Answer:
I think the correct answer is nucleic acid. There four major classes of macromolecules and these are lipids, carbohydrates, proteins and nucleic acids. Among these nucleic acid would best fit the definition. Examples of nucleic acids are DNA and RNA
PLEASE HELP, WILL GIVE BRAINLEIST!!!
Answer:
A.
Explanation: The statement A is the only one that corresponds correctly with the graph.
PLEASE HELP HELP HELP
Answer:
1st
Explanation:
A tiny seeding grows into a tall tree with a mass of several tons. From where does the tree gain all that mass?
Answer:
it comes from sunlight
Explanation:
Based on the chemical equation, use the drop-down menu to choose the coefficients that will balance the chemical equation:
( )Na2HPO4 → ( )Na4P2O7 + ( )H2O
Answer: 2,1,1
Explanation:
Answer:
2,1,1
Explanation: Hope this helps
what is an example of drought
Answer:
An example of drought is August in the desert
Explanation:
Drought is defined as a long period of time when there is no rain
what is a definition and example of Elevation
a country with different habitat is described as high degree of?..
Answer:
Habitat diversity.
Explanation:
Biodiversity means the diversity of living organisms that make up land and water, as well as the diversity within different species, between species and ecosystems. Biodiversity is not only the overall diversity of forms and phenomena of flora and fauna but also the diversity of the function of living organisms.
Two true-breeding stocks of pea plants are crossed. One parent has red, axial flowers and the other has white, terminal flowers; all F1 individuals have red, axial flowers. The genes for flower color and location assort independently. If 1,000 F2 offspring resulted from the cross, approximately how many of them would you expect to have red, axial flowers?
Answer:
hi
Explanation:
190 is the red terminal
Dihydromyricetin (DHM), a chemical found in the moyeam plant of Asia, has shown the ability to treat certain
cancers.
Which of the following answer choices best describes a possible mechanism of action for this cancer drug?
Choose 1 answer:
А
DHM decreases apoptosis in cancer cells.
DHM decreases apoptosis in normal cells.
DHM promotes apoptosis in cancer cells.
D
DHM promotes apoptosis in normal cells.
Answer:
(C) DHM promotes apoptosis in cancer cells.
Explanation:
Since some cancers are caused by a lack of apoptosis (programmed cell death), DHM treats cancer by forcing apoptosis to occur in cancer cells, stopping their growth and division.
The choice which best describes a possible mechanism of action for this cancer drug is DHM promotes apoptosis in cancer cells. The correct option is C.
What is Dihydromyricetin (DHM)?DHM is a chemical that is present in the plant, Hovenia Dulcis grow in Japan. It is a raisin plant and has several medicinal values. It is used in East Asia as a hangover medicine.
Apoptosis is a process of cell death, so if DHM promotes apoptosis in the cancerous cells, then it will reduce cancer by killing the cancer cells.
Thus, the correct option is C, DHM promotes apoptosis in cancer cells.
Learn more about cancer cure, here:
https://brainly.com/question/10275210
#SPJ2
What should one do if the results of an experiment consistently do not support the original hypothesis?
Answer:
Change the hypothesis to match the results.
Distinguish the types of forgetting: anterograde amnesia, retrograde amnesia, encoding failure, retrieval failure, and interference (both retroactive and proactive).
