Which gland is known as the "master gland" because it sends chemical messages to many other glands?

Answers

Answer 1

Answer: pituitary gland


Related Questions

Can someone answer this for me?

Answers

Answer:

Outside

Explanation:

The word outside makes the most sense in this sentence.

Hope it helps!

The Colorado River provides water and electricity for over 40 million people. But so much water is withdrawn from this river for agriculture/livestock and drinking water, that very little of it reaches the sea. Due to drought and overuse, it currently is drying up. This will be a major problem because crops and livestock in the USA depend on this water. What percent of the nation's crops and livestock rely on the river's water?​

Answers

Answer:

About 80%

Explanation:

I might be wrong but at least 80%

Explain how a scientist might use a karyotype to study genetic disorders.☜(゚ヮ゚☜)

Answers

Karyotype helps to study the presence and location of genes on chromosome. This also helps to find the mutations such as duplication or deletions.

Answer:

90% of people marry there 7th grade love. since u have read this, u will be told good news tonight. if u don't pass this on nine comments your worst week starts now this isn't fake. apparently if u copy and paste this on ten comments in the next ten minutes you will have the best day of your life tomorrow. you will either get kissed or asked out in the next 53 minutes someone will say i lov

90% of people marry there 7th grade love. since u have read this, u will be told good news tonight. if u don't pass this on nine comments your worst week starts now this isn't fake. apparently if u copy and paste this on ten comments in the next ten minutes you will have the best day of your life tomorrow. you will either get kissed or asked out in the next 53 minutes someone will say i love

90% of people marry there 7th grade love. since u have read this, u will be told good news tonight. if u don't pass this on nine comments your worst week starts now this isn't fake. apparently if u copy and paste this on ten comments in the next ten minutes you will have the best day of your life tomorrow. you will either get kissed or asked out in the next 53 minutes someone will say

90% of people marry there 7th grade love. since u have read this, u will be told good news tonight. if u don't pass this on nine comments your worst week starts now this isn't fake. apparently if u copy and paste this on ten comments in the next ten minutes you will have the best day of your life tomorrow. you will either get kissed or asked out in the next 53 minutes someone will say i love

90% of people marry there 7th grade love. since u have read this, u will be told good news tonight. if u don't pass this on nine comments your worst week starts now this isn't fake. apparently if u copy and paste this on ten comments in the next ten minutes you will have the best day of your life tomorrow. you will either get kissed or asked out in the next 53 minutes someone will say i love u

Explanation:

Which feature of chytrids makes them different from the other types of fungi? the material that strengthens their cell walls the special digestive material they release their use of budding to reproduce their ability to live in dry environments

Answers

Answer:

the material that strengthens their cell walls

Explanation:

Chytrids originate from the kingdom fungi and a division known as Chytridiomycota. They contain a feature of unique characteristics by the presence of the chitin and the cellulose cell wall. The chitin made up the component of their cell wall in fungi but in Chytrids, the cellulose helps to strengthens their cell walls.

Answer:

A. the material that strengthens their cell walls

Which statement best explains how the gases of the atmosphere affect the temperature of Earth?

Answers

The atmosphere today contains more greenhouse gas molecules, so more of the infrared energy emitted by the surface ends up being absorbed by the atmosphere. Since some of the extra energy from a warmer atmosphere radiates back down to the surface, Earth's surface temperature rises.

What is the universe made of

Answers

Answer:

composition

Explanation:

the universe is composed almost completely of dark energy, dark matter , and ordinary matter

Answer: matter , atoms

Explanation:

HELP NEED THIS BY TODAY!
What did Mendel study that lead him to his discovery

Answers

Answer:

A monk, Mendel discovered the basic principles of heredity through experiments in his monastery's garden. His experiments showed that the inheritance of certain traits in pea plants follows particular patterns, subsequently becoming the foundation of modern genetics and leading to the study of heredity.

Explanation:

Answer:

Mendel studied the genetics of pea plants.

Explanation:

Mendel looked at the pea plants in his monastery garden to determine genetics. He found that some plants had white flowers, while some did not, and he used that discovery to determine the genetics of the plants.

How do you think about the invention of the microscope? Influenced the cell theory?
And what are the components of the cell theory?

