Which statement BEST states what happens during mitotic anaphase? The chromosomes are duplicated. O Spindle fibers stretch across the cell. O Sister chromatids move to opposite sides of the cell. O Chromosomes and centrioles attach to the plasma membrane.​

Answers

Answer 1

Answer:

Move to the opposite sides of cell

Explanation:

Answer 2

Answer:

Sister chromatids move to opposite sides of the cell.


Related Questions

What are common changes
In an environment?

Answers

Answer:shelter, land, prey

Explanation:

Changes? Do you mean like temperature and humidity

"CRISPR" stands for Clustered Regularly Interspaced Short Palindromic Repeats, which are the hallmark of a bacterial defense system that forms the basis for CRISPR-Cas9 genome editing technology. In the field of genome engineering, the term "CRISPR" or "CRISPR-Cas9" is often used loosely to refer to the various CRISPR-Cas9 and -CPF1, (and other) systems that can be programmed to target specific stretches of genetic code and to edit DNA at precise locations, as well as for other purposes, such as for new diagnostic tools. How can this tool be used to alter genes in various organisms?

Answers

Answer:

by designing short guide RNAs (sgRNAs) customized to target genes of interest in the cells of these species

Explanation:

The CRISPR-Cas9 editing system is a versatile and powerful genome engineering tool for editing genomes, which can be directed to alter almost any DNA sequence in order to modify gene function. This system consists of an endonuclease protein (Cas 9) that cuts DNA at specific sites guided by a short guide RNA (sgRNA), which binds by base complementarity to the target sequence. This sgRNA must be designed with efficiency and specificity to target genes of interest. In consequence, the CRISPR-Cas9 genome editing system produces DNA double-strand breaks which may be repaired by 1- error-prone nonhomologous end joining (NHEJ) or 2-homology-directed repair (HDR) DNA repair pathways. According to the DNA repair pathway that has been activated, it is possible to trigger genetic modifications in the cells of different species (i.e., plant cells, animal cells, human cells, etc).

The movement of water in or out of the cell membrane without the use of ATP.

Diffusion

Facilitated diffusion

Osmosis

Excoytosis

Answers

The answer is Osmosis because its the only one that has anything to do with water

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

Answers

Thymine(T) pairs with adenine(A)

Adenine(A) pairs with uracil(U)

Cytosine(C) pairs with guanine(G)

therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT

is

AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA

Write a summary statement for saturated fats including whether they are solids or liquids at room temperature and weather they have all single carbon-to-carbon or at least one carbon-to-carbon bond

Answers

Answer:

A saturated fat is a type of fat in which the fatty acid chains have all or predominantly single bonds. A fat is made of two kinds of smaller molecules: glycerol and fatty acids. Fats are made of long chains of carbon atoms. Some carbon atoms are linked by single bonds and others are linked by double bonds. Double bonds can react with hydrogen to form single bonds. They are called saturated because the second bond is broken and each half of the bond is attached to a hydrogen atom.

Explanation:

Answer:

saturated fats consists of single covalent bond and they are solid at room temperature and their melting point increases with increasing chain length

hope it helps

Explanation:

what is a cell membrane?

Answers

Answer:

The cell membrane is the semipermeable membrane of a cell that surrounds and encloses its contents of cytoplasm and nucleoplasm.

Explanation:

Answer:

Short. The semipermeable membrane surrounding the cytoplasm of a cell.

Long. The cell membrane is the semipermeable membrane of a cell that surrounds and encloses its contents of cytoplasm and nucleoplasm. The cell membrane separates the cell from the surrounding interstitial fluid, the main component of the extracellular fluid.

Explanation:

1. Peer review allows others in the field to assess a scientist's investigations and results.
a. True
b. False

Answers

Answer:

False.

Explanation:

Peer review provide others scientist in the field to assess a scientist's investigations and results.

Peer Review:

It is the reviewing or evolution of the work by many professionals and experts in the field.

For example-  A scienfic manuscript is send to the many scientist for evolution before publication.

This peer review is unbiased because the reviewer does not know the name or other information about writter.

To know more about  Peer Review:

https://brainly.com/question/10853815

When discussing Newton’s laws of motion, which terms do people most likely use when talking about Newton’s third law of motion?

A. “action” and “reaction”


B. “mass” and “inertia”


C. “inertia” and “force”


D. “force” and “acceleration”

Answers

Answer:

A. action and reaction

Explanation:

the third law is:-

Every Action has it's opposite and equal Reaction

Answer:

The correct answer is "action" and "reaction".

