Which statement is False?

A.) Both Eukaryotic and Prokaryotic cells have genetic information (DNA), cytoplasm, ribosomes and a cell membrane.

B.) The cell membrane (made up of lipids) is "semi-permeable" which means it only let's certain materials in and out, and helps keep cells stable, which is known as "homeostatis".

C.) Cells contain a cytoskeleton, which is a collection of fibers that provide support for organelles and aides in the cells internal movements.

D.) Eukaryotes do not have a nucleus, nor do they have "membrane bound organelles", like the golgi apparatus or the endoplasmic reticulum (ER)​

Answers

Answer 1

Answer:a

Explanation:


Related Questions

Peoples choices can sometimes have negative effects on their own health as well as the health of your well-being of others describe to these choices explain how they can impact the individual and others

Answers

Answer

a good environment could mean better people better love and kindness bad environment could mean problems in your future and/or daily life this can affect everybody and anybody

Explanation:

Which of the following statements regarding prokaryotic and eukaryotic cells is true

Answers

Answer:

I would need the statements to answer that. however prokaryotic cells are plant cells and eukaryotic cells are animal cells

Answer:

They are typically smaller than eukaryotic cells. The DNA of a prokaryotic cell is contained in the nucleoid. There are several ways in which prokaryotic cells are different from eukaryotic cells. Firstly, they are generally smaller in size, their organelles are not membrane bound, and they have no nucleus. They, however, share commonalities with eukaryotic cells including the presence of a bilipid plasma membrane, presence of ribosomes and DNA.

Hope this helps, have a great day/night, and stay safe!

- Lee el siguiente párrafo y a continuación responde lo que se te pide.Los seres humanos primitivos comenzaron a clasificar las plantas y los animales tanto por su utilidad como por el daño que les causaban, luego fueron profundizando aún más en sus conocimientos sobre la flora y la fauna de su entorno, identificando los ciclos biológicos y hábitat, entre otros aspectos que facilitaron su producción y pronta disponibilidad. Con base en el párrafo anterior se puede afirmar que: * 1 punto A) Empezaron a entablar una relación más estrecha con el medio ambiente. B) Abandonaron su vida primitiva y nómada C) Incrementaron sus conocimientos únicamente sobre el ciclo del agua. D) Empezaron la agricultura y la piscicultura.

Answers

Answer:

A) Empezaron a entablar una relación más estrecha con el medio ambiente.

Explanation:

Desde el pasaje, podemos ver que la gente comenzó a prestar más atención a su entorno y cómo la fauna y la flora afectan la vida humana.

Incluso intentaron desarrollar un sistema burdo de clasificación biológica. Henec, se puede inferir que las personas desarrollaron una relación más cercana con su entorno.

Baby Brain Power
How does the bar graph on page 5 expand on
information presented in the passage?
It shows exactly how many synapses a person's
brain has at birth
Speech, emotional regulation, movement, and
vision-all of these extraordinary abilities and
many more are possible thanks to the organ
that serves as the body's control center. When
one thinks of "brain power, it is the faces of
adult inventors, professors, and novelists that
Ekely come to mind. Remarkably the most
critical time period with respect to brain
development occurs relatively soon after an
individual is bom.
A newborn enters the world as a fairly helpless
creature, but her brain hos billions upon
bitions of specialized cells coiled neurons.
It gives more information than the passage by
showing that the number of synapses returns to
what it was at birth.
It provides specific information about how many
synaptic connections are formed in each year of a
person's life.
It gives information about synaptic connections
beyond the time period described in the passage.
2
3
4
5

Answers

Answer:

C

Explanation:

Took it

Which statement best describes homeostasis in a cell?

A. Molecules are in equilibrium (balance) inside and outside the cell

B. Active transport causes molecules to move from low to high concentration the molecules are un-equal

C. Pathogens enter cells and infect those cells, causing them to malfunction

D. Cells do not maintain homeostasis with their external environments.

Answers

Answer:

I believe the answer is A. The cell is in an equilibrium inside and out when it goes through homeostasis.

Explanation:

PLZ HELP (30 POINTS)




Which of the following is a direct benefit of using agriscience to optimize land use for animal grazing?

Reducing soil degradation
Inventing new fertilizers
Updating irrigation
Increasing climate change

Answers

Answer: The answer is D Increasing climate change

Explanation: Which of the following is a direct benefit of using agriscience to optimize land use for animal grazing? hope this helps man

D

Explanation:

i think that's the answer

when benedicts solution is added to a sucrose solution and put into a boiling water-bath , no change in color is observed

state why no color change is observed

Answers

Answer:

b

Explanation:

Chemicals and proteins in the cell read the DNA ___________ for building that make cells, tissue and organs.
(A.Instructions
(B.Genes
(C.Recipe
(D. Life manual

Answers

You answer will be B!! Good luckkk!