Answers

Answer:

See the answer below

Explanation:

The invention of the microscope paved way for the development of the cell theory because, without it, the cell and all the organelles of the cell would not have been discovered and or studied in great detail. It was through the use of  a microscope that Robert Hooke was able to observe and name the cell and it was through the same microscope that the fine details of the cell were able to be studied by other scientists, culminating in the formulation of the cell theory.

The cell theory states that all living organisms are made up of cells, the cell is the basic unit of all life, and cells can only arise from already existing cells (via cell division). The components of the cell theory, therefore, are:

Living organisms are made up of cells.The cell represents the basic unit of life.Cells can only arise from preexsiting cells.

A friend says that all bacteria are harmful to people list three reasons this statement is incorrect.

Answers

-autotrophic bacteria give off oxygen (O2)
-flavor foods such as vinegar, yogurt, cheese, etc. (pasteurization)
-decomposers (bacteria)- recycle nutrients in food web
-enviromental clean-up- bacteria eat oil from oil spills
0health and medicine- bacteria break down food in your intestines/make

1. DNA base sequence: GACGATGTAGCATCGACCATTG.
What would the mRNA sequence for this sequence of DNA be?

Answers

CUGCUACAUCGUAGCUGGUAAC

Government agencies regulate most aspects of agricultural safety.
True
False

Answers

Answer:

False

Explanation:

Process performed by plants (producers) using the sun's energy to make their own food.
A. Conduction
B. Photosynthesis
C. Fission
D. Fusion

Answers

Answer: B.Fotosintesis

Explanation:

Answer:

option B

Explanation:

photosynthesis is the correct answer.

plz mark my answer as brainlist plzzzz.

hope this will be helpful to you.

I AM LITERALLY CRYING RIGHT NOW PLEASEE HELPPP WILL MARK BRANLIEST HELPPP MEE

Part 1: Explore

Based on your research and observations of the three common states of matter, answer the

following questions.

Out of the videos, animations, and images you researched, which was your favorite? Why?

Do you feel it accurately represented the differences between each state of matter


How does the space between the particles in each state of matter differ?

How do the particles in each state of matter move?

Part 2: Explain

Examine the heating curve of water below, and then answer the questions about it. If you require the use of a text reader, open the file Heating Curve of Water to receive the information.


Which three parts of the graph’s curve represent the solid, liquid, and gaseous state of water?

Explain your reasoning.

Which point of the graph’s curve represents the melting point of water? Explain your reasoning.

Which point of the graph’s curve represents the boiling point of water? Explain your reasoning.

What happens to the energy of water in Part B and Part D of the graph’s curve? How do you know?

Why does the temperature of the water stay the same when it melts and boils?

Now comes the hands-on part of your project! You will continue to explore phase changes by performing an experiment and creating your own heating curve. Before you begin your experiment, read over the following information.


The materials you will need for your experiment are listed below.


small pot

measuring cup (must have mL and oz markings)

spoon (wooden, plastic, or metal)

ice

water

stove

thermometer (should have units in °C

Time (min) Temperature of Water (°C) Observations of Water

0

1

2

3

4

5

6

7

8

9

10

11

12

13

14

15

Place 14 oz of crushed ice into a small pot. Then add about 125 mL of water to it.

Using the thermometer, measure and record the initial temperature of the ice water. List this temperature in °C in the “0” minutes row of your data table in the lab handout. *Do not allow the thermometer to touch the bottom of the pot when recording measurements.

Place the pot on the stove, and turn the knob to the medium-low setting.

Using the thermometer, measure the temperature every minute until the water begins to boil vigorously. Record this data in the table on your lab handout.

At each measurement, also record what is happening to the water. Be sure to record the times of these events:

The ice melts.

The water forms steam.

The water begins to boil.

Once the water has begun to boil, stir the water constantly with the spoon.

Continue to measure and record the temperature every minute until almost all the water has boiled and the pot is close to empty.

Record the last temperature, and turn off the stove. DO NOT TOUCH THE POT WITHOUT SAFETY EQUIPMENT.

Create the x-axis and y-axis of a graph.

Label the x-axis as follows: Time (min).

Label the y-axis as follows: Temperature of Water (°C).

Along the x-axis, create and label 15 marks, one for each minute of the experiment. (Hint: The origin starts at 0.)

