What term means to stay separate or not expand? isolationism? or expansionism?

Answers

Answer 1

Answer:

expansionism

Explanation:

Hope this helps

Answer 2

Answer:

Both but go with Expansionism is right

Explanation:


Related Questions

Please help me DO ALL FOR BRAIN LIEST !! :D i need help this is due soon!!! any help would be great read directions and read passage to get answers thanks !

Answers

Answer:

1 Improving Babylon

Once he felt the city was safe, he went to work. Hammurabi worked to improve the defenses and infrastructure of the city. He strengthened the city walls, improved the city's irrigation system, and built new temples to the gods. The city became prosperous and grew in power.

2 The Hammurabi code of laws, a collection of 282 rules, established standards for commercial interactions and set fines and punishments to meet the requirements of justice. Hammurabi's Code was carved onto a massive, finger-shaped black stone stele (pillar) that was looted by invaders and finally rediscovered in 1901.

3 The Mesopotamia social hierarchy basically consisted of three classes such as nobility, free citizens and slaves. The hierarchy of Mesopotamia can be symbolized as a triangle shaped pyramid.

Explanation:

I hope this helps!!!

please give me brainliest!!!!

:}

How many humans like cheese?

Answers

Answer:

4 billon

Explanation:

i guess

According to the excerpt, what did God disclose to Constantine? also pls give an actual answer to the question and don't put gibberish

Answers

Answer:

if this is about the bible how about you go read it

Explanation:

Answer:

God disclosed  “Do not think that I came to bring peace on earth. I did not come to bring peace but a sword” According to the expert, “matthew 10:53” (document 1). This explains that he wanted his followers to only look at him one way.

True or False? Not every American agreed with the war, and many protested the expansionist action. (talking about Us in the mexican war)

Answers

True it was a lot of land so not everyone agreed!!

This is true. Not every American was in agreement with the war and the expansionist strategy.

The war in this question was the Mexican-American war. The democrats that were mostly living in the southwest were in agreement with the war. They supported it.

But the people that were in opposition to the war were the Whigs. These people condemned the war and also discouraged the land-grabbing ideas of the US. The regarded the war as a conscienceless effort by the United State.

Read more on https://brainly.com/question/20474525?referrer=searchResults

Please help me with this question

Answers

Where is the graph Explanation:

Why might the English government have agreed to send debtors to the New World?

Answers

Answer:

i think it is the third answer

Explanation:

Answer: The Colonies needed more workers

Explanation: They needed to send people here so they could work.

Place the following events in sequence:
A) The Black Death hits China;
B) Plague-infested ships land at Messina, Italy;
C) The Black Death hits the Middle East

Answers

c,b,a. trust me :) its the correct answer

He IMA FROGGEN GIVE YOU BRAINLIST IF YOU ANSWER RIGHT FOR MEH tezztttt

Answers

Ogelthorpe's plan did not work as he had expected it to. His plan was to send debtors to work plantations in the colonies instead of sending them to jail. Ogelthorpe also created rules that stated "no one person could own too much land and, alacahol and slavery were banned."  Even though those rules were in place some colonists did find ways to get lots of land as well as bring alcahol and slaves into the colony.  As satated in the passage, "Ogelthorpe had also origanlly wanted to make products that were in high demand in England, such as silk, but soon found that Georgias cilimate was not good for such products."  According to the text corn, rice, tobacco, and indigo became major cash crops since Georgia had a good climate for growing such produce.

Hope this Helped!

It’s because in the passage it says that 50,000 depters were doing work so then they built things so that people can go to their work quicker by road I’m sorry if wrong bc I’m going of the top of my head from my work 3 months ago so sorry if not correct

help.

What caused the removal of Khrushchev from government?

failures in the Five-Year Plan
political revolution
failures in foreign relations
citizens' dissension

Answers

Answer:

Failures in foreign relations

Explanation:

Answer: b, political revolution

Explanation: I looked it up

WILL GIVE BRINALY!! PLS HELP!!
List the layers of the earth a short description of each layer, starting with the event of the earth.

Answers

Answer:

The Crust, The layer that humans live on.

The Mantle, The thickest layer.

The Outer Core, The only liquid layer.

The Inner Core, 800 miles in diameter.

Explanation:

What did Hammurabi's Code call for?
Options: (Requires 1 answer!)

A. Specific punishments for each type of violation of the laws
B. Equal punishments for a crime for all classes of people
C. Monetary fines for all offenses
D. Punishment only for crimes against the government

Answers

Answer:

it is A or B hope it helps

I think. It’s A

Hope it helps

HELP!!!! 10 PTS!!!!
What river is Washington D.C. on?????
Plz hurry!!!

Answers

Answer:

The Potomac River

Explanation:

Read the passage below to help you answer the question. The following is fictional diary entry of a child living in colonial New England.

Each morning I wake up before dawn. There are many chores that need to be done. First I go out to the barn, milk the cows and collect eggs for breakfast. Next it is time to make sure all of the animals have been fed and then help Father collect wood for the fire. I help Mother churn butter while she makes breakfast.

After breakfast, I got to school. My parents say that school is very important to the future of the colony. We use chalkboards to practice our handwriting and record our answers. Paper is hard to find and very expensive. School sometimes finishes early so all the children can help on the farms. before I leave school, I usually find a few minutes to play marbles and tag with some of the other children. Once I get home, my family and I will work until sunset. We will have a supper of soup and biscuits, and then go tot bed. On Sundays everyone in town goes to church. Then we spend the day playing games and singing songs. After a long week or work and school, it is great to see everyone having so much fun.




In the New England colonies, ______________ worked hard.


A. Everyone
B. Only women
C. Only children
D. Only men

Answers

Answer:

hope it helps

Explanation:

everyone

A.Everyone. That is right

Use impressment in a sentence about Washington’s presidency.

Answers

Answer:

During Washington's presidency, some British sailors off the coast of America were practicing impressment, in which they would force Americans to work on British ships. ... Washington made treaties to avoid problems.

PLS MARK ME BRAINLIEST

Many Mexican Texans faced hostility and discrimination because of the -
1.homestead exemption
2.Treaty of Guadalupe Hidalgo
3.1850 census
4.competition for land

Answers

Answer:

2

Explanation:

Many people were angry after the Treaty and blamed the Tejanos.

2 I had that question before

Summarize Jesus’ life according to the gospel.

Answers

Jesus was born, and as he grew older he set good examples and never committed a sin. He then died and got resurrected and during that time the world went dark. And he got hung on a cross for the people that he loves
JESUS IS MY KING AND ALWAYS WILL BE!!❤️❤️❤️

ILL GIVE BRAINLIEST!!!!

No explanation needed, just the answer is fine. Thank you!

Answers

Answer:

Explanation:

James Walker Fannin Jr. was a 19th-century slave-trader and American military figure in the Texas Army and leader during the Texas Revolution of 1835–36.

William Barret "Buck" Travis (August 1, 1809 – March 6, 1836) was a 19th-century American lawyer and soldier. At the age of 26, he was a lieutenant colonel in the Texas Army. He died at the Battle of the Alamo during the Texas Revolution.

William Barret "Buck" Travis (August 1, 1809 – March 6, 1836) was a 19th-century American lawyer and soldier. At the age of 26, he was a lieutenant colonel in the Texas Army. He died at the Battle of the Alamo during the Texas Revolution

He led the Texan Army to victory at the Battle of San Jacinto, the decisive battle in Texas's war for independence

30 POINTS! Make a generalization about whether Anne Hutchinson was a role model or a trouble-maker. Use details from the passage to help explain your answer.

Answers

While the Puritan society viewed Anne Hutchinson as a trouble-maker, she should be viewed as a role model. The passage explains that she was a leader in a society where women were not considered leaders. She also encouraged people to think for themselves and interpret the Bible in their own way. Although some people didn’t agree with her, what she was doing was not harming Puritan society. The end of the passage explains why some people may think of Anne Hutchinson as a trouble-maker. However, these claims have nothing to do with what she did. The passage states that puritans had to have strict rules to survive, but Anne Hutchinson’s encouragement to think for oneself does not break any rules that are put in place in order for the Puritans to survive. They were just angry that people weren’t thinking in the same way as them. Anne Hutchinson was most definitely a role model. She inspired people to lead regardless of gender and taught people to think for themselves.

This is for my sister she is begging me to help and I dont want to so can yall help a sista out?
Why did some missions use force when interacting with Native Americans?

A. To integrate them into Spanish culture
B. to share meal with them
C. to show off their power
D. to teach them how to build houses

Answers

Answer:

The answer is A

Explanation:

Answer:

ima say A or C but i would say C bc showing off the fact that they can overpower he native americans i think was the whole point...

Explanation:

Calculate the distance between Florida in The U.S. and the island of Cuba.

and Why was this distance a concern to Americans?

Answers

Answer:

the distance was 103 miles and it was a concern because of the missle crisis that happend in 1969

Explanation:

Answer:

thanks lol

Explanation:

Does anyone know if there are any celebrations/festivals during Hanukkah?

Answers

Answer:

i believe there is a parade for Hanukkah my friend said she went to one

Explanation:

Do you think Texans had some valid reasons for seceeding from the Union? Explain why or why not.

Answers

Answer:

I hope this help

Explanation:

The election of a Republican, Abraham Lincoln, to the presidency of the United States and fears that Republican control of the executive branch would threaten slavery and the traditional rights and liberties of Americans precipitated the secession crisis in Texas and elsewhere.

What group originally wanted independence in South Africa from Great Britain?

Answers

Answer:

South African War, also called the Second Boer War or the Second War of Independence. A war fought from October 11, 1899, to May 31, 1902

Explanation:

Tax laws _____.
Group of answer choices

A. have to be voted in by the citizens

B. can be proposed to Congress by the President

C. can never be repealed

D. cannot start in the Senate

Answers

Answer:

c

Explanation:

the answer is C
i hope this helps





I need some help, please

Answers

The fourth one is the best one to choose go for it

Answer:

so i looked it up and one brainly question asked this and someone answered it was A. or 1st one. it was expert varifyed.

I would go with the first one.

Explanation:

I'm sorry i couldn't be of more of a help. :\

helpppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppp

Answers

Answer:

1 slaves

2merchants and bankers

3 industrial workers and farmers

4 aristocrats

Explanation:

hope this helps!!

1 is to slaves
2 is to aristocrats
3 is to industrial workers
4 is to merchants

How is Shinto different from other major religions such as Christianity, Islam, and Judaism?
A.
Shinto does not have a sacred text.
B.
Shinto was developed by Buddhist monks.
C.
Shinto worships only one god.

Answers

Answer:

I believe it is B. because Unlike other religions, such as Judaism or Buddhism, which emphasize understanding God or one's place in the world, Shintoism primarily focuses on helping people communicate with these kami. I hope that helps.

Explanation:

Shinto religion is very much different  from other major religions such as Christianity, Islam, and Judaism because Shinto does not have absolutes. The correct option is A). Shinto does not have a sacred text.

What are the major beliefs of the Shinto?

Shinto is the major religion of the Japan along with the Buddhism. In the late 6th century AD, the name Shinto was created for the native religion in order to distinguish it from the Buddhism religion, which was introduced from China.

Shinto means 'way of the gods,' which is the oldest form of the religion that has been followed by the Japanese. Shinto religion does not have the absolutes. According to it, nobody is perfect and there no wrong or right.

The major beliefs of the Shinto are the importance of harmony, respect for nature, respect of people, family respect, and subordination of the individual before the group etc.

Learn more about Shinto here:-

https://brainly.com/question/16953990

#SPJ2

what is the most well known earth quake in history pls help

Answers

Answer:

one of 2 earthquakes

the 1960 Valdivia quake or the 2004 Indian Ocean quake

Explanation:

Which of the following is true about fossil fuels?
A. Most of them will run out in less than 100 years.
B. They do not produce large amounts of pollution.
C. They can be renewed as we use them.
D. They can only be used as fuel for vehicles.