Genes of DNA can be read by chemicals and proteins for building that can make cells, tissue, and organs. Therefore, option "B" is correct.

What are genes?

Genes are composed of  DNA which is the genetic material. Gene is the functional unit of heredity. Chromosomes are comprised of multiple genes. Genes code for a particular trait. More than one gene can code for a particular trait.

The function of DNA and RNA is controlled by genes. There are more than 3000 genes present. Mutation can occur in genes. Deletion and insertion are some types of mutation genes. Transposomes are called jumping genes. Sickle cell anemia and cystic fibrosis are some examples of gene mutations.

Genes code for the traits such as the color of eyes, height quality of hair, and more.

Learn more about genes, here:

https://brainly.com/question/31121266

#SPJ2

HELP!!!!15 POINTS!!!!!!

i think it's f but idk..

Answers

Answer:

F is good

Explanation:

F is a very good choice

What Bacteria is put in yougurt ?

Answers

two species of bacteria called Lactobacillus bulgaricus and Streptococcus thermophilus.

Answer:

food bateria

Explanation:

Which of the following processes begins when a star enters the main sequence?
a


Nuclear fission
b


Nuclear fusion
c


Condensation of a nebula
d


Appearance of a supernova

Answers

Answer:

i believe it is B: Nuclear Fusion

Explanation:

Answer:

C. Nuclear Fusion

Explanation:

I am 1000000000% sure this is correctamundo, stay cool, and have a great day!

what is the complementary dna strand of C-C-T-A-G-C-T

Answers

Answer:

G-G-A-T-C-G-A

Explanation:

The A-T pairs are connected by two hydrogen bonds, while the G-C pairs are connected by three hydrogen bonds.

A 100 kg box is initially at rest on a level surface. One 10 N force acts on the box , directed toward the right. A second 10 N force acts simultaneously on the box , directed toward the left , as shown.

Answers

The box would stay at rest where it lies since the same amount of force is pulling it in opposite directions :)

Since 10 N forces are acting from both sides, these are balanced forces and the box will not move because balanced forces are acting on it. So the correct option is D.

What are balanced forces?

Forces that are equal in magnitude and opposing in direction are said to be balanced forces. Equilibrium is seen as a condition of balanced forces. There is no shift in direction when the forces are in balance.

Balanced combined forces have always been equal to zero. These are vectors for merging. Balance forces cannot alter an object's momentum or direction.

An item is kept traveling at a constant speed by a balanced force. In it, Newton's First Law of Motion is explained. A good illustration of a balanced force is a book on the table. The normal force (support force) of the table balances out the weight of the book. The two forces are exactly equal and opposed to one another.

While forces that are balanced can keep an item at rest or move at a steady speed, unequal forces can cause things to accelerate.

Therefore the correct option is D.

Read more about balanced forces, here

https://brainly.com/question/19127263

#SPJ5

Its easy! If right will give brainlist! Don't overthink..:) Just answer

The virtual image changes with the position of the mirror to the eye when the mirror is..............?
Fill in the blanks

Answers

Answer:

When the mirror is inside the focal point..?

People are more likely to seek treatment if they
A. are in a minority
B. live in a rural community
C. have medical insurance
D. have a diagnosis

Answers

Answer:

C. have medical insurance

Explanation:

People are more likely to seek treatment if they D. have a diagnosis as it helps in the treatment of disease.

The clinical diagnosis lets in a clinical expert chart a listing of clinical signs after which evaluate them to different data. A high-quality fitness final result is primarily based totally one scale of being alive and not using a long-time period results to death.

What is the diagnosis?

The act of spotting a disorder from its symptoms and symptoms and signs the realization this is reached following and trying out .The prognosis turned into pneumonia.

Thus it is well explained.

To learn more about the medical insurance refer to link :

https://brainly.com/question/1941778

The air in the thermosphere is composed of atoms of _____ that are very far apart from each other.

Answers

Answer:

Explanation:

In the upper thermosphere, atomic oxygen (O), atomic nitrogen (N), and helium (He) are the main components of air.

Energetic ultraviolet and X-ray photons from the Sun also break apart molecules in the thermosphere. In the upper thermosphere, atomic oxygen (O), atomic nitrogen (N), and helium (He) are the main components of air there ya go son

In the United States, most racial discrimination comes in the form of ________ discrimination.

A. Direct
B. overt
C. indirect
D. extra​

Answers

Answer:

C, indirect because most people do not admit that they are racist and claim that they didn't do things because they're racist.

Explanation:

In the United States, most racial discrimination comes in the form of indirect discrimination. Therefore, option C is the correct option.

What is indirect discrimination?

Indirect discrimination involves the policies or practices that appear neutral on the surface, but deep down have adverse effects on the people belonging to a particular race.

Indirect discrimination can be seen in various areas, such as employment. During a job vacancy, the job applicant requires to speak a high level of proficient English which appears to be a reasonable requirement for the job, but it can lead to a significant impact on non-native English speakers.

Indirect discrimination can be seen in the education field where schools give admissions to only those students who will qualify for a specific education test which may seem unfair to students belonging to a specific race, and having different educational backgrounds.

Therefore, indirect discrimination is the most common form of discrimination observed in the United States.

Learn more about indirect discrimination here:

https://brainly.com/question/14710203

#SPJ7

Ribosomes are the site where
protiens
are produced.
Amino acids are coded for by triplet bases in RNA called
condon
.

Answers

Answer:

That's true

Explanation:

But remember. What is produced actually is not a protein. It is a petide chain which is the first structure of protein.

When the peptide chain reaches its fourth structure ،it csn have its function in body.

Thats a complete protein.

Hope it helps.

An earthquake occurred three hundred miles off the shoreline, and massive flooding occurred on land as a result.
Which best describes what occurred?
- Continental shifting resulted in a tsunami.
- Continental shifting resulted in a volcano erupting.
- Tidal activity in the subduction zone caused a tsunami.
- Tidal activity in the subduction zone caused a volcano to erupt.

Answers

Answer:

An earthquake occurred three hundred miles off the shoreline, and massive flooding occurred on land as a result. Which best describes what occurred? Continental shifting resulted in a tsunami.

Explanation:

The best thing that describes the scenario that occurred is tidal activity in the subduction zone caused a tsunami. The correct option is C.

What is tsunami?

The violent breaking of rock during an earthquake releases energy that travels through the earth in the form of resonance known as seismic waves.

These seismic waves radiate from the hypocenter in all directions, becoming weaker as they travel further away from the hypocenter.

Tsunamis are a series of large waves with extremely long wavelengths and periods that are usually caused by a violent, impulsive undersea disturbance or activity near the coast or in the ocean.

When a large earthquake ruptures, the faulting can cause vertical slip large enough to disturb the overlying ocean, causing a tsunami to travel in all directions.

Thus, the correct option is C.

For more details regarding tsunami, visit:

https://brainly.com/question/14782736

#SPJ6

Explain how diffusion and osmosis are related to the symptoms of cystic fibrosis

Answers

Answer:

Answer D

Explanation:

just took the test.

the other liquid waste product in cellular respiration is

Answers

Answer: During the process of cellular respiration, carbon dioxide is given off as a waste product. This carbon dioxide can be used by photosynthesizing cells to form new carbohydrates. Also in the process of cellular respiration, oxygen gas is required to serve as an acceptor of electrons.

Explanation: Hope dis helps :)))))  

Answer:

the waste products are carbon dioxide and water

What do the enzymes in excision repair systems do?

A destroy cancer cells
B cut off telomere sections
C replace dna damaged by chemicals
D replace rna primers with dna

Answers

B would be the answer I think

To achieve which of the following goals would rotational grazing be most appropriate? (3 points)
-To maximize livestock populations while minimizing costs
-To preserve vegetation and soil fertility of land
-To involve townspeople in the operations of a nearby farm
-To transform an abandoned city lot into a neighborhood garden

Answers

Answer:

To preserve vegetation and soil fertility of land

Explanation:

.

A person with a low number of white blood cells could have difficulty in fighting infections and A decrease in the number of lymphoid stem cells could result in a decrease in red blood cell.

What is nucleotide?

It is the sub units and buIlding blocks of DNA. It is made up of a five-sided sugar, phosphate group and then a nitrogen base.

These groups make the backbone of the DNA helix. If you look at a DNA helix, they make the side of the ladder or the side portion. They connect to a nitrogen base which make the steps of the ladder.  The type of sugar that is used in a DNA helix is called deoxyribose.

Nitrogen bases are the molecules that make up the steps of the ladders. There are four different nitrogen bases, namely; Guanine, Thymine,Adenine and Cytosine.

Pyrimidines are compounds that make a single 6-sided ring. Examples of pyrimidines are Cytosine and Thymine. Purines on the other hand make 5-sided and 6-sided rings.

Therefore, A person with a low number of white blood cells could have difficulty in fighting infections and A decrease in the number of lymphoid stem cells could result in a decrease in red blood cell.

