Which antivenom will save Tyler?

Select one:

a.
Antivenom A


b.
Antivenom B


c.
Antivenom C


d.
Antivenom D

Answers

Answer 1

Answer:

b

Explanation:


Related Questions

Answer this please I promise 30 points + mark as brainliest ( only relevant answers )

Answers

Answer:

A) Group X = Rose ,mango tree,marigold,palm tree

B) This is the answer of group X =Rose ,mango

This is the answer of group Y =Fern ,pine trees

Explanation:

Answer:

jen, from my heart im saying i lu.v u for real

its been almost 5 months weren't having the same old c.hat we used to have.

ik that ur scared to c.hat with  me since the day ur mom caught u

but still the old memories keep coming into me how many times i try to forget u, i still lu.v u jen still lu.v u

and as i made u a promise that one day we'll meet, i still keep thqat word and that day even if its just one day, we're gonna enjoy the max we could

i'll be waiting for that moment and i hope u would be too...

still lu.v u :(  .......

Which model below shows a prokaryotic cells?

Answers

Answer:

Modle two as it is singular, simple with a flagellum

Explanation:

What two elements of weather are affected by air masses

Answers

Answer:

The air masses separated by a front usually differ in temperature and humidity. Cold fronts may feature narrow bands of thunderstorms and severe weather, and may on occasion be preceded by squall lines or dry lines. Warm fronts are usually preceded by stratiform precipitation and fog.

Cold fronts and warm fronts

According to Vince Carter, "...the most important aspect of getting his degree was the sense of accomplishment it brought. " Use information from the selection and your own ideas to explain what he meant by this statement.

Answers

Answer:

the hard work he went through

What biotic factors might affect a population of fish? Check ALL that apply.

predators
prey
light
bacteria

Answers

Answer:

Explanation: Abiotic factors for fish is water, temperature, amount of dissolved oxygen in water, etc. Penetration of sunlight is also important in fresh water habitat. Biotic factors are predators, disease causing organisms, organisms available as food, population density of competitors, etc.

Explanation:

What is the difference between a detritivore and a decomposer?
A.While detritivores consume animals, decomposers only consume plants.
B. While detritivores feed on dead organic matter, decomposers actually break down dead or decaying organisms.
C. While detritivores consume both plants and animals, decomposers only consume dead animals.
D. While detritivores are heterotrophic, decomposers are autotrophic.

Answers

What are detrivores?

Detritivores are organisms that feed on the organic waste of dead plants and animals

What are decomposers?

Decomposers are organisms that break down dead or decaying organisms; they carry out decomposition, a process possible by only certain kingdoms, such as fungi. Decomposers are the organisms that decompose dead plants and animals.

Difference between detrivores and decomposers

Option C is the the correct answer

While detritivores consume both plants and animals, decomposers only consume dead animals.

Read more about organisms

https://brainly.com/question/25832580

Answer:

While detritivores feed on dead organic matter, decomposers actually break down dead or decaying organisms.

Explanation:

The answer explains itself. It is accurate information. :) Have a good day!

PLEASEE help me answer this question!??

Answers

Answer:

a or b.

Explanation:

it can be in ts regular form solid or it just formed like a liquid

Answer:

B. liquid I think.

Explanation:

or solid bc coal is a solid.

thats all i got.

What happens to the cells at the edges of an injury when a cut in the skin or a break in a
bone occurs?

Answers

Explanation:

[tex]\huge{\underbrace{\overbrace{\mathfrak{\blue{Answer:}}}}}[/tex]

When an injury such as a cut in the skin or a break in a bone occurs, cells at the edges of the injury are stimulated to divide rapidly. This action produces new cells, starting the process of healing.

PLEASE HELP ME - In 1839, Schleiden and Schwann began formulating a theory of cells and their role in living organisms. Over time, cell theory has been updated. Modern theory is summarized below. All known living things are made up of cells. The cell is the structural and functional unit of all living things. All cells come from pre-existing cells by division. The flow of energy occurs within cells. Cell theory explains all of the following except a. the growth of animals. b. how viruses require the cells of living organisms to survive. c. how bacteria reproduce. d. the storage of chemical energy in plant cells.​

Answers

It made it possible to actually see cells. Explanation: With the development and improvement of the light microscope, the theory created by Sir Robert Hooke that organisms would be made of cells was confirmed as scientist were able to actually see cells in tissues placed under the microscope.