Answer:
Anterograde amnesia is the inability to create new memories after the onset of amnesia, while memories from before the event remain intact. Brain regions related to this condition include the medial temporal lobe, medial diencephalon, and hippocampus. Anterograde amnesia can be caused by the effects of long-term alcoholism, severe malnutrition, stroke, head trauma, surgery, Wernicke-Korsakoff syndrome, cerebrovascular events, anoxia, or other trauma. Retrograde amnesia is the inability to recall memories made before the onset of amnesia. Retrograde amnesia is usually caused by head trauma or brain damage to parts of the brain other than the hippocampus (which is involved with the encoding process of new memories). Brain damage causing retrograde amnesia can be as varied as a cerebrovascular accident, stroke, tumor, hypoxia, encephalitis, or chronic alcoholism. The there is encoding failure. Encoding is the process of converting sensory input into a form able to be processed and stored in the memory. However, this process can be impacted by a number of factors, and how well information is encoded affects how well it is able to be recalled later. On the other hand, retrieval failure is the failure to recall information in the absence of memory cues. Proactive interference occurs when old memories hinder the ability to make new memories. In this type of interference, old information inhibits the ability to remember new information, such as when outdated scientific facts interfere with the ability to remember updated facts. This often occurs when memories are learned in similar contexts, or regarding similar things. It’s when we have preconceived notions about situations and events, and apply them to current situations and events.Retroactive interference occurs when old memories are changed by new ones, sometimes so much that the original memory is forgotten. This is when newly learned information interferes with and impedes the recall of previously learned information. The ability to recall previously learned information is greatly reduced if that information is not utilized, and there is substantial new information being presented. This often occurs when hearing recent news figures, then trying to remember earlier facts and figures.
Explanation:
Found it on a similar question
A biome is defined by four characteristics
Answer:
Biomes contain many ecosytems within the same area. Land-based biomes are called terrestrial biomes. Water-based biomes are called aquatic biomes. Temperatures, precipitation amounts and prevalent organisms characterized the biomes of the world.
Explanation:
If the original strand reads ATT-CCC-GCA what is the complementary strand?
Explanation:
Problem Set 4 Answers
1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)
b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d. The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
2. Below is a table for the genetic code:
T
C
A
G
T
TTT Phe (F)
TTC "
TTA Leu (L)
TTG "
TCT Ser (S)
TCC "
TCA "
TCG "
TAT Tyr (Y)
TAC "
TAA Stop
TAG Stop
TGT Cys (C)
TGC "
TGA Stop
TGG Trp (W)
C
CTT Leu (L)
CTC "
CTA "
CTG "
CCT Pro (P)
CCC "
CCA "
CCG "
CAT His (H)
CAC "
CAA Gln (Q)
CAG "
CGT Arg (R)
CGC "
CGA "
CGG "
A
ATT Ile (I)
ATC "
ATA "
ATG Met (M)
ACT Thr (T)
ACC "
ACA "
ACG "
AAT Asn (N)
AAC "
AAA Lys (K)
AAG "
AGT Ser (S)
AGC "
AGA Arg (R)
AGG "
G
GTT Val (V)
GTC "
GTA "
GTG "
GCT Ala (A)
GCC "
GCA "
GCG "
GAT Asp (D)
GAC "
GAA Glu (E)
GAG "
GGT Gly (G)
GGC "
GGA "
GGG "
a. The following codons can be mutated by one base to produce an amber codon:
CAG Gln
AAG Lys
GAG Glu
TCG Ser
TTG Leu
TGG Trp
TAA Stop
TAT Tyr
TAC Tyr
The complementary strand will read TAA-GGG-CGT since the A is complementary to T and C is to G nucleotide.
What are nucleotides?A biological molecule known as a nucleotide has the basic building blocks of a nitrogenous base, pentose sugar, and phosphate. As polynucleotides, DNA and RNA are composed of a chain of monomers with various nitrogenous bases. The execution of metabolic and physiological processes requires nucleotides.
Building blocks of nucleic acids, energy storage, carriers of activated metabolites for biosynthesis, structural moieties of coenzymes, and metabolic regulators are all roles that nucleotides play in the physiology of animals.
Adenine and thymine and guanine and cytosine are the proper bases to couple with in DNA. Therefore, the complementary strand will read TAA-GGG-CGT since the A is complementary to T and C is to G nucleotide.
Learn more about nucleotides, here;
https://brainly.com/question/28178584
#SPJ2
what processes do organisms use to release stored energy
my science teacher gave us this but i’m not sure how to do it
Do you believe that all of our actions can be attributed to the nervous system? Does your memory of an event trigger your responses? Why or why not?