Along the y-axis, create and label temperature markings for every 20 degrees. (Hint: The origin starts at 0.)

Refer to the data from your experiment to plot the points on your graph. Then connect each of the data points with a line.

Look over your graph to make sure it is clear and correctly labeled.

Either save your graph as a computer file, or take a picture of your graph and upload it as a file on your computer.

Describe your experience in performing the experiment. What went well? What could have been

improved?

Examine your line graph. How does the graph’s slope change over time?

Examine your line graph. Why does the slope change?

How could you apply the knowledge gained from this experiment in the real world?

Hint: Think of cooking.

Make a prediction. How do you think adding other substances to the water would affect its

heating curve?

THANK YOU SO MUCH

Answers

Answer:

think of cooking

Explanation:

the reason is that I just know it

In the biosphere, _________________ is an important element in ATP (Adenosine triphosphate) and DNA (Deoxyribonucleic acid).

A. Phosphorus
B. Phosphate
C. Photosynthesis
D. Photons

Answers

C would be your answer

In the biosphere, phosphorus is an important element in ATP (Adenosine triphosphate) and DNA (Deoxyribonucleic Acid), which is in Option A, as phosphorus is a crucial element in the biosphere as it is a component of both ATP (Adenosine triphosphate) and DNA (Deoxyribonucleic Acid).

What is phosphorus?

Phosphorus is essential for the formation of the backbone of the DNA molecule, where it links the sugar and nitrogenous base components of the nucleotides. The phosphate group of each nucleotide forms a covalent bond with the sugar molecule of the adjacent nucleotide, forming a long, stable chain of nucleotides that make up the DNA molecule. The DNA molecule is responsible for transmitting genetic information from parent to offspring and serves as a blueprint for the development and function of living organisms.

Hence, in the biosphere, phosphorus is an important element in ATP (adenosine triphosphate) and DNA (deoxyribonucleic acid), which are in Option A.

Learn more about phosphorus here.

https://brainly.com/question/12767956

#SPJ2

If one DNA strand reads CCGTAATGCAT, what will be the sequence of the complimentary strand?

Answers

The complimentary strand would be GGCATTACGTA

help me out girlies its due

Answers

the stereotype is that all australians are some sort of zookeepers? and wear clothes like that. also that they drink beer a lot.

Answer:

the stereotype is that all australians are zookeepers? and wear clothes like that.

Explanation:

using the count data and observational data you acquired calculate the number of cfus in the original sample

Answers

Answer:

cuales son los datos ?

Explanation:

cuales son los datos

Name one adaptation that allows desert plants to survive with little water?

Answers

Answer:

stomata

Explanation:

This adaptation helps cacti reduce water loss by keeping the hot, dry wind from blowing directly across the stomata. The leaves and stems of many desert plants have a thick, waxy covering.

PLEASE HELP
Match the monomer to the polymer.
A.Amino acid B.glycogen
C. Nucleotide.
D.phospholipid Monosaccharide.
E.DNA
F.Fatty acids and glycerol.
G.protein collagen​

Answers

Nucleotide (DNA)

Amino acid (protein collagen​)

Monosaccharide (glycogen)

Fatty acids and glycerol (phospholipid)

How can a material at a certain temperature have all of its molecules at the same energy?

Answers

it can be frozen (32°F or 0°C) which would slow the energy of the molecules. or it could be boiled (212°F or 100°C) which would rapidly increase the speed of the molecules.

explain how the cells, tissue, and organs within the circulatory system work together to enable it to perform its function of pumping materials around the body and removing waste products such as carbon dioxide.

Answers

Answer:

the body has levels of organization that build on each other.Cells make up tissues,tissues make up organs,and organs make up organs system.

15 Which of the following mutations would have the potential to affect future
generations of a species?
A A frame shift mutation in the X chromosome of a cheek cell
B A chromosomal mutation in the Y chromosome of a kidney cell
CA point mutation in the first chromosome of a sperm cell
D A substitution mutation in the third chromosome of a uterus cell

Answers

Answer:

c i think

Explanation:

I don't know just trying to help hope you have a good day

The answer is c a point mutation in the first chromosome of a sperm cell

Construct an argumentative paragraph. Do you believe it's ethical or unethical to artificially select traits in plants and or animals? Provide evidenco to suoport your claims. It doesn't matter what side you chose, but I need it asap.​I will give you any mark you want.​

Answers

Answer:

The ethics of artificially inserting traits in animals has been in the practice for years in the form of selective breeding, but should scientists really be editing DNA to the extent they are today? I don't believe they should. Life itself should construct itself without us interfering. Making a brand new plant just because it looks nice doesn't account for many factors, including the fact that it could be harmful to nearby plants if pollinated. In addition, generic engineering costs quite a lot of money, which should be used on other more cost effective methods, such as improving agriculture rather than creating a whole new plant that could harm entire crops. Genetic engineering isn't a necessity and humans should not play God with plant and animal life.

Which of the following options best depicts the process of protein synthesis?

1. protein → RNA → DNA
2. DNA → amino acid → RNA → protein
3. DNA → RNA → protein
4. RNA → DNA → RNA → protein

Answers

During translation, the genetic code in mRNA is read and used to make a protein. These two processes are summed up by the central dogma of molecular biology: DNA → RNA → Protein.

PLEASE HELP ASAP Match each word with the phrase that best defines it.
informal
a statement that is objective or unchanging
fact
done in a way that is friendly or casual
formal
a statement that is subjective or based on
interpretation
topic
done in a way that is suitable, appropriate,
or based on guidelines
opinion
the main point of a given subject

Answers

Answer:

fact: a statement that is objective or unchanging

informal: done in a way that is friendly or casual

formal: done in a way that is suitable, appropriate,

or based on guidelines

opinion: a statement that is subjective or based on

interpretation

topic: the main point of a given subject

Match each word with the phrase that best defines it.

1. Fact: a statement that is objective or unchanging

2. Informal: done in a way that is friendly or casual

3. Formal: done in a way that is suitable, appropriate, or based on guidelines

4. Opinion: a statement that is subjective or based on interpretation

5. Topic: the main point of a given subject

What are Phrases?

A phrase is a group of words or a singular word which functions as a grammatical unit. For example, the English expression "the very happy boy" is a noun phrase containing the adjective phrase "very happy".

It can be a single word or a complete sentence. Phrases are used to describe the people, things, or events.

There are following types of phrases. They are:

Noun phrase.Adjective phrase.Adverb phrase.Verb phrase.Prepositional phrase.Gerund phraseInfinitive phraseParticipial phrase

Thus, matching the following words with its phrases

1. Fact: a statement that is objective or unchanging

2. Informal: done in a way that is friendly or casual

3. Formal: done in a way that is suitable, appropriate, or based on guidelines

4. Opinion: a statement that is subjective or based on interpretation

5. Topic: the main point of a given subject

Learn more about Phrases, here:

https://brainly.com/question/15806900

#SPJ2

How can you determine the number of bonds an atom can make

Answers

Answer:

The number of bonds for a neutral atom is equal to the number of electrons in the full valence shell (2 or 8 electrons) minus the number of valence electrons. This method works because each covalent bond that an atom forms adds another electron to an atoms valence shell without changing its charge.

Which statement explains the movement of energy through aerobic
cellular respiration? Choose the correct answer.
O Heat energy is absorbed as chemical potential energy is transferred from
oxygen molecules to ATP molecules.
O Heat energy is released as chemical potential energy is transferred from
oxygen molecules to ATP molecules.
O Heat energy is released as chemical potential energy is transferred from
glucose molecules to ATP molecules.

Answers

Answer:

Energy in the form of heat is released as chemical potential energy is transferred from glucose molecules to ATP molecules

The statement that best explains the movement of energy through aerobic cellular respiration is as follows:

Heat energy is released as chemical potential energy is transferred from glucose molecules to ATP molecules.

Thus, the correct option for this question is C.

What is Aerobic cellular respiration?

Aerobic cellular respiration may be defined as a type of biological process through which the molecules of glucose are broken down into carbon dioxide and water in the presence of oxygen with the liberation of some amount of energy. The derivation of energy is the fundamental mechanism of this process.

The mechanism initiate after capturing the heat energy from the and transforming it into chemical energy through the process of photosynthesis which synthesizes glucose. This glucose is then transferred to its potential energy to the ATP molecules in the presence of oxygen.