Thank You so Much

your amazing have a great life

When is carbon dioxide released during aerobic cellular respiration?

Answers

Answer:

I hope this helps and rate it if its right

Explanation:

I hope this helps and rate it if its right

(GIVING BRAINLIEST!!)


James made the following table to compare the common characteristics of planets. Which of the following would best replace X?


A) Asteroids

B) Comets

C) Moons

D) Stars

Answers

Answer: moons

Explanation:

Mars and Neptune both have moons

Answer:

hi answer is moons

Explanation:they have moons :)

how do vital signs allow medical professionals to assess a patient's physiology and overall health

Answers

they measure the pulse rate and blood pressure of a patient, these can  help to determine if a patient has any diseases of the blood or if they are under stress.

When the northern hemisphere points toward the sun, the southern hemisphere faces away from the sun. In this instance, it is:

A.
summer in North America, and winter in Australia.
B.
summer in North America and Australia.
C.
winter in North America, and summer in Australia.

Answers

Answer:

A

Explanation:

the northern hemisphere is the opposite from the southern hemisphere

Since northern and southern hemisphere are in opposite directions therefore, option (A) is correct.

Why are the seasons reversed in each hemisphere?

The axis of rotation of the Earth is inclined with regard to the plane in which it orbits the sun. This is the root reason of the changing of the seasons. When the axis of the earth is aligned with the sun, summer arrives in that hemisphere of the planet. Expect winter to arrive when the axis of the earth is tilted away from the sun.

Different places of Earth receive the Sun's most direct rays throughout the year. When the North Pole tilts toward the Sun, it's summer in the Northern Hemisphere. When the South Pole tilts toward the Sun, the Northern Hemisphere experiences winter.

Learn more about seasons, here:

https://brainly.com/question/12028829

#SPJ2

which layer of the earth is made out of melted metal?

Answers

The outer core. A molten nickle- iron alloy.

A _______________ from the sun hits chlorophyll and excites an electron, known as __________________________________.

Answers

Answer:

Photon, light dependent reaction of photosynthesis

Explanation:

Photosynthesis is the process by which green plants make their own food in the presence of sunlight and water.

There are two steps of Photosynthesis that include light dependent reaction and light-independent reaction.

In light dependent reaction, a photon from the sun is absorbed by the green pigment in leaves called chlorophyll that allow the electron to excite from ground energy level to high energy level. It converts the solar energy into chemical energy and called light dependent reaction of photosynthesis.

Hence, the correct answer is "Photon, light dependent reaction of photosynthesis".

how does the respiratory and digestive system work together to maintain homeostasis

Answers

You have four main types of tissues: epithelial, nervous, muscle, and connective tissue. Epithelial tissue covers the outside of the body. It also lines organs and cavities. Nervous tissue sends electrical signals. Muscle tissue helps you move. Connective tissue joins bones and cushions organs.
When groups of tissues work together, they are called organs. Some
examples of organs are the heart, lungs, skin, and stomach. When organs work together, they are called systems. For example, your heart, lungs, blood, and blood vessels work together. They make up the circulatory system.
There are eleven systems in the human body: muscular system, respiratory system, digestive system, integumentary system (skin), skeletal system, circulatory (or cardiovascular) system, excretory (or urinary) system, reproductive system, nervous system, lymphatic system, and endocrine system. Each system has a special job.
All of your body systems have to work together to keep you healthy. Your bones and muscles work together to support and move your body. Your respiratory system takes in oxygen from the air. It also gets rid of carbon dioxide.
1
2
3
4
5
6
Your digestive system absorbs water and nutrients from the food you eat.
Your circulatory system carries oxygen, water, and nutrients to cells throughout your body. Wastes from the cells are eliminated by your respiratory system, your excretory system, and your skin. Your nervous system controls all these activities with electrical impulses. If any system in your body isn't working properly, other systems are affected.
Think of your body as a building. A building has a plumbing system, a heating system, a cooling system, an electrical system, and a support system. If any system in a building breaks down, other systems can be affected.
As one example, think about a building's electrical system. Suppose a mouse chewed through an electrical wire to a furnace. Without electricity, the heating system would not work. If this happened in very cold weather, the plumbing system could be affected. Water pipes might freeze and burst. If a lot of water leaked into the building's walls, its support system would be damaged. Like a building's systems, your body's systems have to work together.
HERE IS UR ANSWER MATE!.....

The respiratory system brings oxygen into the lungs when you breathe. The digestive system breaks food down into nutrients such as glucose. Now the circulatory system enters the picture. It transports glucose and other nutrients from the digestive system to the cells.

HOPE IT HLPS UH WELL

1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG
mRNA:
Codon:
Anticodon:
Amino Acids:

Answers

Answer:
mRNA: UAUGCUUUAGCGCUAGCGCCGCUAAGCC

CODONS: AUG-GAA-AUG

AMINO ACIDS: METHIONINE-LEUCINE


Explanation: hope this helps
i am so confused is this an actual question or is it just random letters?-

What are the advantages and disadvantages of a honey bees sexual reproduction

Answers

Answer:I just learned this.

Explanation: The Advantage is that they have plant pollination and honey.

Which of the following processes cycles matter through different parts of an ecosystem?
More than one answer may be correct.
1. the nitrogen cycle
2. the water cycle
3. the carbon cycle

Answers

Answer:

the nitrogen cycle, the water cycle, and the carbon cycle

Explanation:

The water, carbon, and nitrogen cycles move nutrients through the different parts of an ecosystem. Water moves through organisms and the environment in different phases. Carbon moves through an ecosystem in carbon dioxide, minerals, and organic compounds. Nitrogen moves through an ecosystem in nitrogen gas, ammonium, nitrates, and organic compounds.

The biogeochemical cycle is a pathway that circulates the chemicals through the abiotic and the biotic factor. The nitrogen, water, and carbon cycle through various regions of an ecosystem.

What is a biogeochemical cycle?

The biogeochemical cycle is the movement of the chemicals and compounds of carbon, nitrogen, and water in the biosphere (biotic) and the atmosphere, lithosphere, and hydrosphere (abiotic) spheres of the earth.

These cycles move the nutrient through different spheres in the form of inorganic and organic compounds. It is an essential part of the ecosystem as they regulate the flow of the natural elements.

Therefore, option 1. nitrogen cycle, option 2. water cycle, and option 3. carbon cycle move through various parts of an ecosystem.

Learn more about biogeochemical cycles here:

https://brainly.com/question/1204069

#SPJ2

please answer asap! anatomy final exam!! thanks:)
Describe what lymph is and how it travels throughout the body. What would happen if the lymphatic system did not drain interstitial fluid from the body?

Answers

Answer:

A fluid that flows through the lymphatic system is called lymph. it travels when you breathe and move your muscles the lymph continuously get pushed towards the heart from the outer reaches of your body. if the lymphatic system didn't drain interstitial fluid then the lymph fluid would build up in the body's tissues, making them swell.

Are gender traits completely a result of societal expectations?

Answers

Answer:

No. Gender traits in humans are largely determined by biophysical processes. There seems to be a vocal political faction that is trying to convince people in the name of liberty and equality that gender traits are completely learned, and therefore arbitrary. But this claim disagrees with scientific evidence. In general, boys play more with cars and girls play more with dolls not because their parents are perpetuating outdated gender stereotypes, but because their brain is telling them to. This fact does not mean that boys have to play with boy toys, or that boys who play with dolls aren't really boys. It is just a scientific observation about average behavior and its link to fetal development.

How could one determine if two
unidentified organisms share a common
ancestor?

Answers

Answer:

Evolutionists determine that two organisms have a common ancestor is by looking at fossil evidence in different rock layers using the law of Superposition (Oldest layers are on the bottom, newest are on the top) and compare the skulls or other bones to each other in order of oldest to newest (or newest to oldest). Another way to determine this is to examine the amount of DNA a certain species shares with another species. An example of this would be that Humans share roughly 90% of our DNA with chimpanzees or the other Great Apes.

Explanation:

DNA

They can look at the DNA it's the most common one.

There are 4 pieces of evolution and they are

Fossils , Geography , Embryos / DNA , Anatomy

Fossils: Physical remains of species , Determine age, location,  environment

Deeper layers = older

Geography: Proves species share common  ancestors, depending on where

they live

DNA: BEST evidence because it’s the  MOST ACCURATE

Similarities in the early stages of  development

Similarities in DNA

More similarities = closely related

More differences = not related

Anatomy: Compare body parts of different  species to see how they evolved

3 different structures:

Homologous (same structure,  different function)

Analogous (similar structure,  different organisms)

Vestigial (body parts that no  longer serve a purpose)

All of that are in evolution

Hope it helped! ( Gave u my biology notes :D)

The formation of an ionic bond involves the
Select one:
O sharing of neutrons.
sharing of protons.
transfer of neutrons
transfer of electrons

Answers

Answer: transfer of electrons

Explanation:

correct order of events during the process of nucleosynthesis?

Answers

Answer:

hydrogen nucleus formed, isotope of hydrogen, tritium formed, helium nucleus formed

Explanation:

Answer:

A

Explanation:

took the quiz

What are 3 lines of evidence that corroborate the theory of evolution?

Answers

Answer:

Lines of Evidence supporting theory of evolution by natural selection: Fossil evidence, Biographical evidence and Anatomical evidence.

Explanation:

I majored in Biology

How does the size of a bacterial cell compare with an animal cell?

Answers

Answer:

hope it helped

Explanation:

Bacterial cells are very small - about 10 times smaller than most plant and animal cells. Most bacterial cells range in size from 0.2 to 10 microns or micrometers (0.0000079 to 0.00039 inches). ... One reason why bacterial cells are so small is that they need a large surface area to cell volume to take in nutrients.

How many chlorine atoms are there in the molecule NiCl2

Answers

Answer:

2, that’s what the 2 means.

Explanation:

⦁ In what stage of an animal’s life cycle do most cells differentiate?

Answers

Answer:

Reproduction

Explanation:

Answer:

Animals and plants produced by sexual reproduction begin life as a single cell, a fertilised egg or zygote . These cells must divide by mitosis to produce a multicellular organism.

What is the function of a phospholipid bilayer

Answers

Answer:

Phospholipid bilayers create a selectively permeable barrier to the movement of ions and molecules important for cellular function.

Answer: The phospholipid bilayer acts as a barrier to the passage of molecules.

A molecule of oxygen gas contains two:
O molecules
O elements
O atoms

Answers

Answer:

O atoms

Explanation:

:)))

A molecule of oxygen gas contains two atoms of oxygen bonded together.

Answer: your answer will be C

Other Questions
please awnser photo will give brain if you are first If I were to say the phrase "She was blue," what would be the denotationand connotation of this phrase? Please label which is the denotation andwhich is the connotation what is the dakota access pipeline How many groups of 3/4 are in each of the following questions?11/4Enter answer as a fraction. 2 lines that never intersect Stanley has a collection of seashells. He found 35% of his collection on Florida beaches. If Stanley has 49 seashells from Florida, how many seashells does he have in his collection all together?A) 90 B) 120 C) 140 D) 160 Katie is 22 years old and wants to hold a government office in Oklahoma. For which of the following positions is sheeligible?i. state representativeii. state senatoriii. state supreme court justiceA. i. onlyB. i. and ii. onlyC. ii. and iii. onlyD. i.. ii., and lii. Please help I will give brainliest and 11 points!! Brian spends the same amount of money each morning. On Saturday he bought a large coffee for $1.25 and 2 doughnuts. On Sunday he brought a small coffee for $.50 and 5 doughnuts. Write and solve an equation to determine the cost of one doughnut. Why are viruses considered nonliving but bacteria are considered living? Give two reasons.Not a long life story but a simple two reasons. The Notorious jumping frog of calaveras country Rewrite the expression as the sum of two numbers 7(2+5) If x+2=5 then x= What brainly plsWhat is the solution of x + 6 11C. x 1show your work pls Given the diagram below, solve for the value of x. what's your rblx user? and do you play jb? ok bye The regular doctor patients see for routine checkups and medical treatment is a(n)what? Write one sentence on why it is important to not plagiarize. need help asap!!! What is the solution of the following system?Use the substitution method.{y+7=3x6x2y=12The only solution is (14, 12) .The only solution is (12, 14) .There is no solution.There are an infinite number of solutions. the diagram shows what tina had left from a yard of fabric. she now uses 2/3 yards of fabric for a project.how much of the original yard of fabric did tina have after the project