Which process requires ATP in order to release particles from a cell to maintain homeostasis?​

Answers

Answer 1

Answer:

Active Transport uses energy (atp) to maintain homeostasis within cells. Organisms use energy contained in their cells to allow proteins to make channels in the membrane for transport.


Related Questions

PLEASE ANSWER ALL QUESTIONS! THANKS!

Which of the following statements about salinity is true?
Question 1 options:

Ocean water near areas with low evaporation has higher salinity.


Ocean water in regions with high levels of precipitation has higher salinity.


Ocean water near rivers has a lower salinity.


Ocean water in areas with high humidity has a higher salinity



How are latitude and temperature related?








Question 2 options:

Lower latitudes will have warmer water because it is closer to the equator.


Higher latitudes will have warmer water because it is closer to the equator.


Higher latitudes will have warmer water because it is closer to the poles.


Lower latitudes will have warmer water because it is closer to the poles


How does salinity vary with freezing and melting?









Question 3 options:

Both freezing and melting decrease salinity.


Both freezing and melting increase salinity.


Freezing decreases salinity, while melting increases salinity.


Freezing increases salinity, while melting decreases salinity.


How does salinity vary with evaporation?









Question 4 options:

When water evaporates, it takes salt with it, increasing its salinity.


When water evaporates, it leaves salt behind, increasing its salinity.


When water evaporates, it leaves salt behind, decreasing its salinity.


When water evaporates, it takes salt with it, decreasing its salinity.

Answers

Answer:

that guys answers are all wrong except for #3

Explanation:

i took the quiz and got 1/4

Which statement explains the movement of energy through aerobic
cellular respiration? Choose the correct answer.
O Heat energy is absorbed as chemical potential energy is transferred from
oxygen molecules to ATP molecules.
O Heat energy is released as chemical potential energy is transferred from
oxygen molecules to ATP molecules.
O Heat energy is released as chemical potential energy is transferred from
glucose molecules to ATP molecules.

Answers

Answer:

Energy in the form of heat is released as chemical potential energy is transferred from glucose molecules to ATP molecules

The statement that best explains the movement of energy through aerobic cellular respiration is as follows:

Heat energy is released as chemical potential energy is transferred from glucose molecules to ATP molecules.

Thus, the correct option for this question is C.

What is Aerobic cellular respiration?

Aerobic cellular respiration may be defined as a type of biological process through which the molecules of glucose are broken down into carbon dioxide and water in the presence of oxygen with the liberation of some amount of energy. The derivation of energy is the fundamental mechanism of this process.

The mechanism initiate after capturing the heat energy from the and transforming it into chemical energy through the process of photosynthesis which synthesizes glucose. This glucose is then transferred to its potential energy to the ATP molecules in the presence of oxygen.

Therefore, heat energy is released as chemical potential energy is transferred from glucose molecules to ATP molecules. Thus, the correct option for this question is C.

To learn more about Cellular respiration, refer to the link:

https://brainly.com/question/2809259

#SPJ2

How can a material at a certain temperature have all of its molecules at the same energy?

Answers

it can be frozen (32°F or 0°C) which would slow the energy of the molecules. or it could be boiled (212°F or 100°C) which would rapidly increase the speed of the molecules.

help me out girlies its due

Answers

the stereotype is that all australians are some sort of zookeepers? and wear clothes like that. also that they drink beer a lot.

Answer:

the stereotype is that all australians are zookeepers? and wear clothes like that.

Explanation:

Explain how a scientist might use a karyotype to study genetic disorders.☜(゚ヮ゚☜)

Answers

Karyotype helps to study the presence and location of genes on chromosome. This also helps to find the mutations such as duplication or deletions.

Answer:

90% of people marry there 7th grade love. since u have read this, u will be told good news tonight. if u don't pass this on nine comments your worst week starts now this isn't fake. apparently if u copy and paste this on ten comments in the next ten minutes you will have the best day of your life tomorrow. you will either get kissed or asked out in the next 53 minutes someone will say i lov

90% of people marry there 7th grade love. since u have read this, u will be told good news tonight. if u don't pass this on nine comments your worst week starts now this isn't fake. apparently if u copy and paste this on ten comments in the next ten minutes you will have the best day of your life tomorrow. you will either get kissed or asked out in the next 53 minutes someone will say i love

90% of people marry there 7th grade love. since u have read this, u will be told good news tonight. if u don't pass this on nine comments your worst week starts now this isn't fake. apparently if u copy and paste this on ten comments in the next ten minutes you will have the best day of your life tomorrow. you will either get kissed or asked out in the next 53 minutes someone will say

90% of people marry there 7th grade love. since u have read this, u will be told good news tonight. if u don't pass this on nine comments your worst week starts now this isn't fake. apparently if u copy and paste this on ten comments in the next ten minutes you will have the best day of your life tomorrow. you will either get kissed or asked out in the next 53 minutes someone will say i love

90% of people marry there 7th grade love. since u have read this, u will be told good news tonight. if u don't pass this on nine comments your worst week starts now this isn't fake. apparently if u copy and paste this on ten comments in the next ten minutes you will have the best day of your life tomorrow. you will either get kissed or asked out in the next 53 minutes someone will say i love u

Explanation:

5. All cells
a. Are enclosed in a membrane that maintains internal conditions different from the surroundings
b. Have DNA as genetic material
c. Require energy to function
d. All of the above are correct

Answers

I’m pretty sure it’s D

I AM LITERALLY CRYING RIGHT NOW PLEASEE HELPPP WILL MARK BRANLIEST HELPPP MEE

Part 1: Explore

Based on your research and observations of the three common states of matter, answer the

following questions.

Out of the videos, animations, and images you researched, which was your favorite? Why?

Do you feel it accurately represented the differences between each state of matter


How does the space between the particles in each state of matter differ?

How do the particles in each state of matter move?

Part 2: Explain

Examine the heating curve of water below, and then answer the questions about it. If you require the use of a text reader, open the file Heating Curve of Water to receive the information.


Which three parts of the graph’s curve represent the solid, liquid, and gaseous state of water?

Explain your reasoning.

Which point of the graph’s curve represents the melting point of water? Explain your reasoning.

Which point of the graph’s curve represents the boiling point of water? Explain your reasoning.

What happens to the energy of water in Part B and Part D of the graph’s curve? How do you know?

Why does the temperature of the water stay the same when it melts and boils?

Now comes the hands-on part of your project! You will continue to explore phase changes by performing an experiment and creating your own heating curve. Before you begin your experiment, read over the following information.


The materials you will need for your experiment are listed below.


small pot

measuring cup (must have mL and oz markings)

spoon (wooden, plastic, or metal)

ice

water

stove

thermometer (should have units in °C

Time (min) Temperature of Water (°C) Observations of Water

0

1

2

3

4

5

6

7

8

9

10

11

12

13

14

15

Place 14 oz of crushed ice into a small pot. Then add about 125 mL of water to it.

Using the thermometer, measure and record the initial temperature of the ice water. List this temperature in °C in the “0” minutes row of your data table in the lab handout. *Do not allow the thermometer to touch the bottom of the pot when recording measurements.

Place the pot on the stove, and turn the knob to the medium-low setting.

Using the thermometer, measure the temperature every minute until the water begins to boil vigorously. Record this data in the table on your lab handout.

At each measurement, also record what is happening to the water. Be sure to record the times of these events:

The ice melts.

The water forms steam.

The water begins to boil.

Once the water has begun to boil, stir the water constantly with the spoon.

Continue to measure and record the temperature every minute until almost all the water has boiled and the pot is close to empty.

Record the last temperature, and turn off the stove. DO NOT TOUCH THE POT WITHOUT SAFETY EQUIPMENT.

Create the x-axis and y-axis of a graph.

Label the x-axis as follows: Time (min).

Label the y-axis as follows: Temperature of Water (°C).

Along the x-axis, create and label 15 marks, one for each minute of the experiment. (Hint: The origin starts at 0.)

Along the y-axis, create and label temperature markings for every 20 degrees. (Hint: The origin starts at 0.)

Refer to the data from your experiment to plot the points on your graph. Then connect each of the data points with a line.

Look over your graph to make sure it is clear and correctly labeled.

Either save your graph as a computer file, or take a picture of your graph and upload it as a file on your computer.

Describe your experience in performing the experiment. What went well? What could have been

improved?

Examine your line graph. How does the graph’s slope change over time?

Examine your line graph. Why does the slope change?

How could you apply the knowledge gained from this experiment in the real world?

Hint: Think of cooking.

Make a prediction. How do you think adding other substances to the water would affect its

heating curve?

THANK YOU SO MUCH

Answers

Answer:

think of cooking

Explanation:

the reason is that I just know it

using the count data and observational data you acquired calculate the number of cfus in the original sample

Answers

Answer:

cuales son los datos ?

Explanation:

cuales son los datos

Name one adaptation that allows desert plants to survive with little water?

Answers

Answer:

stomata

Explanation:

This adaptation helps cacti reduce water loss by keeping the hot, dry wind from blowing directly across the stomata. The leaves and stems of many desert plants have a thick, waxy covering.

Process performed by plants (producers) using the sun's energy to make their own food.
A. Conduction
B. Photosynthesis
C. Fission
D. Fusion

Answers

Answer: B.Fotosintesis

Explanation:

Answer:

option B

Explanation:

photosynthesis is the correct answer.

plz mark my answer as brainlist plzzzz.

hope this will be helpful to you.

What would happen to the production of the high energy sugars if water or carbon dioxide were not
available to plants?
ATD

Answers

Answer:

There would be no production of high energy sugars in the plant.

Explanation:

Plants produce their food (autotrophism) in a process unique to them called PHOTOSYNTHESIS. Photosynthesis is the process whereby plants produce energy-storing sugars (glucose) in the presence of light from sun.

This photosynthetic process combines Carbon dioxide (CO2) and water (H2O) as reactants to form sugar (C6H12O6) and oxygen (O2) as products. The equation for photosynthesis is as follows:

6CO2 + 6H2O → C6H12O6 + 6O2

This means that water and carbon dioxide are strictly needed for the process of photosynthesis to occur in plants. Hence, if water or carbon dioxide were not available to plants, there would be no photosynthetic process and ultimately no production of high energy sugars.

The Colorado River provides water and electricity for over 40 million people. But so much water is withdrawn from this river for agriculture/livestock and drinking water, that very little of it reaches the sea. Due to drought and overuse, it currently is drying up. This will be a major problem because crops and livestock in the USA depend on this water. What percent of the nation's crops and livestock rely on the river's water?​

Answers

Answer:

About 80%

Explanation:

I might be wrong but at least 80%

HELP NEED THIS BY TODAY!
What did Mendel study that lead him to his discovery

Answers

Answer:

A monk, Mendel discovered the basic principles of heredity through experiments in his monastery's garden. His experiments showed that the inheritance of certain traits in pea plants follows particular patterns, subsequently becoming the foundation of modern genetics and leading to the study of heredity.

Explanation:

Answer:

Mendel studied the genetics of pea plants.

Explanation:

Mendel looked at the pea plants in his monastery garden to determine genetics. He found that some plants had white flowers, while some did not, and he used that discovery to determine the genetics of the plants.

15 Which of the following mutations would have the potential to affect future
generations of a species?
A A frame shift mutation in the X chromosome of a cheek cell
B A chromosomal mutation in the Y chromosome of a kidney cell
CA point mutation in the first chromosome of a sperm cell
D A substitution mutation in the third chromosome of a uterus cell

Answers

Answer:

c i think

Explanation:

I don't know just trying to help hope you have a good day

The answer is c a point mutation in the first chromosome of a sperm cell

A friend says that all bacteria are harmful to people list three reasons this statement is incorrect.

Answers

-autotrophic bacteria give off oxygen (O2)
-flavor foods such as vinegar, yogurt, cheese, etc. (pasteurization)
-decomposers (bacteria)- recycle nutrients in food web
-enviromental clean-up- bacteria eat oil from oil spills
0health and medicine- bacteria break down food in your intestines/make

Which statement best explains how the gases of the atmosphere affect the temperature of Earth?

Answers

The atmosphere today contains more greenhouse gas molecules, so more of the infrared energy emitted by the surface ends up being absorbed by the atmosphere. Since some of the extra energy from a warmer atmosphere radiates back down to the surface, Earth's surface temperature rises.

Which of the 8 characteristics prove that a virus is or is not considered living?

Answers

Answer:

Nonliving characteristics include the fact that they are not cells, have no cytoplasm or cellular organelles, and carry out no metabolism on their own and therefore must replicate using the host cell's metabolic machinery.

Explanation:

Viruses lack membranes. Hence, they do not show characteristics of life until they enter a living cell. On entering the living cell they use the cell machinery to multiply.

PLEASE HELP
Match the monomer to the polymer.
A.Amino acid B.glycogen
C. Nucleotide.
D.phospholipid Monosaccharide.
E.DNA
F.Fatty acids and glycerol.
G.protein collagen​

Answers

Nucleotide (DNA)

Amino acid (protein collagen​)

Monosaccharide (glycogen)

Fatty acids and glycerol (phospholipid)

Can someone answer this for me?

Answers

Answer:

Outside

Explanation:

The word outside makes the most sense in this sentence.