Therefore, heat energy is released as chemical potential energy is transferred from glucose molecules to ATP molecules. Thus, the correct option for this question is C.

To learn more about Cellular respiration, refer to the link:

https://brainly.com/question/2809259

#SPJ2

What would happen to the production of the high energy sugars if water or carbon dioxide were not
available to plants?
ATD

Answers

Answer:

There would be no production of high energy sugars in the plant.

Explanation:

Plants produce their food (autotrophism) in a process unique to them called PHOTOSYNTHESIS. Photosynthesis is the process whereby plants produce energy-storing sugars (glucose) in the presence of light from sun.

This photosynthetic process combines Carbon dioxide (CO2) and water (H2O) as reactants to form sugar (C6H12O6) and oxygen (O2) as products. The equation for photosynthesis is as follows:

6CO2 + 6H2O → C6H12O6 + 6O2

This means that water and carbon dioxide are strictly needed for the process of photosynthesis to occur in plants. Hence, if water or carbon dioxide were not available to plants, there would be no photosynthetic process and ultimately no production of high energy sugars.

Explain why it is very important for the gametes to divide by meiosis. What could happen if the gametes accidentally divide by mitosis? can someone answer in a sentence!!

Answers

Meiosis is important because it ensures that all organisms produced via sexual reproduction contain the correct number of chromosomes. Meiosis also produces genetic variation by way of the process of recombination.

Explanation: Gametes are made via meiosis which produces cells with n=23 instead of diploid cells. If gametes were produced instead by mitosis each gamete would be diploid not haploid.

I hit a substance with a hammer and it shatters.It is a

Answers

Answer:

non metal ,so it is brittle in nature

Other Questions
Which statement correctly describes a parliamentary democracy?A.A democracy in which the executive creates and enforces laws.B.A democracy in which the executive creates laws and the legislature enforces the laws.C.A democracy in which the legislature creates and enforces laws.D.A democracy in which the legislature creates laws and the executive enforces the laws. Complementary angles Find the value of x in each right angle.I cannot get this wrong solve the first equation for x.X+ 5y = 0 20y = -4x 1. Which of the following would be a reason that Asia contains 60% of the world's population? The climate is mild in all parts of Asia, so people can live all over the continent. Many people love high altitudes, so the largest part of the population live on the mountain tops. Asia has a variety of natural resources, forests and rivers, use hydroelectric power, and import other things they need60 POINTS Which statement BEST supports the practice of creating majority-minority districts? a. It makes it more likely that Democrats will get elected. .b. It was commonly used during the late 20th century.c. It creates districts that may have a loose geographical connection.d. It helps minority groups receive political representation.e. It was found constitutional according to the Supreme Court. HELP ASAP PLS IF U ANSWER U GET 40 POINTS THANKS Which sentences have verbs and subjects that agree? Check all that apply. h(x) = x^3 - 2xg(x) = 3x + 4 Find (h+g)(4) Learning Task 2: Fill in the blanks. Write your answers on a separateBreeding groundmarineAquaticroots of the seacoastalIf there are no mangrove forests, then the sea will have no meaning.It is having a tree with no roots, for the mangroves are theMangrove swampswamp are found along the 2. area They areimportant to 3.life. They are serve as 4.ground for fishesand marine organism. They protect the 5.__from erosion and effects ofstorms.science po yan Which of the following is not an organ in the nervous system? Which student correctly wrote the algebraic expression for the following statement?the quotient of a number and sevenAdrians workquotient represents divisionStartFraction 7 over n EndFractionHaileys workquotient represents divisionStartFraction n Over 7 EndFractionCamilas workquotient represents multiplication7 nJuans workquotient represents subtraction7 minus n pls say A, B, C , or D thanks and pls hurry I would like to be a teacher. Right now we have the ability for genetic modification (plants, animals, diseases, or humans). Discuss a positive or a negative use and whether you agree or disagree with it. what does redundant mean 1.000016solution pls pls help me How could student loan debt keep you from enjoying your plans and dreams? A) 274 m2B) 302 m2C) 344 m2D) 420 m2 is 14/18 greater then, less then, or equal to 7/9 What element of photography is the most similar to Shape? What are the differences between the two? how is the law of mendelian inheritance violated in down's syndrome