which of the following cells shows the process of a nucleus? a. prokaryotic b. eukaryotic c. both

Answers

Answer 1

Answer:

b. eukaryotic

Explanation:

"Eukaryotic" means to have a nucleus.
Answer 2
eukaryotic because the other one lacks a nucleus

Related Questions

1. Peer review allows others in the field to assess a scientist's investigations and results.
a. True
b. False

Answers

Answer:

False.

Explanation:

Peer review provide others scientist in the field to assess a scientist's investigations and results.

Peer Review:

It is the reviewing or evolution of the work by many professionals and experts in the field.

For example-  A scienfic manuscript is send to the many scientist for evolution before publication.

This peer review is unbiased because the reviewer does not know the name or other information about writter.

To know more about  Peer Review:

https://brainly.com/question/10853815

Genetic engineering involves _______ to achieve desired results. a. enzyme production b. modifying products and processes c. changing one organism into another d. introducing traits into organisms Please select the best answer from the choices provided A B C D

Answers

Answer:

D

Explanation:

the answer is d bruv like fr

Answer:

D

Explanation:

DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD

What do RNAs do in the cell?

Group of answer choices

Answers

Answer:

A wide range of functions are performed by RNA, from translating genetic information into molecular machines and cell structures to controlling gene activity during development, cellular differentiation, and changing environments.

Explanation:

None

Describe how the circulatory system allows the endocrine system to do its job?​

Answers

Answer:

The circulatory system is the transport system for endocrine info. The endocrine chemicals and hormones must circulate through the body via blood vessels.

I could really use some help on this question l, please help!?! Thank you ❤️ much love stay safe 2020

Answers

Answer: its B and D

Explanation:

The movement of water in or out of the cell membrane without the use of ATP.

Diffusion

Facilitated diffusion

Osmosis

Excoytosis

Answers

The answer is Osmosis because its the only one that has anything to do with water

describe and explain how the rate of photosynthesis is affected by light intensity​

Answers

Increasing the light intensity increases the rate of photosynthesis, until some other factor - a limiting factor - becomes in short supply. At very high light intensities, photosynthesis is slowed and then inhibited, but these light intensities do not occur in nature.

Can a
Brain cell
Fat cell
Muscle cell
Red blood cell
Liver cell
Convert one type of fuel molecule to another

Answers

answer: yes

exanation:

What three things regarding cell organelles are different between plant and animal cells?

Answers

Answer:

Plant cells have a cell wall, but animals cells do not. ...

Plant cells have chloroplasts, but animal cells do not. ...

Plant cells usually have one or more large vacuole(s), while animal cells have smaller vacuoles, if any are present

which of the following is not true about an allele?

A. alleles are found at the same place on a chromosome

B. alleles have a dominant and recessive form

C. an allele is never independently assorted and passed down randomly

D. and allele is one of two or more forms of a gene

Answers

Answer:

C

Explanation:

I guess it's C but not conform

C. An allele is never independently assorted and passed down randomly.

What is an allele?

Alleles are found at the same place on a chromosome, known as a locus. They can have a dominant and recessive form, meaning that one form of the allele may be expressed over the other in the phenotype of an organism. An allele is one of two or more forms of a gene, which are variations of a particular gene that can produce different traits in an organism.

However, alleles are not always passed down randomly. In meiosis, the process of cell division that produces gametes (sex cells), the alleles of a gene are independently assorted and passed down to the offspring. This means that each gamete receives one copy of each allele at random, which can result in a mix of alleles in the offspring. However, the exact combination of alleles that an offspring receives depends on the combination of alleles that its parents had, which can influence the probability of certain alleles being passed down.

Learn more about allele, here:

https://brainly.com/question/14206531

#SPJ2

1. what is an organelle?

2. give me an example of an organelle.

3. Which organelle is the "command center" of
the center?

Answers

Answer:

1. a subcellular structure that has a job to do within the cell

2. mitochondria

3. the nucleus

Which describes something that occurs during translation?

Answers

Answer: In translation process, the messenger RNA (mRNA) template is used to create amino acid chain by which a protein is formed. Translation is the process of synthesis of proteins from amino acids which the help of mRNA

Answer:

c

Explanation:

Which of the following IS NOT a part of the cell theory? *
All organisms are made of one or more cells
All cells contain nuclei and membrane bound organelles
Cells arise from pre-existing cells
Cells are the basic units of structure and function

Answers

Answer:

all cells contain nuclei.

Explanation:

prokaryotes dont have a nuclei

what occurs in a chemical reaction

Answers

Answer:

options on. D is write answer

what is a cell membrane?

Answers

Answer:

The cell membrane is the semipermeable membrane of a cell that surrounds and encloses its contents of cytoplasm and nucleoplasm.

Explanation:

Answer:

Short. The semipermeable membrane surrounding the cytoplasm of a cell.

Long. The cell membrane is the semipermeable membrane of a cell that surrounds and encloses its contents of cytoplasm and nucleoplasm. The cell membrane separates the cell from the surrounding interstitial fluid, the main component of the extracellular fluid.

Explanation:

Write a summary statement for saturated fats including whether they are solids or liquids at room temperature and weather they have all single carbon-to-carbon or at least one carbon-to-carbon bond

Answers

Answer:

A saturated fat is a type of fat in which the fatty acid chains have all or predominantly single bonds. A fat is made of two kinds of smaller molecules: glycerol and fatty acids. Fats are made of long chains of carbon atoms. Some carbon atoms are linked by single bonds and others are linked by double bonds. Double bonds can react with hydrogen to form single bonds. They are called saturated because the second bond is broken and each half of the bond is attached to a hydrogen atom.

Explanation:

Answer:

saturated fats consists of single covalent bond and they are solid at room temperature and their melting point increases with increasing chain length

hope it helps

Explanation:

What are common changes
In an environment?

Answers

Answer:shelter, land, prey

Explanation:

Changes? Do you mean like temperature and humidity

4
_ is a component of soil made entirely of decomposed organic remains. This component increases soil fertility and _
the ability of soil to retain water.
A. Humus; increases
B.
Parent material; decreases
C.
Subsoil; increases
D
Topsoil; decreases

Answers

Answer:

The answer is A

Explanation:

am 100% sure

PLEASE help its a question about rocks I'm tryna score a 80

Answers

Answer: The answer is C

Explanation:

lavas cool quickly at the earth's surface and are characterized by fine-grained texture, in which the crystals are too small to be seen by the unaided eye. Very quickly cooled lavas, typically those quenched in water, will have a glassy texture. They cool too quickly to form crystals.

Which of these are true of physical therapists? Check all of the boxes that apply.

All physical therapists can diagnose.

Physical therapists strengthen muscle and improve balance.

Physical therapists do not prescribe medication.

Physical therapists are considered doctors.

Physical therapists are commonly called physiatrists.

Answers

2nd, and the last one

what dose cloraplast do​

Answers

n particular, organelles called chloroplasts allow plants to capture the energy of the Sun in energy-rich molecules; cell walls allow plants to have rigid structures as varied as wood trunks and supple leaves; and vacuoles allow plant cells to change size.

Answer:

Chloroplasts are a plant cell organelles and help. plants capture the energy of the sun.

Explanation:

they convert light energy to the sun relatively stable chemical energy via the photosynthetic process. By doing so, they sustain life on Earth

centricles play specific roles during the division of​

Answers

Answer:Centrioles play a notable role in cell division. ... These spindle fibers act as guides for the alignment of the chromosomes as they separate later during the process of cell division. Though centrioles play a role in the mitosis of animal cells, plant cells are able to reproduce without them

Explanation:

Which is an example of the use of plants in human societs?

Answers

Answer:

|

v

Explanation:

photosynthesis creates oxygen, water and glocose(starch) and we take in those and use it in our mitochondrias to create atp so it can hapen all over again.

Human uses of plants include both practical uses, such as for food, clothing, and medicine, and symbolic uses, such as in art, mythology and literature.

I'll give you a brainliest if is right or at least shows some effort
(thanks & i hope your having a good day)

In your own words, explain how background noise detected in space provides evidence for the Big Bang Theory.

Answers

Answer:

Celestial microwave radiation found a strange microwave signal causing background noise in the radio telescope. The signal came from every direction. The young universe would have been very hot. The microwave background radiation is the remaining heat from the Big bang.

I tried my hardest and this is what I put on MY test so good luck

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

Answers

Thymine(T) pairs with adenine(A)

Adenine(A) pairs with uracil(U)

Cytosine(C) pairs with guanine(G)

therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT

is

AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA

Which is a term for a type of detritivore?
Carnivore
Decomposer
Herbivore
Omnivore

Answers

Answer:

Decomposer

Explanation:

Decomposers eat dead organsims carnivores rarely

Answer:

C. Decomposer

Explanation:

A.P.E.X

What are two ways in which cells use the energy temporarily stored in ATP?

Answers

Answer: Energy provided by ATP is used in active transport, to contract muscles, to make proteins, and in many other ways

The two main ways in which cells use the energy temporarily stored in the form of ATP is in active transport, and to make proteins.

What is Active transport?

Active transport is the movement of molecules, ions, solutes, solvents against the concentration gradient. The flow of material takes place from the region of their lower concentration to the region of their higher concentration. The transport is against the gradient and hence requires energy to proceed which is given by ATP.

ATP is required to synthesize proteins in the ribosomes of the cell through the process of translation. This is a highly energy-consuming energy and thus required large amount of ATP.

Learn more about ATP here:

https://brainly.com/question/14637256

#SPJ2

A student observes that a plant has droopy leaves and stems and infers that the rate of photosynthesis has slowed in the plant. Which statement provides evidence to support the student’s inference?

Answers

Answer:

A. The water pressure in the plant's vacuole is low, and without water, the chloroplasts cannot convert carbon dioxide to glucose during photosynthesis.

Explanation:

Photosynthesis occurs on chloroplasts which are located on the surface of leaves. Photosynthesis is the conversion of carbon dioxide, water, and light energy to produce glucose and oxygen for plants.

The vacuoles inside the plant's cell contain stored food and absorb water through osmosis. Water in the vacuole has more solutes than water outside the vacuole. This causes the Turgor Pressure which the vacuole impacts on the plants. If the reverse becomes the case, water is lost from the vacuole causing it to shrink.

Flaccidity of the vacuole and the cell wall will cause the chloroplasts where photosynthesis occurs to shrink.

plants Which part of the carbon cycle occurs when plants, trees, or fossil fuels are burned?
A. Transpiration B. Oxidation C. Photosynthesis D. Combustion

Answers

I believe C- photosynthesis but I could be wrong.

can u answer that question

Answers

Answer:

The synthesis of new proteins

Other Questions
my question is down there Read and select the option with the correct and best verbs to complete the dialogue.A teacher talking to a student the first day of class:Seora Vila: Sara, t ________ la mochila y los libros en mi clase. Tienes el uniforme?Sara: No. seora Vila. Yo ________ el uniforme.A. habla; habloB. necesitas; necesitoC. hablo; hablasD. necesito; necesitas what is inheritance? FAST!!! Which graph shows the point M(3, 5)?5M4433M2211AB132405 X01425 X3544332NM M1M430125 X430 1 25 X 2500 + 110h < 3000 can you pls answer this HELP!!!!15 POINTS!!!!!!i think it's f but idk.. Are you living a meaningful life? Use place value multiplication with powers of 10 or equivalent fractions to explain what is happening mathematically to the decimal points in the divisor and the dividend before dividing Emma throws an object upward from a hill that is 64 feet high. The object has an initial velocity of 48 feet per second. The function y = -16x2 + 48x + 64 represents the height of the object, y, in terms of the time elapsed after the object is thrown, x. List the different kinds of external conflicts, and explain them. What is an internal conflict? Give me an example. help me pls with this question What did Angelina Grimk encourage women to do?O A. Remain subordinate to menB. Refuse to help reform movementsC. Unite in the abolitionist causeO D. Respect established social roles Put summary of I Have a Dream I need help with this I will award 30 points to anyone that can solve this. If i fail i have to retake List the number from greatest to least 3/2, 0.75,-24,-3/2 If your presentation uses a background, your text should _____.be placed in bulleted listswork well with the backgroundbe at least 50-pointsbe written in paragraph form What do you think is the common link between each of the phenomena shown? Ashoka created theofAshoka to help control the empire,spread religious tolerance and ideasof nonviolence Twelve plus the product of twelve and a number is seventy-two.