Hope it helps!

Which of the following options best depicts the process of protein synthesis?

1. protein → RNA → DNA
2. DNA → amino acid → RNA → protein
3. DNA → RNA → protein
4. RNA → DNA → RNA → protein

Answers

During translation, the genetic code in mRNA is read and used to make a protein. These two processes are summed up by the central dogma of molecular biology: DNA → RNA → Protein.

Describe the two signals and pathways that are activated when you touch something and experience pain

Answers

The medial thalamus projects to widespread areas of the forebrain, including the somatosensory cortex. Thus there are two major ascending pathways for pain: a direct lateral spinothalamic pathway and an indirect medial spinoreticulothalamic pathway.

How do you think about the invention of the microscope? Influenced the cell theory?
And what are the components of the cell theory?

Answers

Answer:

See the answer below

Explanation:

The invention of the microscope paved way for the development of the cell theory because, without it, the cell and all the organelles of the cell would not have been discovered and or studied in great detail. It was through the use of  a microscope that Robert Hooke was able to observe and name the cell and it was through the same microscope that the fine details of the cell were able to be studied by other scientists, culminating in the formulation of the cell theory.

The cell theory states that all living organisms are made up of cells, the cell is the basic unit of all life, and cells can only arise from already existing cells (via cell division). The components of the cell theory, therefore, are:

Living organisms are made up of cells.The cell represents the basic unit of life.Cells can only arise from preexsiting cells.

Government agencies regulate most aspects of agricultural safety.
True
False

Answers

Answer:

False

Explanation:

In the biosphere, _________________ is an important element in ATP (Adenosine triphosphate) and DNA (Deoxyribonucleic acid).

A. Phosphorus
B. Phosphate
C. Photosynthesis
D. Photons

Answers

C would be your answer

In the biosphere, phosphorus is an important element in ATP (Adenosine triphosphate) and DNA (Deoxyribonucleic Acid), which is in Option A, as phosphorus is a crucial element in the biosphere as it is a component of both ATP (Adenosine triphosphate) and DNA (Deoxyribonucleic Acid).

What is phosphorus?

Phosphorus is essential for the formation of the backbone of the DNA molecule, where it links the sugar and nitrogenous base components of the nucleotides. The phosphate group of each nucleotide forms a covalent bond with the sugar molecule of the adjacent nucleotide, forming a long, stable chain of nucleotides that make up the DNA molecule. The DNA molecule is responsible for transmitting genetic information from parent to offspring and serves as a blueprint for the development and function of living organisms.

Hence, in the biosphere, phosphorus is an important element in ATP (adenosine triphosphate) and DNA (deoxyribonucleic acid), which are in Option A.

Learn more about phosphorus here.

https://brainly.com/question/12767956

#SPJ2

1. DNA base sequence: GACGATGTAGCATCGACCATTG.
What would the mRNA sequence for this sequence of DNA be?

Answers

CUGCUACAUCGUAGCUGGUAAC

PLEASE HELP ASAP Match each word with the phrase that best defines it.
informal
a statement that is objective or unchanging
fact
done in a way that is friendly or casual
formal
a statement that is subjective or based on
interpretation
topic
done in a way that is suitable, appropriate,
or based on guidelines
opinion
the main point of a given subject

Answers

Answer:

fact: a statement that is objective or unchanging

informal: done in a way that is friendly or casual

formal: done in a way that is suitable, appropriate,

or based on guidelines

opinion: a statement that is subjective or based on

interpretation

topic: the main point of a given subject

Match each word with the phrase that best defines it.

1. Fact: a statement that is objective or unchanging

2. Informal: done in a way that is friendly or casual

3. Formal: done in a way that is suitable, appropriate, or based on guidelines

4. Opinion: a statement that is subjective or based on interpretation

5. Topic: the main point of a given subject

What are Phrases?

A phrase is a group of words or a singular word which functions as a grammatical unit. For example, the English expression "the very happy boy" is a noun phrase containing the adjective phrase "very happy".

It can be a single word or a complete sentence. Phrases are used to describe the people, things, or events.