Explanation:

Newton's Third Law is: "for every action, there is an equal and opposite reaction". This means that every time something is pushed on, the other object pushes back. For example, when a swimmer pushes off the wall of a pool, the wall will push back on the swimmer, giving them the push they need to swim to the other side.

Which is a term for a type of detritivore?
Carnivore
Decomposer
Herbivore
Omnivore

Answers

Answer:

Decomposer

Explanation:

Decomposers eat dead organsims carnivores rarely

Answer:

C. Decomposer

Explanation:

A.P.E.X

A student observes that a plant has droopy leaves and stems and infers that the rate of photosynthesis has slowed in the plant. Which statement provides evidence to support the student’s inference?

Answers

Answer:

A. The water pressure in the plant's vacuole is low, and without water, the chloroplasts cannot convert carbon dioxide to glucose during photosynthesis.

Explanation:

Photosynthesis occurs on chloroplasts which are located on the surface of leaves. Photosynthesis is the conversion of carbon dioxide, water, and light energy to produce glucose and oxygen for plants.

The vacuoles inside the plant's cell contain stored food and absorb water through osmosis. Water in the vacuole has more solutes than water outside the vacuole. This causes the Turgor Pressure which the vacuole impacts on the plants. If the reverse becomes the case, water is lost from the vacuole causing it to shrink.

Flaccidity of the vacuole and the cell wall will cause the chloroplasts where photosynthesis occurs to shrink.

Question 4 of 10
Which of the following best describes cost-benefit analysis?

Answers

Answer: a) a process of maximizing benefits and minimizing costs. b)a way to predict how much someone will earn in the future. c)a calculation of how much profit will result from a certain level of spending. d)a method of calculating money spent on a project.

Explanation:

How does soil erosion affect streams and rivers?

Answers

Explanation:

The effects of soil erosion go beyond the loss of fertile land. It has led to increased pollution and sedimentation in streams and rivers, clogging these waterways and causing declines in fish and other species. And degraded lands are also often less able to hold onto water, which can worsen flooding.

6. Name the nitrogenous wastes excreted by the following organisms:-
(1) Desert mole
(ii) Marine fish
(111) Tilapia​

Answers

Answer:

Desert mole excretes concentrated urine with urea.

Marine fish excretes urine with uric acid.

Tilapia excretes dilute urine with amino acids.

Explanation:

The nitrogenous wastes that are excreted by the following organisms are as follows:

Desert mole: Urea.Marine fish: Uric acid.Tilapia: Amino acids.

What is Nitrogenous waste?

Nitrogenous waste may be defined as the compounds which are excreted by the organisms that contain an excessive amount of nitrogen or its derivative products.

Among the above-given organisms, Desert mole and Marine fish are Ureotelic organisms that excrete either concentrated or diluted urine with a significant amount of urea and uric acid respectively.

While Tilapia is an Ammonotelic organism that excretes diluted urine with a significant amount of amino acids.

Therefore, it is well described above.

To learn more about Nitrogenous waste, refer to the link:

https://brainly.com/question/9517408

#SPJ2

Which of the following IS NOT a part of the cell theory? *
All organisms are made of one or more cells
All cells contain nuclei and membrane bound organelles
Cells arise from pre-existing cells
Cells are the basic units of structure and function

Answers

Answer:

all cells contain nuclei.

Explanation:

prokaryotes dont have a nuclei

which of the following is not true about an allele?

A. alleles are found at the same place on a chromosome

B. alleles have a dominant and recessive form

C. an allele is never independently assorted and passed down randomly

D. and allele is one of two or more forms of a gene

Answers

Answer:

C

Explanation:

I guess it's C but not conform

C. An allele is never independently assorted and passed down randomly.

What is an allele?

Alleles are found at the same place on a chromosome, known as a locus. They can have a dominant and recessive form, meaning that one form of the allele may be expressed over the other in the phenotype of an organism. An allele is one of two or more forms of a gene, which are variations of a particular gene that can produce different traits in an organism.

However, alleles are not always passed down randomly. In meiosis, the process of cell division that produces gametes (sex cells), the alleles of a gene are independently assorted and passed down to the offspring. This means that each gamete receives one copy of each allele at random, which can result in a mix of alleles in the offspring. However, the exact combination of alleles that an offspring receives depends on the combination of alleles that its parents had, which can influence the probability of certain alleles being passed down.

Learn more about allele, here:

https://brainly.com/question/14206531

#SPJ2

What are two ways in which cells use the energy temporarily stored in ATP?

