electromagnetic waves across space or through matter.
Answer:
radiation
Explanation:
Pls, I need help with this! Biology Thank you :)
Answer:
If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG
If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG
Explanation:
1. What were the conditions on the planet when life began?
Answer: The early Earth had no ozone layer and was probably very hot. The early Earth also had no free oxygen. Without an oxygen atmosphere very few things could live on Earth. Anaerobic bacteria were probably the first living things on Earth.
3. What two paths can a cell take after it has grown?
Answer:
Explanation:In eukaryotic cells, or cells with a nucleus, the stages of the cell cycle are divided into two major phases: interphase and the mitotic (M) phase.
why cant you touch your palm to your shoulder? (on the same arm)
Answer: cause
Explanation:
Some people can some cant
Plant life in wetlands is not
different from plant life In other areas.
True
False
As a senior high school student, is it important for you to participate in any physical
activities especially in this time of pandemic? Why?
Answer: I believe that it should be the student's choice and not forced upon them, though it is important for them to get some sort of exercise to stay healthy. During this pandemic, kids have an excuse to not do sports if they or their parents aren't comftoable with doing any extracurriculars after school.
Explanation:
inherited traits are governed controlled by
I need help on these questions please.
True or False
An increase in cell size results in an increase in surface area to volume ratio.
Answer:
true I think
Explanation:
I think so I hope so
What is a main difference between Mercury and Neptune?
Mercury is an inner planet with a thicker atmosphere and a longer year than Neptune.
Mercury is an inner planet with a thinner atmosphere and a shorter year than Neptune.
Neptune is an inner planet with a thicker atmosphere and a shorter year than Mercury.
Neptune is an outer planet with a thinner atmosphere and a shorter year than Mercury.
Answer:
B because Mercury's orbit is 88 days and Neptune's is 164 earth years
Mercury is an inner planet with a thinner atmosphere and a shorter year than Neptune.
What is Mercury and Neptune?
Since 2011, Neptune has spent 12 years in the sign of Pisces, which it rules and enjoys being in. Mercury spends just 15 to 60 days in each sign of the zodiac, but because of the Mercury retrograde, they come together and hang out for a while.
This is incredibly uncommon. It may be said that Mercury, the hare, is enjoying a Long sleep with Neptune in a dreamy fog and has forgotten his responsibilities as a courier around the Earth.
When Mercury conjoined the Sun on March 14 at 24 degrees Pisces and then today, on March 25, when Mercury conjoined Neptune at 16 degrees Pisces, this was notably felt.
Therefore, Mercury is an inner planet with a thinner atmosphere and a shorter year than Neptune.
To learn more about Mercury, refer to the link:
https://brainly.com/question/4025230
#SPJ3
Earth follows an orbit as it makes a revolution around the Sun. What is the relationship between a revolution and an orbit?
Answer:
An orbit is essentially the motion of an object (be it a planet, a moon, a spacecraft) around a star, moon, or planet. Now a revolution is the movement of an object around an axis of rotation, or a centre, or another object. So the earth revolves around the sun, but the earth is also in orbit around the sun.
Plz mark me brainliest
Neurons that respond to specific types of lines are examples of:
A. figure detectors.
B. top-down processors.
C. feature detectors.
D. figure processors.
Answer:
C
Explanation:
Neurons that respond to certain types of lines are examples of feature detectors found in Option C. Neurons are the monomeric units of the nervous system that play an important role in transmission.
What is the importance of the neuron?
The neuron is a unit in which the message is transmitted from the neuron to another neuron, and this can be done by either chemical signaling or by electric signaling. The neuron receives sensory stimuli from the sensory organ and transmits them to the spinal cord.
Later, the message from the spinal cord is sent to the motor organs, and the whole pathway of the neuron signaling from the sensory to the motor organ is called the reflex arc. The neuron takes part in the signaling process so that the muscle can function, regulate the contraction relaxation, and perform many other functions.
Hence, neurons that respond to certain types of lines are examples of feature detectors found in Option C.