Answer:
The nervous system is made up of all the nerve cells in your body. It is through the nervous system that we communicate with the outside world and, at the same time, many mechanisms inside our body are controlled. The nervous system takes in information through our senses, processes the information and triggers reactions, such as making your muscles move or causing you to feel pain. For example, if you touch a hot plate, you reflexively pull back your hand and your nerves simultaneously send pain signals to your brain. Metabolic processes are also controlled by the nervous system.
Explanation:
These pellets are not eliminated as _________________, but are regurgitated through the ___________________.
Answer:
These pellets are not eliminated as feces, but are regurgitated through the mouth. Pellets are not found exclusively within the owl families. There are many species of birds known to regurgitate pellets: hawks, eagles, kites, harriers, falcons, and even robins are some of the more familiar ones.
tell me if im wrong :/
How many membranes are does the nucleus have?
Explanation:
The nucleus contains all of the genetic material for a eukaryotic cell, but this genetic material needs to be protected. And it's protected by the nuclear membrane, which is a double membrane that encloses all the nuclear genetic material and all the other components of the nucleus
Answer:
it has 2
Explanation:
a.
What is the density of a sample of liquid that has a volume of 125mL and a mass of 200 g?
75 g/mL
c. 1.6 g/mL
b. 16 g/mL
d. 0.625 g/mL
Answer:
C. 1.6
Explanation:
The formula for density is mass/volume, so 200/125 is 1.6g/mL.
ATP is to your cells as ______ is to a car
Answer:
Gas to a car
Explanation:
The ATP function in the cell is equal to the gas or fuel function in the car, as the ATP gives energy to the cell for different functions like the fuel gives energy to the car to move from one place to another.
What is the function of the ATP?
ATP is produced in the cell from the food that living organisms, such as animals and plants, consume and use to produce ATP. There are different reactions that together make ATP, such as glycolysis, the Krebs cycle, and the electron transport chain, and with the help of ATP synthase, ATP is made. It performs a variety of cellular functions, including protein synthesis, food digestion, message transmission from one cell to another, and so on.
Hence, the ATP function in the cell is equal to the gas or fuel function in the car, as the ATP gives energy to the cell for different functions.
Learn more about the ATP here.
https://brainly.com/question/14637256
#SPJ6
Unlike other careers in neurology, all doctors of neurology who want to apply for work in the US must first go through
certification.
licensing.
training.
a background check.
The correct answer is B. Licensing.
Explanation
The Neurologist is a doctor who has specialized in the study of diseases and disorders that affect the nervous system. When a person in the United States wishes to practice as a neurologist, they must follow some steps. You must first prepare to enter medical school by studying an area related to medicine such as chemistry, physics, biology, among others, which conceptually prepares you for the next step. In the second step, you must apply to medical school, where you will be put to the test with the Medical College Admission Test (MCAT) to measure your knowledge on this subject. Once you enter medical school, there you will learn for two years everything related to the necessary concepts and theory about medicine and later you will have to serve as a medical apprentice in university hospitals where you will apply what you learned.
Third, once the doctor has obtained his title that accredits him as a doctor, he must obtain one of the medical licenses that USMLE (United States Medical Licensing Examination) or COMLEX (Comprehensive Osteopathic Medical Licensing Examination of the United States ) doctors must have in the United States. Finally, the doctor must serve for three years as a resident in a hospital focused on an area related to Neurology and one more year of internship. According to the above, the correct answer is B. Licensing.
PLZ HELP ASAP PLEASEE
True breeding plant round seeds (DD) were bred with true breeding smooth
seeds(dd) to produce F1 offspring. F1 offspring were then bred with other F1
offspring. What is the genotypic ratio of the resulting F2 offspring? What is the
phenotypic ratio of the resulting F2 offspring?
Answer:
Genotypic ratio F2 = 1:2:1
Phenotypic ratio F2 = 3:1
Explanation:
In this case, parental genotypes can produce only one type of gamete, i.e., one parent can produce only D gametes, while the other parent can produce only d gametes. Therefore, all F1 generation will be heterozygous (Aa). An F1 hybrid is the first filial generation of offspring obtained from crossing between different parent types. The F1 will produce two gametes (A; a) in a ratio 1:1, thereby the F2 obtained by crossing F1 offspring will have a phenotypic ratio of 3:1 (3 D_; 1 dd) and a genotypic ratio of 1:2:1 (1 AA; 2 Aa; 1 aa).