Answers

Answer: Energy provided by ATP is used in active transport, to contract muscles, to make proteins, and in many other ways

The two main ways in which cells use the energy temporarily stored in the form of ATP is in active transport, and to make proteins.

What is Active transport?

Active transport is the movement of molecules, ions, solutes, solvents against the concentration gradient. The flow of material takes place from the region of their lower concentration to the region of their higher concentration. The transport is against the gradient and hence requires energy to proceed which is given by ATP.

ATP is required to synthesize proteins in the ribosomes of the cell through the process of translation. This is a highly energy-consuming energy and thus required large amount of ATP.

Learn more about ATP here:

https://brainly.com/question/14637256

#SPJ2

Which of the following is an example of how a species may change over time?
A.
Bacteria become resistant to antibiotics.
B.
Dog fur becomes thicker in the winter.
C.
Turtles become male or female based on incubation temperature.
D.
Humans become immune to a certain illness after vaccination.

Answers

Answer: possibly A

Explanation: B an C are not it because they are more like mutations. D humans don’t always become immune.

1. what is an organelle?

2. give me an example of an organelle.

3. Which organelle is the "command center" of
the center?

Answers

Answer:

1. a subcellular structure that has a job to do within the cell

2. mitochondria

3. the nucleus

can u answer that question

Answers

Answer:

The synthesis of new proteins

centricles play specific roles during the division of​

Answers

Answer:Centrioles play a notable role in cell division. ... These spindle fibers act as guides for the alignment of the chromosomes as they separate later during the process of cell division. Though centrioles play a role in the mitosis of animal cells, plant cells are able to reproduce without them

Explanation:

What are non- examples of an electromagnetic wave?

Answers

An electromagnetic wave can travel through anything - be it air, a solid material or vacuum. ... Examples of EM waves are radio waves, microwaves, infrared waves, X-rays, gamma rays, etc.

What three things regarding cell organelles are different between plant and animal cells?

Answers

Answer:

Plant cells have a cell wall, but animals cells do not. ...

Plant cells have chloroplasts, but animal cells do not. ...

Plant cells usually have one or more large vacuole(s), while animal cells have smaller vacuoles, if any are present

describe and explain how the rate of photosynthesis is affected by light intensity​

Answers

Increasing the light intensity increases the rate of photosynthesis, until some other factor - a limiting factor - becomes in short supply. At very high light intensities, photosynthesis is slowed and then inhibited, but these light intensities do not occur in nature.

what occurs in a chemical reaction

Answers

Answer:

options on. D is write answer

Can a
Brain cell
Fat cell
Muscle cell
Red blood cell
Liver cell
Convert one type of fuel molecule to another

Answers

answer: yes

exanation:

plants Which part of the carbon cycle occurs when plants, trees, or fossil fuels are burned?
A. Transpiration B. Oxidation C. Photosynthesis D. Combustion

Answers

I believe C- photosynthesis but I could be wrong.

4
_ is a component of soil made entirely of decomposed organic remains. This component increases soil fertility and _
the ability of soil to retain water.
A. Humus; increases
B.
Parent material; decreases
C.
Subsoil; increases
D
Topsoil; decreases

Answers

Answer:

The answer is A

Explanation:

am 100% sure

I'll give you a brainliest if is right or at least shows some effort
(thanks & i hope your having a good day)

In your own words, explain how background noise detected in space provides evidence for the Big Bang Theory.

Answers

Answer:

Celestial microwave radiation found a strange microwave signal causing background noise in the radio telescope. The signal came from every direction. The young universe would have been very hot. The microwave background radiation is the remaining heat from the Big bang.

I tried my hardest and this is what I put on MY test so good luck

Which is an example of the use of plants in human societs?

Answers

Answer:

|

v

Explanation:

photosynthesis creates oxygen, water and glocose(starch) and we take in those and use it in our mitochondrias to create atp so it can hapen all over again.

Human uses of plants include both practical uses, such as for food, clothing, and medicine, and symbolic uses, such as in art, mythology and literature.

Describe how the circulatory system allows the endocrine system to do its job?​

Answers

Answer:

The circulatory system is the transport system for endocrine info. The endocrine chemicals and hormones must circulate through the body via blood vessels.