Learn more about the neuron here.
https://brainly.com/question/29462317
#SPJ5
please help me put these words in the correct blanks
Answer:
In a transverse wave, a wavelength is the distance from one crest to the next crest or from one trough to the next trough. In a longitudinal wave, the wavelength is the distance from one compression to the next compression or from one rarefaction to the next rarefaction.
Explanation:
Context clues for the second, third, fifth, and sixth blanks; answer is at end of clause
First one was instinct, fourth was because it seemed to be a comparison
Hope this helps! Have a great day!
PHET skate park . Consider this equation: Kinetic Energy = ½ mv2. Which of those variables is changing as the skater moves up and down the track?
Velocity is the variable which is changing during motion of skater.
Impact of velocity on energyVelocity is the variable which is changing when the skater moves up and down the track because moving upward on the slope decrease the speed of the skater while on the other hand, velocity increases when moving downward on the slope.
Mass of the body which is skating remain constant or can't change with height. Mass is the amount of matter present inside the body so we can conclude that velocity is the variable which is changing during motion of skater.
Learn more about kinetic energy here: https://brainly.com/question/8101588
Learn more: https://brainly.com/question/21629135
what is the difference between the calorie (lowercase c) and the Calorie (capital C)
How does salinity vary with evaporation?
Question 4 options:
When water evaporates, it leaves salt behind, increasing its salinity.
When water evaporates, it takes salt with it, increasing its salinity.
When water evaporates, it takes salt with it, decreasing its salinity.
When water evaporates, it leaves salt behind, decreasing its salinity.
Brainly inexplicably is preventing my response from being posted in text form (despite the absence of inappropriate words and links). I've thus provided my response as an attached image. Please let me know if there are any issues viewing or accessing it.
Answer:
A. When water evaporates, it leaves salt behind, increasing its salinity.
Explanation:
when water evaporates it only evaporates the water and leaves the salt behind thus the salinity increases since there is less water to salt. hope this helps! :D
Four differences between viruses and bacteria
Answer:
bacteria :
1. need microscope to see them.
2. need warmth moisture nutrients.
3. saprophyte or parasite.
4. can be harmful or useful.
viruses:
1. smaller than bacteria.
2. spend on living host.
3. always parasite.
4. where is harmful.
How is fish adapted? Write any two adaptational characters of them.
Which of these contributes the most oxygen to our planet?
a. Photosynthetic fungi
b. The Amazon Rain forest
c. the National Forests
d. Phytoplankton
Answer:
D. Phytoplankton
Explanation:
The majority of this production is from oceanic plankton — drifting plants, algae, and some bacteria that can photosynthesize.
Have a wonderful day! <3
Answer:
D
Explanation:
this is because the ocean produces the most oxygen and most of that comes from plankton in the ocean
Which statement best describes the term symbolism?
A.
A writer says one thing but means something else.
B.
A writer compares one element to another using the words like or as.
C.
A writer uses an object to represent significant ideas or qualities.
D.
A writer emphasizes an important concept or theme
Answer:
C. a writer uses an object to represent significant ideas or qualities.
Explanation:
C. A WRITER USES AN OBJECT TO REPRESENT SIGNIFICANT IDEAS OR QUALITIES, YAN PO ANG TAMA
What is Carbon Dioxide?
A medicine
B candy
C colorless gas
D special kind of steel
Answer:
Colorless gas
Explanation:
Which explanation best identifies the relationship between mitosis and
reproduction? *
A.Mitosis is a form of sexual reproduction because the daughter cells form from one
single parent cell.
B.Mitosis is a form of sexual reproduction because the daughter cells are genetically
different from the parent cell.
C.Mitosis is a form of asexual reproduction because the daughter cells form a new
nuclear membrane after reproduction.
D.Mitosis is a form of asexual reproduction because the daughter cells are genetically
identical to the parent cell.
Answer:
D.
Explanation:
Mitosis three main functions are growth and repair of cells, and asexual reproduction for the single celled organisms.
The daughter cells have same chromosomes/genetics.
Example: repair and growth of skin, red blood cells etc.
Answer:
It's D
Explanation:
What does the prefix pseudo mean in the word pseudoscience?
false
subjective
systematic
factual
Hii!!! I believe the answer is A. False. (: