Which cycle causes an algae bloom, which leads to eutrophication?

Sulfur

Phosphorus

Both

Answers

Answer 1
Both because together they cause an algae bloom

Related Questions

HELP!!!!15 POINTS!!!!!!

i think it's f but idk..

Answers

Answer:

F is good

Explanation:

F is a very good choice

What is a society that is able to survive and function over a specified time?​

Answers

Answer:because time and society are different

Explanation:

17. Match the major types of cancer with the types of cells they occur in
Adenocarcinomas
a. The lowest layer of the epidermis (skin)
Basal cell carcinoma
b. upper layers of skin, the lining of stomach, lungs,
kidneys
Squamous cell carcinoma
c. melanin-producing cells of the skin
Sarcoma
d. immune cells in the blood (T cells, B cells, and
bone marrow)
Leukemia and lymphoma
e. bones, fat, blood vessels, tendons, ligaments
Multiple myeloma
1. cells that produce fluids (breast, colon)
Melanoma
g. plasma cells (a type of immune cells)​

Answers

LolsbdgsbcgcsnnsjzkmcjMCk

Which statement best describes homeostasis in a cell?

A. Molecules are in equilibrium (balance) inside and outside the cell

B. Active transport causes molecules to move from low to high concentration the molecules are un-equal

C. Pathogens enter cells and infect those cells, causing them to malfunction

D. Cells do not maintain homeostasis with their external environments.

Answers

Answer:

I believe the answer is A. The cell is in an equilibrium inside and out when it goes through homeostasis.

Explanation:

Which of the following problems are environmental indicators of acid deposition?


Decreased pH levels in lakes and rivers
Decreased concentration of aluminum in the soil
Changes in development of indicator organisms of an ecosystem
II only
III only
I and III
I and II

Answers

Answer:

I and III

Explanation:

Acid deposition will decrease pH levels in lakes and rivers since it contaminates them and lowers their pH, and organisms may be affected by the increased acidity in their immediate surroundings, but aluminum has nothing to do with pH levels at all.

Hope thish elped!

Option I and III shows the problems of environmental indicators of acid deposition.

The following information should be considered:

The acid deposition should reduce the level of pH in terms of lakes and rivers as it contaminates also the organisms should impact when the acidity should be increased for the surroundings. But the aluminum does not have any relationship with pH levels.

Therefore we can conclude that options I and III are correct.

Learn more: brainly.com/question/13107711

the other liquid waste product in cellular respiration is

Answers

Answer: During the process of cellular respiration, carbon dioxide is given off as a waste product. This carbon dioxide can be used by photosynthesizing cells to form new carbohydrates. Also in the process of cellular respiration, oxygen gas is required to serve as an acceptor of electrons.

Explanation: Hope dis helps :)))))  

Answer:

the waste products are carbon dioxide and water

An earthquake occurred three hundred miles off the shoreline, and massive flooding occurred on land as a result.
Which best describes what occurred?
- Continental shifting resulted in a tsunami.
- Continental shifting resulted in a volcano erupting.
- Tidal activity in the subduction zone caused a tsunami.
- Tidal activity in the subduction zone caused a volcano to erupt.

Answers

Answer:

An earthquake occurred three hundred miles off the shoreline, and massive flooding occurred on land as a result. Which best describes what occurred? Continental shifting resulted in a tsunami.

Explanation:

The best thing that describes the scenario that occurred is tidal activity in the subduction zone caused a tsunami. The correct option is C.

What is tsunami?

The violent breaking of rock during an earthquake releases energy that travels through the earth in the form of resonance known as seismic waves.

These seismic waves radiate from the hypocenter in all directions, becoming weaker as they travel further away from the hypocenter.

Tsunamis are a series of large waves with extremely long wavelengths and periods that are usually caused by a violent, impulsive undersea disturbance or activity near the coast or in the ocean.

When a large earthquake ruptures, the faulting can cause vertical slip large enough to disturb the overlying ocean, causing a tsunami to travel in all directions.