There are following types of phrases. They are:

Noun phrase.Adjective phrase.Adverb phrase.Verb phrase.Prepositional phrase.Gerund phraseInfinitive phraseParticipial phrase

Thus, matching the following words with its phrases

1. Fact: a statement that is objective or unchanging

2. Informal: done in a way that is friendly or casual

3. Formal: done in a way that is suitable, appropriate, or based on guidelines

4. Opinion: a statement that is subjective or based on interpretation

5. Topic: the main point of a given subject

Learn more about Phrases, here:

https://brainly.com/question/15806900

#SPJ2

What is the universe made of

Answers

Answer:

composition

Explanation:

the universe is composed almost completely of dark energy, dark matter , and ordinary matter

Answer: matter , atoms

Explanation:

Explain why it is very important for the gametes to divide by meiosis. What could happen if the gametes accidentally divide by mitosis? can someone answer in a sentence!!

Answers

Meiosis is important because it ensures that all organisms produced via sexual reproduction contain the correct number of chromosomes. Meiosis also produces genetic variation by way of the process of recombination.

Explanation: Gametes are made via meiosis which produces cells with n=23 instead of diploid cells. If gametes were produced instead by mitosis each gamete would be diploid not haploid.

If one DNA strand reads CCGTAATGCAT, what will be the sequence of the complimentary strand?

Answers

The complimentary strand would be GGCATTACGTA

explain how the cells, tissue, and organs within the circulatory system work together to enable it to perform its function of pumping materials around the body and removing waste products such as carbon dioxide.

Answers

Answer:

the body has levels of organization that build on each other.Cells make up tissues,tissues make up organs,and organs make up organs system.

Other Questions
In the story " Departure ", Early in the morning he plans to leave. How dies George feel abouthis upcoming departure?A He is confident about his future success.B O He is regretting the decision to leave.CHe is nervous about leaving.DHe is thrilled about his future plans. 4Jared has a collection of 90 movies on DVD. If46 of the movies are comedies, 26 are drama,and the rest are science fiction, what percent ofthe movies are science fiction?A) 18B) 20C) 28D) 32 How often does it rain in theArabian Peninsula? What happens to Odysseus? A scientist compares two samples of white powder. One powder was present at the beginning of an experiment. The other powder was present at the end. She wants to determine whether a chemical reaction has occurred. She finds that neither sample bubbles or dissolves in water. She measures the mass and volume of the solids. Sample one has a volume of 45 cm3 and a mass of 0.5 g. Sample two has a volume of 65 cm3 and a mass of 1.3 g. What should the scientist conclude?A. The samples have the same color, so no chemical reaction has occurred.B. The two samples do not react with water, so no chemical reaction has occurred.C. The densities of the samples are different, so a chemical reaction has occurred.D. The densities of the samples are the same, so no chemical reaction has occurred.E. The densities of the samples are different, so no chemical reaction has occurred. What type of sentence it is? pleaseeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee help asap timed testA coordinate plane with a straight line. The line starts in the lower left quadrant and continues up through the uppercase right quadrant. The line passes through the y-axis slightly below the origin, and then passes through the x-axis slightly to the right of the origin.Which of these values could be the slope of the line? Select two options.203 A positive - negative = what? If you stand on a trampoline, it depresses under your weight. When you stand on a hard stone floor, __________. If you stand on a trampoline, it depresses under your weight. When you stand on a hard stone floor, __________. the floor deforms very slightly under your weight only if you are heavy enough does the floor deform at all under your weight the floor does not deform at all under your weight in a unit circle, what is the relationship between arc length and central angle? 5/6+5/12 For brainliest Kevin is designing a cover for a comic book. He wants to have a rectangular grid with x ^ 2 - 3x - 10 squares in it, for some positive whole number x. What are the possible side lengths for the grid?A. There are no possible whole number side lengths.B. (x + 2) and (x - 5)C. (x - 2) and (x + 5)D. (x + 2) and (x + 5) Using ABC, identify the ratio for sine of C How do I find the cash flow coverage ratio? how important is the music of visayas in terms of its culture and history point.4.i. Explain why a particle moving with a constant speed along a circularpath has a radial acceleration.ii. Show that the acceleration of a body moving in a circular path ofradius r with uniform speed v is and draw a diagram to show thedirection of the acceleration.2iii. Show that the expression = is dimensionally correct. PLEASE ANSWER THIS QUESTION RIGHT.What piece of information does c identify in the following equation?y=ax2+bx+c Plz help me :) dropdowns1) vailid/ not valid2) unbiased/biased3)appropriate/ inappropriate Which best describes the lesson the grandfather was trying to teach?01. It is in his power whether he is a good person or a bad person.2. Wolves are very dangerous animals and should be avoided.03. It is wise for a person to feed both the good and the bad wolves.04. A grandson must listen to his grandfather because it is respectful. What does the phrase "a picture is worth 1,000 words" mean to you? Explain.