which countries were involved in world war 2

Answers

Answer 1

Answer:

Axis Powers & Allies

Explanation:

Axis Powers:

Germany, Italy, Japan

Allies:

France, Great Britain, US, Soviet Union, China (lesser extent)

Answer 2

Answer:

Axis powers—Germany, Italy, and Japan—and the Allies—France, Great Britain, the United States, the Soviet Union, and, to a lesser extent, China.

Explanation:


Related Questions

European competition for colonies, resources, and world markets through the use of militarism was one of the causes of __________.
A.
the Russian Revolution
B.
the Cold War
C.
World War I
D.
World War I

Answers

Answer:

C or D World War 1. (Pick whichever option says World War One)

Explanation:

As these European powers such as Britian, France, Germany, Austria-Hungary, and Russia were industrializing due to the coming of a modern age (20th Century). Resources had become the primary target of vast colonial empires. Strategic territories as well such as British occupied Eygpt or India had multiple advantages over other countries through the African and Asian markets. Germany in comparison had a little number of colonies in Africa and South-East Asia. Competition like this would favor a World War to gain an advantage over rival empires.

who was deborah and why was she imporant

Answers

Answer:

Deborah was a prophetess of God, and the only female judge mentioned in the Bible. She was important because inspired the Israelites to a victory.

Explanation:

For a company picnic, Todd fills 30 paper cups with ketchup and Yuki fills 27 paper cups with ketchup. Each paper cup holds 1 ounce. Later, Todd and Yuki learn that two other company employees completed exactly the same task

Write a numerical expression to find how many ounces of ketchup the four employees prepared.

Answers

Answer:

(30 + 27)2

Explanation:

i think

2 (30+27) is a numerical expression to find how many ounces of ketchup the four employees prepared.

What is numerical expression?

A mathematical statement that solely uses numbers and one or more operation symbols is known as a numerical expression. The terms addition, subtraction, multiplication, and division are all examples of operation symbols. The square root sign or the absolute value symbol can also be used to represent it.

Todd fills 30 paper cups with ketchup, and yuko will 27 paper cups with ketchup.    

Each paper cup holds 1 ounces.

Todd = 30*1 = 30 ounces

Yuki = 27*1 = 27 ounce

Total ounces = 30+27

Later, todd and yuki to learn that to other company employs completed exactly the same task.

= 2(30+27)

Thus, 2 (30+27) .

For more information about numerical expression, click here:

https://brainly.com/question/29778337

#SPJ2

ILL GIVE BRAINLY THING

What was the result of the French and Indian War?

1) France began moving west

2) France lost land claims in North America and Britain gained Canada and most French lands east of the Mississippi.

3) Land east of the Mississippi was divided equally between France and Britain.

4) Spain gained Canada and Britain gained New Orleans.

Answers

Answer:

2)

Explanation:

They were fighting for claims in North America and since France lost, Britain made them give up most of their claims in North America.

I need to know if this is right!!

Answers

Answer:

nope

Explanation:

I think is A because each section has different colors which means something

I NEED HELP ASAP!!!!!!!!!!!

How did the outcome of the war impact navtice Americans

Answers

Answer:

The British took retribution against Native American nations that fought on the side of the French by cutting off their supplies and then forcibly compelling the tribes to obey the rules of the new mother country. No matter which side they fought on, Native Americans were negatively impacted. They were left out of peace talks and lost additional land. In truth, the war did more harm then good to them.

Explanation:

Which must have the characteristics of being a nonprofit organization, and be independent of any political or governmental influence?

UN
NGO
USAID
HIV/AIDS

I think B but i dont know

Answers

There are different kinds of organizations. NGO is one that have the characteristics of being a nonprofit organization, and be independent of any political or governmental influence.

What are the characteristics of non-governmental Organisation?

The NGO is known to have activities such as the ones that not limited to, environmental, social, etc.

They often work so as to boast social or political change on a wider perspective.

NGOs play a vital part in development of any society, as they help in improving communities, and boasting citizen participation.

Learn more about  NGOs from

https://brainly.com/question/10891518

Answer: the anserw is a

Explanation :must have the characteristics of being a nonprofit organization, and be independent of any political

Describe the Indigenous peoples who lived in North and South America prior to the arrival of the Europeans.

Answers

Answer:

Their settlements and social groups were impermanent, and communal leadership (what little there was) was informal. After European contact, some Great Basin groups got horses and formed equestrian hunting and raiding bands that were similar to the ones we associate with the Great Plains natives.

Explanation:

Which of these was NOT a problem during the interwar period?
Cccvvvvvv

Answers

Answer:

the interwar period was the period between the end of the First World War on 11 November 1918 and the beginning of the Second World War on 1 September 1939.

Explanation:

the period represented an era of significant changes worldwide. Petroleum-based energy production and associated mechanisation expanded dramatically leading to the Roaring Twenties, a period of economic prosperity and growth for the middle class in North America, Europe, Asia and many other parts of the world. Automobiles, electric lighting, radio broadcasts and more became common among populations in the developed world.

these are good things that came out of that period?