Thus, the correct option is C.

For more details regarding tsunami, visit:

https://brainly.com/question/14782736

#SPJ6

Which statement is the best example of an object and motion that would make it hard for people to accept Newton’s first law?


A. A rolling ball eventually slows down and comes to a stop.

B. A box does not move when pushed equally from opposite sides.

C. The heavier the load in a cart, the harder the cart is to turn.

D. A wago

Answers

Answer:

a

Explanation:

object in motion will stay in motion until it is acted upon

Answer:

A

Explanation:

Which of the following is not a technological way of improving air quality?
a.
using electrostatic precipitators
b.
installing solar panels
c.
composting
d.
building wind turbines

Answers

Answer:

c.

composting

Explanation:

Composting is not a technological way of improving air quality (Option C).

What is air quality?

Air quality refers to the absence of pollutant substances (e.g. monoxide carbon) in the air.

Air quality is fundamental for maintaining overall health and increasing the quality of life.

Air quality can be measured by using different devices or indicators (for example, by measuring the amount of carbon monoxide and nitrogen oxides).

In conclusion, composting is not a technological way of improving air quality (Option C).

Learn more about air quality here:

https://brainly.com/question/1211889

Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide
chain, identifying the codons, anticodons, and amino acid sequence.
DNA: CGATACAATGGACCCGGTATGCGATATCC

Answers

I don’t feel like answering all that but....
C=G G=C T=A A=U
C=G A=T dont know the rest have a gcodocododd dday

People are more likely to seek treatment if they
A. are in a minority
B. live in a rural community
C. have medical insurance
D. have a diagnosis

Answers

Answer:

C. have medical insurance

Explanation:

People are more likely to seek treatment if they D. have a diagnosis as it helps in the treatment of disease.

The clinical diagnosis lets in a clinical expert chart a listing of clinical signs after which evaluate them to different data. A high-quality fitness final result is primarily based totally one scale of being alive and not using a long-time period results to death.

What is the diagnosis?

The act of spotting a disorder from its symptoms and symptoms and signs the realization this is reached following and trying out .The prognosis turned into pneumonia.

Thus it is well explained.

To learn more about the medical insurance refer to link :

https://brainly.com/question/1941778

HELP! I NEED IT SOON! ILL GIVE BRAINLIEST

Answers

Answer: A: People with different goals can make contributions to scientific knowledge.

Schwann and Virchow both had different goals for what they were trying to discover, but both ended up adding to the same theory.

Hope this helps :)

To achieve which of the following goals would rotational grazing be most appropriate? (3 points)
-To maximize livestock populations while minimizing costs
-To preserve vegetation and soil fertility of land
-To involve townspeople in the operations of a nearby farm
-To transform an abandoned city lot into a neighborhood garden

Answers

Answer:

To preserve vegetation and soil fertility of land

Explanation:

.

A person with a low number of white blood cells could have difficulty in fighting infections and A decrease in the number of lymphoid stem cells could result in a decrease in red blood cell.

What is nucleotide?

It is the sub units and buIlding blocks of DNA. It is made up of a five-sided sugar, phosphate group and then a nitrogen base.

These groups make the backbone of the DNA helix. If you look at a DNA helix, they make the side of the ladder or the side portion. They connect to a nitrogen base which make the steps of the ladder.  The type of sugar that is used in a DNA helix is called deoxyribose.

Nitrogen bases are the molecules that make up the steps of the ladders. There are four different nitrogen bases, namely; Guanine, Thymine,Adenine and Cytosine.

Pyrimidines are compounds that make a single 6-sided ring. Examples of pyrimidines are Cytosine and Thymine. Purines on the other hand make 5-sided and 6-sided rings.

Therefore, A person with a low number of white blood cells could have difficulty in fighting infections and A decrease in the number of lymphoid stem cells could result in a decrease in red blood cell.