Other Questions
why is more dew formed on a grass and not on polished metal surface Which sentence is punctuated correctly?I will get on the bus soon; I should be home before lunch.Many people like both dogs and cats: the animal shelter has plenty of both of them.Don't be surprised if it snows it snows almost every day here in the winter.Many people like to play soccer, soccer has become very popular with children. How many moles are there in 5.2x10^23 atoms of CO2? What do Buddhists consider Enlightenment to be? What is the most important part of your speech Find the percent increase. Round to the nearest percent. From 95 books to 139 books.The percent increase is __%(I just need the answer, no need for explanation) Help me please, Ill give brainliest, pls say how u got the answer but quickly ILL GIVE BRAINLIEST TO FIRST CORRECT ANSWER That timber cat walks over and sits down in the fire. Just like the other cats did it. And he picks up this live coal. And he puts it right on his slanted, green eyes. He dusts his eyeballs with it! And he turns around to the other cats sittin on each side of John. The timber cat says to the other cats, says, showin his teeth, "What you want to do with him there?" And looks straight dead at John, too. And the other cats say right back all in one meow, "We better wait till Martin comes." With that, John gives a great heave up. The chair comes up with him. But at least he was up. And he runs out the wide-open front door. He's callin as he goes out flyin, "Mister Cats! You tell Martin I was here, but I couldn't wait on him. And now I'm gone!" And he was. Long gone. And never seen in that county since.Better Wait Till Martin Comes,Virginia HamiltonWrite two to three sentences explaining how the suspense within the story makes the climax of Better Wait Till Martin Comes funny. Y=-1/4x +9 what is the slope and y - intercept PLZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZZ HELPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPPP!!!!!We know our lands are now become more valuable: the white people think we do notknow their value; but we are sensible that the land is everlasting, and the few goodswe receive for it are soon worn out and gone. For the future we will sell no lands butwhen Brother Onas [the proprietor of Pennsylvania] is in the country; and we will knowbeforehand the quantity of the goods we are to receive. Besides, we are not well usedwith respect to the lands still unsold by us. Your people daily settle on these lands, andspoil our huntingIf you have not done anything, we now renew our request, and desire you will informthe person whose people are seated on our lands, that that country belongs to us, inright of conquest; we having bought it with our blood, and taken it from our enemiesin fair warIt is customary with us to make a present of skins whenever we renew our treaties. Weare ashamed to offer our brethren so few; but your horses and cows have eat the grassour deer used to feed on. This has made them scarce, and will, we hope, plead in excusefor our not bringing a larger quantity: if we could have spared more we would have givenmore; but we are really poor; and desire youll not consider the quantity, but, few as theyare, accept them in testimony of our regardOur wise forefathers established union and amity between the ve nations [IroquoisNation]. This has made us formidable. This has given us great weight and authoritywith our neighboring nations. We are a powerful Confederacy, and by your observingthe same methods our wise forefathers have taken you will acquire much strength andpower; therefore, whatever befalls you, do not fall out with one another.QUESTION: In what ways does the document describe issues of power, wealth, or morality?Be sure to cite evidence from the document that supports your answer and explain why it supports your answer. Use the RADD process to help answer this question. Which of the following statements best describes how the author feels about her mother?Esperanza loves the bread-like smell of her mother's hair.Esperanza spends time with her little sister while her brothers play separately.Esperanza's name makes her feel uncomfortable, and she wants to change it.Esperanza does not want to grow up like her mother. In 1989 Carl Lewis established a world record when he ran the hundred meter dash in 9.92 seconds. What was his average speed (in M/S) for the race? Remember to include your data, equation, and work on solving the problem. How does the stratigraphic principle help us determine the age of layers of rocks? 10 1/9 + 5 14/15 please help Write a compound inequality that represents the following phrase.all real numbers that are between -4 and 8A. -4< n Why is it important to avoid applying too much nitrogen fertilizer?O A. Too much nitrogen can buffer cells from extremes in pH.B. Too much nitrogen in surface runoff can poison fish.C. Too much nitrogen in surface runoff can cause algae to overgrow.O D. Too much nitrogen can increase the salinity of soil. What type of sentence is this sentence? We can only speak of people Whose roots in America are older or newer.a. simpleb. compoundc. complexd. compound-complex Where are alkaline earth metals found on the periodic table?Group 1Group 2Groups 312Group 17 In the past, the mean running time for a certain type of flashlight battery has been 9.7 hours. The manufacturer has introduced a change in the production method and wants to perform a hypothesis test to determine whether the mean running time has increased as a result. The hypotheses are: H 0: = 9.7 hours H a: > 9.7 hours where is the mean running time of the new batteries . Explain the meaning of a Type I error. how many elements are found in the third period. A.2 B.18 C.8 D.32