Answers

Answer:

a

Explanation:

A

Fossil fuels are non renewable sources which means once they run out there’s no more. Since we use them so fast they’re going to run out

Who were the rulers of Cuba and The Philippines prior to The Spanish American War?

Answers

Answer:

spanish and american

Explanation:

Other Questions
Whats the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT 20 POINTS!!!!!!Which of the following is probably not an effect of urban sprawl?A. the loss of habitats and biodiversityB. decreased shortages of water and other resourcesC. increased temperatures in summer monthsmore air pollution that is harmful to human healthPlease select the best answer from the choices providedABCD GMMThe numbers are36XAnd 46 degrees QUESTION 10 of 10: You have a need to purchase 30 units of a product and have them delivered to your company in five days. The sale price is $35 each. Sales tax on the product is 8%. Shipping price is $15. But there is also a 25% rush charge on the sales price added for deliveries less than seven days, which is also taxable. What will be the total cost of this purchase? O a) $1,050.00 b) $1,327.50 Oc) $1,396.50 O d) $1,432.50 A 12 N net force is applied to an object as it moves a distance of 3.0 m: Use theWork-Kinetic Energy Theorem to determine the object's change in kinetic energy.Enter your answer in Joules. plz help i need help im failing Simplify as far as possible.182 Part B: A triangle has vertices A (-2, 3), B (0, 0), and C (1, 2). What are the coordinates of the vertices if the original triangle is dilated by a scale factor of 3 and then reflected over the x-axis? 6th grade history i mark as brainliest A medium artichoke contains about 14% of the recommended amount of a certain mineral an average adult should have each day. About how many grams of the mineral should the average adult have each day? I walked into that reading room a happy healthy man. I crawled out a decrepit wreck Complete each statement by choosing the correct family member that best fits the description.Select the correct answer from each drop-down menu.El padre de mi padre es miEl hijo de mi ta es miLa madre de mi madre es mivEl hijo de mi padre es miLa hija de mi to es mi Who are the most aggressive of the types we looked at? what's the pagathorium theorem A power pole 10 m tall casts a shadow 8 meters long, at the same time that a building nearby casts a shadow 14 m long. How tall is the building? A tank containing oxygen, carbon dioxide, and nitrogen gases has a total pressure of 6.7atm. If the O2 has a pressure of 3.0 atm and the carbon dioxide has a pressure of 1.2what is the partial pressure of the nitrogen gas? The movement of water in or out of the cell membrane without the use of ATP.Diffusion Facilitated diffusion OsmosisExcoytosis PARLER/CRIRE Les personnes suivantes n'ont pascertaines choses. Dites quelle activit de la listeelles ne peuvent pas faire.Marc n'a pas sa raquette.Il ne peut pas jouertudierau tennis.couter le CD1. Nous n'avons pas de vlo.nager2. Je n'ai pas mon maillotde bain.jouer au tennis3. ric n'a pas de couteau. prendre des photos4. Tu n'as pas de fourchette,manger un steak5. Nous n'avons pas noslivres.manger des spaghetti6. Alice n'a pas de portable. faire une promenade7. Les touristes n'ont pas la campagned'appareil-photo.tlphoner8. Vous n'avez pas d'ordinateur.surfer sur le Net9. La n'a pas son baladeur. Escoger Circle the item that does not belong.1.c. la papelera Ca. la tizab. la pluma2.a. la geografac. la economab. el libroB3.a. la mochilab. la puertac. la ventana4.a. la residencia estudiantilb. la casac. la tarea5.a. la pizarrab. el trimestrec. el mapa6.a. el inglsb. el espaolc. el arte 1. Kaleigh notices when she goes to the beach that sometimes the water rises as high as the pier. At other times of the day, the water barely covers the pillars under the pier. These differences in water level are primarily due to the gravitational influence of which of the following? a. The Earths revolution b. The Moon c. asteroids d. comets