Learn more about white blood cells on:

https://brainly.com/question/19202269

#SPJ5

explain how darwin's journey to the galapagos islands contributed to his creation of the theory of evolutions.

Answers

Explanation:

During his visit to the islands, Darwin noted that the unique creatures were similar from island to island, but perfectly adapted to their environments which led him to ponder the origin of the islands' inhabitants.

Among those that struck Darwin so greatly were the finches that are now named in his honor. Darwin would later base some of his thought from the supposing that these finches were all descendents of the same lineage.

What is an advantage to SMRs?
Select all that apply.


less atmospheric emissions


use fusion instead of fission

reduced cost


reduced construction time

Answers

Answer:

PLEASE MARK ME THE BRANIEST THANK YOU :)

Explanation:

The next decades are crucially important to putting the world on a path of reduced greenhouse gas emissions.

By the end of the century, demand for energy will have tripled under the combined pressure of population growth, increased urbanization and expanding access to electricity in developing countries. The fossil fuels that shaped 19th and 20th century civilization can only be relied on at the cost of greenhouse gases and pollution.

A new large-scale, sustainable and carbon-free form of energy is urgently needed. The following advantages make fusion worth pursuing.

Abundant energy: Fusing atoms together in a controlled way releases nearly four million times more energy than a chemical reaction such as the burning of coal, oil or gas and four times as much as nuclear fission reactions (at equal mass). Fusion has the potential to provide the kind of baseload energy needed to provide electricity to our cities and our industries.

Sustainability: Fusion fuels are widely available and nearly inexhaustible. Deuterium can be distilled from all forms of water, while tritium will be produced during the fusion reaction as fusion neutrons interact with lithium. (Terrestrial reserves of lithium would permit the operation of fusion power plants for more than 1,000 years, while sea-based reserves of lithium would fulfil needs for millions of years.)

No CO₂: Fusion doesn't emit harmful toxins like carbon dioxide or other greenhouse gases into the atmosphere. Its major by-product is helium: an inert, non-toxic gas.

No long-lived radioactive waste: Nuclear fusion reactors produce no high activity, long-lived nuclear waste. The activation of components in a fusion reactor is low enough for the materials to be recycled or reused within 100 years.

Limited risk of proliferation: Fusion doesn't employ fissile materials like uranium and plutonium. (Radioactive tritium is neither a fissile nor a fissionable material.) There are no enriched materials in a fusion reactor like ITER that could be exploited to make nuclear weapons.

I HOPE YOU LIKE MY ANSWER THANK YOU:)

has anyone done this worksheet? i need help with it. thanks:)

Answers

I have done it I think
try scanning it with the google app with text and usually answer keys pop up good luck!

Chemicals and proteins in the cell read the DNA ___________ for building that make cells, tissue and organs.
(A.Instructions
(B.Genes
(C.Recipe
(D. Life manual

Answers

You answer will be B!! Good luckkk!

Genes of DNA can be read by chemicals and proteins for building that can make cells, tissue, and organs. Therefore, option "B" is correct.

What are genes?

Genes are composed of  DNA which is the genetic material. Gene is the functional unit of heredity. Chromosomes are comprised of multiple genes. Genes code for a particular trait. More than one gene can code for a particular trait.

The function of DNA and RNA is controlled by genes. There are more than 3000 genes present. Mutation can occur in genes. Deletion and insertion are some types of mutation genes. Transposomes are called jumping genes. Sickle cell anemia and cystic fibrosis are some examples of gene mutations.

Genes code for the traits such as the color of eyes, height quality of hair, and more.

Learn more about genes, here:

https://brainly.com/question/31121266

#SPJ2

PLEASE HELP
the question is in the pic

Answers

the answer is genetic variation because crossing over leads to changing the traits inherited by the daughter cells

what is the complementary dna strand of C-C-T-A-G-C-T

Answers

Answer:

G-G-A-T-C-G-A

Explanation:

The A-T pairs are connected by two hydrogen bonds, while the G-C pairs are connected by three hydrogen bonds.