A student learning about Texas history is instructed to write a paper about American Indians in Texas. Which of the following facts would be most relevant to the student's assignment?

The Europeans saw the American Indians as superior and had great respect for the cultures.
The Europeans saw the American Indians as superior and had great respect for the cultures.

Geographic factors of Texas determined whether American Indians were nomadic or sedentary.
Geographic factors of Texas determined whether American Indians were nomadic or sedentary.

American Indians adopted the idea of "owning land" from Spanish conquistadores.
American Indians adopted the idea of "owning land" from Spanish conquistadores.

Treaties were always successful in creating peace and determining boundaries between Anglos and American Indians.
Treaties were always successful in creating peace and determining boundaries between Anglos and American Indians.

Answers

Answer:

D

Explanation:

A. over on thousand year after
B. at the same time
C. 500 year after
D. 500 years before

Answers

It would be B.) at the same time.

Answer: B

Explanation:

What was Father Eusebio Kino’s major accomplishment?

A.) He convinced Spaniards of the need to adopt the agricultural skills of the American Indians.
B.) He established more than 20 missions, where he lived and worked with American Indians.
C.) He led an American Indian rebellion against a Spanish mission.
D.) He led a Spanish military campaign that drove American Indians from the Southwest.

Answers

I’m pretty sure it’s B) :)

Answer:

B.) He established more than 20 missions, where he lived and worked with American Indians.

Explanation:

Which territories did the United States gain as part of the hegouatus:

Answers

Answer:

By the turn of the 20th century, America was digging a canal shortcut between the ... But the U.S. spent around 2¢/acre for an area roughly 1/3rd the size of the ... was an excellent pretext to acquire all of Spain's territories in the Caribbean and ...

Explanation:

GIVING BRAINLEIST+20 POINTS

What was one restriction placed on free African Americans?
O A. They were responsible for paying for the freedom of their enslaved
OB. They had to pay for public services that were free for white
OC. They were not allowed to participate in antislavery organizations.
D. They were forbidden in many states to learn to read and write.
relatives.
Americans.

Answers

Answer: FIXED VERSION: D, They were forbidden in many states  to learn to read and write. Such as in a story this African American girl, had bodyguards to get into a school but her parents had the money because she was so smart that she got in but there were no other african americans with her. Many african americans had their own way less educated schools. I hope this helped anyone who finds it

Explanation:

Answer:

D

Explanation:

Which of the following is not an example of a check or balance put into the U.S. Constitution?
A. Congress confirms a judicial appointment.
B. President vetoes a bill sent to him from Congress.
C. Congress reviews a judicial decision and overturns the Supreme Court ruling.
D. The president issues a pardon or commutes someone's sentence.

Answers

Answer:

Congress reviews a judicial decision and overturns the Supreme Court

Explanation:

history pls help.

After the war, Texas had an agrarian-based economy. "Agrarian" means which of the following? Question 5 options: A. related to land and crops B. railroad C. industrial businesses

Answers

Answer:

A. Related to land and crops

Explanation:

Agrarian basically is the word "Agriculture", and agriculture means something to do with farming. soil, crops, and animals that provide food and other products. Full agriculture definition in dictionary

Which is why it's A, Related to land and crops. I also already took the test.

Answer: A related crops and land

What was not true about the economy at the end of World War II? A. The GMP and corporate profits doubled B. National debt quadrupled during the war C. Wage freezes reduce consumer spending D. Efficiencies in farming reduce manual labor needs

Answers

Answer: A

Explanation:

C. Wage freezes reduce consumer spending

Do you think it possible for Sacco
and Vanzetti to actually receive a
fair trial in the 1920s? Why or why
not?


Answers

Answer:

The exhibit is designed to aid the understanding of this crucial episode in American history, and the importance of our striving always to be, in the enduring and inspiring words of the Massachusetts Constitution, "a government of laws and not of men."

Explanation:

How did trade help the Minoans develop wealth?

Answers

Ion know...................

1. How was Justinian and Theodora's Byzantine Empire different from Western Europe during the same time period?

Answers

Answer:

The Western Empires were collapsing where the Byzantine Empire was teaching its highest point.

Explanation:

Which aspect of the government created by the new nation, the United States of America, was designed to prevent one person or group from galning too much power?

Answers

Answer:

Separation of powers

Explanation:

The Framers thought that this was necessary because they wanted to avoid having a government or a part of government that was too powerful. ... So the decided to create a government in which neither the executive nor the legislature (nor the judicial, for that matter) could have too much power.

Answer:A system of checks and balances

Explanation:

Took the test and this is the right answer.

In the first paragraph of the speech, on page 2 Eisenhower uses the phrase "insolvent phantom as

a symbol of the threat of economic depression

an allusion to soldiers who died for America's freedom

a simile comparing America to other countries

a metaphor for democracy's potentially grim future

Answers

Answer:

The answer is "A symbol of the threat of economic depression"

Explanation:

Insolvent means unable to pay a debt and phantom means "denoting a transaction that has been invented for fraudulent purposes but that does not really exist." These words together both have something to do with the economy(money structure)

In the first paragraph of the speech, on page 2 Eisenhower uses the phrase "insolvent phantom as a symbol of the threat of economic depression. Thus, option A is correct.

On January 17, 1961, President Dwight Eisenhower addressed the American people on national television from the Oval Office of the White House in a speech that lasted less than 10 minutes. Those who anticipated that the World War II hero and the military commander would end his presidency with a sentimental, "old soldier" address a la Gen. Douglas MacArthur were taken aback by his stern warnings against the perils of the "military-industrial complex."

Eisenhower, who served two terms as president of the United States, had restrained the drive for higher defense spending amid the demand to produce more military hardware during the Cold War's arms race. However, the 1950s saw significant growth in both the American military forces and the defense sector.

Learn more about the Eisenhower speech here:

https://brainly.com/question/28549476

#SPJ6

please help me with history

Answers

Answer:

D

Explanation:

Please give me braianliuest

The answer is d jhhhhhhhuhhshshrhdhhfhrhrjrjjffjjrjdjfjfhf

Why does Monk claim that this is the form of government in America

Answers

Answer:

because he said so

Explanation:

The made by João de Castro (1540) depicts a variety of
shing developed by Spain Advancements in technology
including the design of vessels for transoceanic travel
resulted in
greatly expanded trade efforts in the Americas, Africa,
and Asia due to greater shipping capacities and
defensive capabilities,
decreased military tension between European
empires due to the mutual benefit of increased trade.
the development of missionary tleets by the Vatican
to convert indigenous peoples of the Americas, Africa,
and Asia to Christiania
the adoption of new shipping technologies by the
Incan and Aztec empires as they sought to compete
economically with Europe

Answers

Answer:

A) greatly expanded trade efforts in the Americas, Africa, and Asia due to greater shipping capacities and defensive capabilities

Explanation:

took the test

Answer:

A

Explanation:

What state was the first to secede the Union following Lincoln’s election in 1860?

Answers

Answer:

The first state to secede was South Carolina

Explanation:

When the Democratic Party disintegrated in 1860 over the slavery-extension question, Lincoln was elected as the first Republican president. On December 20, 1860, a special convention called in South Carolina unanimously passed an ordinance of secession.

Is this statement true or false?

Eleanor Roosevelt fought for the rights of the underdog – for all those who were persecuted or treated unfairly including women, minorities, the poor, and children.

Answers

Answer:

True.

Explanation:

This answer will be true because I took the quiz, and got it correct. I hope you guys do well on the quiz too!.

Answer:

true

Explanation:

Its quiz 1.02 A Woman of Courage

please answer please i need help lol

Answers

Just put what you think

What is this “check” that Dr. King refers to? How has America defaulted on this check?

Answers

Answer:

dr.'s “Dream” speech used ... “In a sense we've come to our nation's capital to cash a check,” he said, ... “It is obvious today that America has defaulted on this promissory note ...

Explanation:

What country did the Second Crusade begin from?

Answers

Answer: Europe I believe.

Europe
May be
I hope
Other Questions
Express 10 : 12 as a decimal.(Round to the nearest hundrerdth) TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA The slope of the line below is -1/7. Write a point-slope equation of the lineusing the coordinates of the labeled point. What might be the consequences of your choice? Political: Economic: Social: What are the two ways a subduction zone can be generated? The local lighting company found that 2 out of every 10 lightbulbs was defective. Ifthere are a total of 120 bulbs in a box, how many can they predict will be defective? Quienes intervienen en este caso de violencia? En la fragmento de la novela corazn a shop is having a sale all items are reduced by 30% work out the sale price of an item normally priced at 110 Which court would hear this case? Mr. Jones is suing Ms. Brown for the cost ($2,000) to fix his fence when her tree fell and crushed the fence. Hello can someone help me with this question please! 2 3/8 x 3 3/4 divided by 2 2/3 HELP PLEASEAt Love Canal in the 1970s, there was an environmental disaster. In response, the Superfund law was passed. Why can we view Love Canal and the creation of the Superfund as a positive environmental event? A. It allowed the EPA to find toxic waste sites and force the responsible parties to clean up the sites. B. It provided money to businesses responsible for toxic waste sites to clean up their pollutionC. It helped boost the economy among those waste sites D. It helped identify toxic waste site and move people away from them what do you understand by the term current state and define its SI unit......... help please! thank you!The ratio of cats to dogs is 8/6, which can be simplified to 4/3. The ratio of fish to birds is 20/2. Can it be simplified to 10? Why or why not? Answer in complete sentences. Its an inequality I need the work for it ik the answer Which of the following stimuli is least likely to cause an animal to vomit?A.A bacterial infection in the stomachB.Feeling cold after stepping outsideC.Drinking large amounts of water at onceD.Getting dizzy after spinning in circles do you have any song writing tips whats 43.6 rouded to the nest tenth I dont know how to do this can someone help? question 20 which of the following is the correct order of Maslows hierarchy of needs (from the lowest ti highest level)?A. physical needs, safety, belonging, esteem, self actualization B. time management, mental rehearsal, physical activity, relaxation, biofeedback C. extraversion, agreeableness, consciousness, emotional stability, openness D. anger, fear, sadness, happiness, love