Learn more about white blood cells on:

https://brainly.com/question/19202269

#SPJ5

BRAINLIEST:
in which month is a hurricane most likely to occur: October or December? explain

Answers

Answer:

October

Explanation:

October is one of the hurricane season months

17. Match the major types of cancer with the types of cells they occur in
Adenocarcinomas
a. The lowest layer of the epidermis (skin)
Basal cell carcinoma
b. upper layers of skin, the lining of stomach, lungs,
kidneys
Squamous cell carcinoma
c. melanin-producing cells of the skin
Sarcoma
d. immune cells in the blood (T cells, B cells, and
bone marrow)
Leukemia and lymphoma
e. bones, fat, blood vessels, tendons, ligaments
Multiple myeloma
1. cells that produce fluids (breast, colon)
Melanoma
g. plasma cells (a type of immune cells)​

Answers

LolsbdgsbcgcsnnsjzkmcjMCk

explain how darwin's journey to the galapagos islands contributed to his creation of the theory of evolutions.

Answers

Explanation:

During his visit to the islands, Darwin noted that the unique creatures were similar from island to island, but perfectly adapted to their environments which led him to ponder the origin of the islands' inhabitants.

Among those that struck Darwin so greatly were the finches that are now named in his honor. Darwin would later base some of his thought from the supposing that these finches were all descendents of the same lineage.

Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide
chain, identifying the codons, anticodons, and amino acid sequence.
DNA: CGATACAATGGACCCGGTATGCGATATCC

Answers

I don’t feel like answering all that but....
C=G G=C T=A A=U
C=G A=T dont know the rest have a gcodocododd dday

In a chemical analysis of a sample of animal tissue, which element would most likely be found in the smallest quantity?

Answers

Answer:

Iodine

Explanation:

Iodine is needed by animals because the body's metabolic rate is controlled by the action of an iodine hormone, called thyroxine, which is secreted by the thyroid gland in the neck.

If the animal fails to supply enough iodine through food to be able to make a normal amount of this compound, then the thyroid gland enlarges or expands trying to create enough, resulting in a common type of goiter.

Describe some of the properties of water and explain how the structure of water is responsible for these properties.

Answers

Answer:

The main properties of water are its polarity, cohesion, adhesion, surface tension, high specific heat, and evaporative cooling. A water molecule is slightly charged on both ends. This is because oxygen is more electronegative than hydrogen. ... The stream of water bends due to the polarity of water molecules.

Explanation:

PLEASE HELP
the question is in the pic

Answers

the answer is genetic variation because crossing over leads to changing the traits inherited by the daughter cells
Other Questions
A student collects 100 seeds from a group of plants produced from thesame parent plants. Of the seeds collected, 80 are blue seeds, and 20 arewhite seeds. The trait for seed color is controlled by one gene andresults in seeds with either a blue color or white color.Which Punnett square of the parent plants' traits likely correspondswith the 100 seeds collected? Hurry please! How do you put 14 1/2 into a calculator without the '/' ? Choose the correct word to complete the following sentence._____ students have finished.WeUs what is mornachy in the government What is 3 /49 as a decimal? Sometimes news organizations have biases because:A. they are concerned about a national crisis.B. the government pays them to be biased.C. they need to make money and get advertisers.D. the audience has to be influenced. pls help me with this question. HELP PLEASE ON MY FINALGrassRabbitFox Mushroom Which of the above organisms gets its energy from photosynthesis?Only IOnly IVI, II and III onlyI, II, III and IV Can someone please write an equation to model this scenario which relates to the first two questions. I need it ASAP!Matt works at a job where he makes a base pay of $200 per week and $50 per sale. (Use an x and a y. Y is the total amount he makes and x is the number of sales.): ) A certain species of rabbit can have either black or grey fur. The allele for black fur is dominant over the allele for grey fur. If a homzygous black rabbit is crossed with a heteozygous black rabbit, what phentypic ratio will occur in the first generation? Is this statement true or false?Mark Rothko and Josef Albers' paintings, No 10, 1952 and Homage to the Square, both have an emotional use of color. __ is the history, stories, music, traditions, customs, and so on, of a community of people. The first man-made satellite to orbit the earth was solve for c: c-7 -3 Chase read a total of 6 books over 2 months. After belonging to the book club for 4 months, how many books will Chase have read in all? Assume the relationship is directly proportional.? books How did the telescope contribute to Galileo's theories? a) Church elders could see the motion in the universe for themselves and support Galileo. b) The telescope made automatic measurements of the movements in the universe. c) Through the telescope, Galileo could see how bodies in the universe moved and what they were made of. The United States played a worldwide active role to help stop the spread of communism after World War II. Plz help ill give points How does the presence of suspense in a story affect readers?It helps them predict the storys outcome.It gives them hints about the characters thoughts.It makes them skip the boring parts.It keeps them engaged in the story. Mrs. Brown uses 1/4 package of graph paper for each class. She needs 1 1/2 packages to serve all of her classes. Howmany classes does Mrs. Brown teach?