How do scientists plan to use copy number variants and identical twins to determine the roots of diseases? In your response, use the words: gene

Answers

Identical genes have the same genetic material and the same genes. So if they both have a disease it's likely that it's genetic.

Scientists plan to use copy number variants (CNVs) and identical twins to determine the genetic differences between them and the cause of genetic disease as CNVs are variations in the copies of a gene in an individual's genome.

What is the significance of copy number variants?

Scientists use copy number variants (CNVs) to study the genetic diseases in twins and CNVs are variations in the copies of a gene in an individual's genome, but in identical twins, they have the same genetic makeup. By analyzing the CNVs in twins, scientists can identify the genes that may be involved in the disease and how they contribute to its development.

Hence, scientists plan to use copy number variants (CNVs) and identical twins to determine the genetic differences between them and the cause of genetic disease as CNVs are variations in the copies of a gene in an individual's genome.

Learn more about the copy number variants here.

https://brainly.com/question/29844397

#SPJ2

- Lee el siguiente párrafo y a continuación responde lo que se te pide.Los seres humanos primitivos comenzaron a clasificar las plantas y los animales tanto por su utilidad como por el daño que les causaban, luego fueron profundizando aún más en sus conocimientos sobre la flora y la fauna de su entorno, identificando los ciclos biológicos y hábitat, entre otros aspectos que facilitaron su producción y pronta disponibilidad. Con base en el párrafo anterior se puede afirmar que: * 1 punto A) Empezaron a entablar una relación más estrecha con el medio ambiente. B) Abandonaron su vida primitiva y nómada C) Incrementaron sus conocimientos únicamente sobre el ciclo del agua. D) Empezaron la agricultura y la piscicultura.

Answers

Answer:

A) Empezaron a entablar una relación más estrecha con el medio ambiente.

Explanation:

Desde el pasaje, podemos ver que la gente comenzó a prestar más atención a su entorno y cómo la fauna y la flora afectan la vida humana.

Incluso intentaron desarrollar un sistema burdo de clasificación biológica. Henec, se puede inferir que las personas desarrollaron una relación más cercana con su entorno.

Its easy! If right will give brainlist! Don't overthink..:) Just answer

The virtual image changes with the position of the mirror to the eye when the mirror is..............?
Fill in the blanks

Answers

Answer:

When the mirror is inside the focal point..?

Most abundant element in the biomolecules studied (fats, proteins, carbohydrates, nucleic acids) was....
carbon
Monosaccharide
Amino acid

Answers

amino

acid

Explanation:

thats amino acid

amino acid ............

Ribosomes are the site where
protiens
are produced.
Amino acids are coded for by triplet bases in RNA called
condon
.

Answers

Answer:

That's true

Explanation:

But remember. What is produced actually is not a protein. It is a petide chain which is the first structure of protein.

When the peptide chain reaches its fourth structure ،it csn have its function in body.

Thats a complete protein.

Hope it helps.

BRAINLIEST:
in which month is a hurricane most likely to occur: October or December? explain

Answers

Answer:

October

Explanation:

October is one of the hurricane season months

Small aquatic organisms, such as coral, are the producers of the ocean.
Please select the best answer from the choices provided true or false

Answers

Answer:

true

Explanation:

on edg

Small aquatic organisms, such as coral, are the producers of the ocean. Thus, the given statement is true.

What is aquatic organism?

The term aquatic organism has been defined as the the organism lives in the water is known as the aquatic organism. The corals are essential part of the marine ecosystems. They are feeding upon zooplankton, but also their polyps get sugar that is produced by the algae living on them. Also, the corals provide much needed shelter for lots of marine animals, but also are on the menu of some, like the starfish for example.

Limestone is in form of sedimentary rock that is made up of skeletal fragments of marine organisms such as forams, corals and molluscs. However, limestone is formed from the shell of an organisms because the shell is made up of calcite or aragonite.