Jeffry was wondering why when he made breakfast, that after he was done cooking, the mass of everything he used was not the same. What best
describes why this is so, according to the law of conservation of mass.
A: cooking causes water vapor to escape so it cannot be added to the mass
B: cooking makes things solid and that adds to the mass
C: cooking changes the matter so it is different
D: cooking did nothing so he measured the mass wrong
Answer:
the answer is b guys
Explanation:
cooking makes things solid and that adds to the mass
mark brainliest!
How is energy cycled through a cell?
Answer:The cell needs glucose to have ATP and the cycle is cellular respiration. It turns glucose into energy by forming that ATP.
Explanation:
In the example, no RNA is made during the process. What would need to occur for lacZ to be expressed in mRNA
Answer:
In activity 1, lacZ was expressed under the lactose culture evidenced by 2c having the highest b-gal activity. There is a sign of activation in lactose culture since allolactose (inducer) which is an isomer of lactose, binds the repressor protein.
Explanation:
Answer: What my dude rays said trust me he is smart!!! :)
The chemical equation of cellular respiration contains information about?
a. the relative amount of products and reactants.
b. the formation of glucose.
c. the intermediate reactions needed to break down glucose.
d. the environment in which cellular respiration occurs.
The chemical equation of cellular respiration comprises information regarding the relative amounts of products and reactants.
• The process, which takes place within the mitochondria of all the organisms is termed cellular respiration. In this process, the simple sugars are dissociated into water and carbon dioxide and release energy in the form of ATP.
• A chemical reaction is a procedure in which one or more components, that is, the reactants get transformed into one or more different components called the products.
• The substances, which start the reaction are called reactants, while the ones that get produced in the reaction are called products.
• The association between the reactants and products in a chemical reaction can be signified with the help of a chemical equation.
Thus, the chemical reaction of cellular respiration comprises information regarding the relative amount of products and reactants.
To know more about:
https://brainly.com/question/425991
Sand blowing against a rock is an example of
erosion
physical weathering
chemical weathering
Answer:
physical weathering
Explanation:
1. One positive use of viruses is their function as a. infectious particles. c. cloning vectors. b. pandemic initiators. d. marine predators.
Answer: The correct option is C.
Cloning vectors.
Explanation:
Viruses are use as cloning vectors because they can give the new gene or birth the new gene by infecting the cell. They are so modified and orogrammed in such a way that they cannot cause disease when it is used in humans. Cloning vector is a DNA fragment gotten from viruses or bacteria plasmid which is maintained and used for cloning purposes.
The transfer of energy by electromagnetic waves is called
A. conduction.
B. convection.
C. radiation.
D. insulation.
Help Quick
Answer:
C.Radiation
Explanation:
Which two changes would increase the density of ocean water?
A. Increasing the amount of light that enters it
B. Decreasing its salinity
C. Increasing the amount of water that evaporates from it
I D. Decreasing its temperature
Answer:
The answer is simply D.
Explanation:
One factor that does affect density is the temperature. In general, most substances become less dense as temperature increases and more dense as temperature decreases.
The amount of water that evaporates from the ocean and the temperature are the two factors that influence its density. So options C and D are both true for this statement.
What is the effect of temperature on density?
The ocean water has more salts and minerals dissolved in it, so it is denser than normal fresh water. Some factors further decrease or increase the density of the ocean water. When the temperature drops, the water cools and ice forms. The ice is denser than the water, so it will sit below it.
As the temperature rises, the water evaporates, increasing salinity because more salts are present in the ocean water than in the water itself. The concentration of salt in the ocean determines the salinity of the ocean, and it can increase the density of ocean water when the concentration of salt is higher.
Hence, the amount of water that evaporates from the ocean and the temperature are the two factors that influence its density. So options c and d are both true for this statement.
Learn more about the density here
https://brainly.com/question/14697097
#SPJ2