Due to the presence of nutrients that swipe from ocean to the shores along with tides which makes predators to be present along the shores which ultimately pose a threat to coastal aquatic organisms.

Therefore, Small aquatic organisms, such as coral, are the producers of the ocean. Thus, the given statement is true.

Learn more about  aquatic organisms on:

https://brainly.com/question/1397242

#SPJ6

In the United States, most racial discrimination comes in the form of ________ discrimination.

A. Direct
B. overt
C. indirect
D. extra​

Answers

Answer:

C, indirect because most people do not admit that they are racist and claim that they didn't do things because they're racist.

Explanation:

In the United States, most racial discrimination comes in the form of indirect discrimination. Therefore, option C is the correct option.

What is indirect discrimination?

Indirect discrimination involves the policies or practices that appear neutral on the surface, but deep down have adverse effects on the people belonging to a particular race.

Indirect discrimination can be seen in various areas, such as employment. During a job vacancy, the job applicant requires to speak a high level of proficient English which appears to be a reasonable requirement for the job, but it can lead to a significant impact on non-native English speakers.

Indirect discrimination can be seen in the education field where schools give admissions to only those students who will qualify for a specific education test which may seem unfair to students belonging to a specific race, and having different educational backgrounds.

Therefore, indirect discrimination is the most common form of discrimination observed in the United States.

Learn more about indirect discrimination here:

https://brainly.com/question/14710203

#SPJ7

Baby Brain Power
How does the bar graph on page 5 expand on
information presented in the passage?
It shows exactly how many synapses a person's
brain has at birth
Speech, emotional regulation, movement, and
vision-all of these extraordinary abilities and
many more are possible thanks to the organ
that serves as the body's control center. When
one thinks of "brain power, it is the faces of
adult inventors, professors, and novelists that
Ekely come to mind. Remarkably the most
critical time period with respect to brain
development occurs relatively soon after an
individual is bom.
A newborn enters the world as a fairly helpless
creature, but her brain hos billions upon
bitions of specialized cells coiled neurons.
It gives more information than the passage by
showing that the number of synapses returns to
what it was at birth.
It provides specific information about how many
synaptic connections are formed in each year of a
person's life.
It gives information about synaptic connections
beyond the time period described in the passage.
2
3
4
5

Answers

Answer:

C

Explanation:

Took it

PLSSSSS HELP ILL GIVE U A BRANLIEST

Answers

Answer:

C

Explanation:

the anser is c plz mark me

Answer:

I would say its D

Explanation:

34. Education, Fuel, Food and Clean water are all listed as important factors in limiting….
a. Human Development index
b. Gross Domestic Product
c. Infant Mortality
d. Carrying Capacity

Answers

Answer:

A. Human Development index

Explanation:

The Human Development Index is a statistic composite index of life expectancy, education, and per capita income indicators, which are used to rank countries into four tiers of human development.

hope i helped

its not gdp nor infant mortality nor carrying capacity

and much more

Answer: the answer is A

Explanation:

Other Questions
helpppppp me plssssuh What happened in the constitutional convention? _____ is a guidline to help an individual write and achieve well-specified goals.A. The decision-making modelB. An action planC. A goalD. The stages of change I need help with this question pleaseeee Your ability to navigate home without using a GPS or map is due to the development of __________________. Which model is a concordance model?A. the big bang theoryB. the dark energy modelC. the steady state modelD. the Lambda-CDM model f(x)=x^2+2x-1 find f(-3) Find the width of the Brady river. Who usually creates prints using specialized techniques and transfers images onto cloth, paper, or glass?___usually create prints using specialized techniques and transfers images onto cloth, paper, or glass. find the height of the triangle in which A=192 cm^2 I'm not sure if these are correct. please help me, i dont know how to do this:) How did the Republic of Texas guarantee freedom and rights of its citizens? Select the correct answer. PLEASE HELP!Read the passage. Which sentence best describes Beth?A. Beth enjoys helping poor people.B.Beth is skilled at treating sick people.C. Beth is more dutiful than her sisters.D. Beth is kind, but her sisters are cruel.by Louisa May Alcott (excerpt)"Meg, I wish you'd go and see the Hummels. You know Mother told us not to forget them," said Beth, ten days after Mrs. March's departure."I'm too tired to go this afternoon," replied Meg, rocking comfortably as she sewed."Can't you, Jo?" asked Beth."Why don't you go yourself?" asked Meg."I have been every day, but the baby is sick, and I don't know what to do for it. Mrs. Hummel goes away to work, and Lottchen takes care of it. But it gets sicker and sicker, and I think you or Hannah ought to go."Beth spoke earnestly, and Meg promised she would go tomorrow."Ask Hannah for some nice little mess, and take it round, Beth, the air will do you good," said Jo, adding apologetically, "I'd go but I want to finish my writing.""My head aches and I'm tired, so I thought maybe some of you would go," said Beth."Amy will be in presently, and she will run down for us," suggested Meg.So Beth lay down on the sofa, the others returned to their work, and the Hummels were forgotten. An hour passed. Amy did not come, Meg went to her room to try on a new dress, Jo was absorbed in her story, and Hannah was sound asleep before the kitchen fire, when Beth quietly put on her hood, filled her basket with odds and ends for the poor children, and went out into the chilly air with a heavy head and a grieved look in her patient eyes. PLEASE HURRY !!! i need help with 1.. If your friend has been drinking and doesn't have the money for a cab fare,...A. that's his problem - he should have planned better.O B. don't worry about it - he'll find another option.OC. pay for the fare in advance - to save him embarrassment. Read the following plot summary. Then, answer the question that follows.On the steamer headed for Virginia, Cecily was surrounded by her fellow Englishmen, and the new step she was taking didn't seem so frightening, but when the ship pulled into the harbor and the passengers disembarked, she began to doubt her sanity. In 1820, young ladies did not start "from scratch" in a new country without friends or family to shelter or support them, but Cecily's brother was here in this massive, unsettled country, and she was determined to find him. Working as a seamstress for wagon trains heading westward, she moved slowly across the nation, showing her engraving of Benjamin's face to anyone she met. After reaching the Rocky Mountains, she learned that a young Englishman was sick with cholera, and she quickly located her very sick brother. Nursing him through the worst of the disease, she eventually strengthened him enough to travel. They joined a new wagon train and made it to the Oregon country, where Benjamin purchased a section of land, and he and Cecily began the hard work of creating a new home together.Which of the following correspondents would be a logical choice for a character letter from Cecily?A BenjaminB the ship's captainC Aunt Lucy in Shropshire, EnglandD a landowner in the Oregon countryBRAINLESS IF RIGHT Some viruses attack cells by inserting their own DNA into the host cells DNA. Why might it be simpler for these viruses to attack prokaryotic cells than eukaryotic cells? A. Prokaryotic cells have less DNA than do eukaryotic cells.B. The rapid growth of prokaryotic cells generates more viruses.C. Unlike eukaryotic cells, prokaryotic cells do not have a nucleus.D. The cell wall in prokaryotic cells is a less effective barrier. how has Isreals lack of oil affected that countrys economy? A 5-column table with 6 rows titled Number of cans collected. Column 1 has entries 7, 8, 10, 11, 11, 14. Column 2 has entries 16, 17, 18, 18, 24, 25. Column 3 has entries 28, 29, 30, 30, 35, 37. Column 4 has entries 38, 40, 40, 41, 41, 41. Column 5 has entries 42, 42, 42, 42, 42, 43.Students from Grover Middle School are recycling aluminum cans. The table shows the total number of cans brought in each school day for a period of six weeks. They collected a total of 862 cans. Use the drop-down menus to define the terms.Mean: Median: Mode: Range: