Answer:
phosphorus has been considered to be the primary nutrient limiting phytoplankton growth in freshwater ecosystems
Explanation:
17. Why did cover crops fall out of favor in the 20th century?
O A. Selective herbicides were developed to kill weeds.
O B. Cover crops worsen soil structure.
O C. Cover crops reduce water infiltration into the soil.
O D. Cover crops were no longer beneficial.
How does the double helix structure of DNA support its role in encoding the genome?
1)The sugar-phosphate backbone provides a template for DNA replication
2)tRNA pairing with the template strand creates proteins encoded by the genome
3)Complementary base-pairing creates a very stable structure
4)Complimentary base pairing allows for easy editing of both strands of DNA
Answer: Complementary base- pairing creates a very stable structure
Explanation:
The double helix structure of deoxyribonucleic acid (DNA) support its role in encoding a genome because the: 3. Complementary base-pairing creates a very stable structure.
A double helix can be defined as the spiral configuration of the deoxyribonucleic acid (DNA) molecule.
In Biology, a double helix is typically used to describe the molecular structure of a double-stranded deoxyribonucleic acid (DNA) molecule, which comprises two (2) linear strands that are complimentary and run opposite to each other and twist together (anti-parallel).
Hence, the complementary base-pairing in a double-stranded deoxyribonucleic acid (DNA) or double helix structure of deoxyribonucleic acid (DNA) helps to create a very stable structure, which in turn makes it possible to encode a genome.
Read more: https://brainly.com/question/19755749
Which statement is best represented by the diagram?
All carbon is in the form of carbon dioxide,
Carbon can exist in many forms, but the total amount of carbon stays the same.
The amount of carbon in the cycle can increase or decrease based on the number of factories present.
Only living things release carbon dioxide into the atmosphere.
Answer:
All carbon is in the form of carbon dioxide
Which animals are the main consumers of the Pan dropseed (Sporobolus ioclados) ?
Answer:
elephants
Explanation:
The animals that are the main consumers of the Pan dropseed are all animals have complex organ systems. Especially Seed-eating birds including American sparrows, and elephants.
What is Sporobolus ioclados?The grass family contains a nearly universal genus of plants called Sporobolus. The genus' members are frequently referred to as dropseeds or sacaton grasses.
They grow in numerous sorts of open habitat in warmer temperatures and are typical grassland and savanna plants. At least one species, as well as another, are endangered.
Only alkali sacaton has the little moth Bucculatrix sporobolella's caterpillar been discovered (Sporobolus airoides).
On Laysan Island, it appears that the local elimination of S. virginicus by feral rabbits led to the extinction of the Laysan dropseed noctuid moth (Hypena laysanensis).
All of the animals that eat the Pan dropseed most frequently have intricate organ systems, including seed-eating birds including American sparrows, and elephants
Thus, these are the animals that are the main consumers of the Pan dropseed.
For more details regarding consumers, visit:
https://brainly.com/question/7437497
#SPJ6
Clever ones this is one for you
If you throw a pebble into a pond, ripples spread out from where it went in. These ripples are waves travelling through the water. The waves move with a transverse motion. The undulations (up and down movement) are at 90° to the direction of travel.
Answer:
so please Indicate your question
HELP PLZ Which landform is highlighted in the image?
O hills
O mountains
O plains
O plateau
Answer:
I may be wrong, but isn't that the Rocky Mountain Range?
Answer: b. Mountains
Explanation:
Which of the following reactions produces the oxygen released by photosynthesis?
Answer:
6CO2 + 6H2O → C6H12O6 + 6O2+Energy
Explanation:
This means that the reactants, six carbon dioxide molecules, and six water molecules, are converted by light energy captured by chlorophyll (implied by the arrow) into a sugar molecule and six oxygen molecules, the products.
Which of the following describes a negative feedback loop?
Answer:
Which of the following describes a negative feedback loop?
Explanation:
where is option ?
ALOT OF POINTS PLEASE HELP :)
How did humankind discover the presence of DNA?
Answer:
The real breakthrough in understanding DNA, however, came with the discovery of its structure in 1953. The discovery of the structure of DNA is often credited to James Watson and Francis Crick.
Explanation:
What boundary is present at the Philippine plate and the Eurasian plate?
A convergent boundary resulting in earthquakes and volcanic activity
B transform boundary resulting in fault lines and shallow earthquakes
C divergent boundary resulting in mid-ocean ridge and creation of new sea floor
D convergent boundary resulting in mid-ocean ridge and widening of ocean basic
Answer:
D
Explanation:
Chromosomes contain large molecules known as
a DNA
b Lacunae
C Mitochondria
d Viron
Answer:
a DNA
Explanation:
prove me wrong
|•-•|
PLEASE HELP I WILL MARK BRAINLIEST. Listed in the Item bank are key terms and expressions, each of which is associated with one of the columns. Some terms may display additional information when you click on them. Drag and drop each item into correct column. Order does not matter. PLEASE HELP
Producer: Grass, trees, algae
Consumer: Birds, cows, humans
Decomposer: Earthworms, fungi, mushrooms
Answer:
Producer: Grass, trees, algae
Consumer: Birds, cows, humans
Decomposer: Earthworms, fungi, mushrooms
Explanation:
Hope This Helps!
Please Mark Me Brainly!
which of the following are part of the central nervous system?
Answer:
The central nervous system is made up of the brain and spinal cord
Explanation:
ion if that's the answer you were looking for but here go.
MARKING PEOPLE AS BRAINLIDT IF CORRCET
True or False: Bone cells contain different DNA than blood cells.
Answer:
True the bone cells do have different DNA than blood
Explanation:
Which statement accurately describes renewable
Answer:
D
Explanation:
in what form is carbon found in the atmosphere?
Answer:
carbon dioxide(CO2)
Methane gas(CH4)
Explanation:
Answer:
CO2
Explanation:
Please I need Help!!
● Prophase I
● Metaphase I
● Anaphase I
● Telophase I
● Prophase II
● Metaphase II
● Anaphase II
● Telophase II
Answer:
Its in this order: 3 - 4 - 1 - 6 - 5 - 7 - 2 - 8
Explanation:
I learned this a while ago so I would know
John had two different colored rabbits that were brothers, one grey rabbit, and one that was white with black spots. Both of these rabbits' parents were only white and black. Explain the terminology and reasoning for these color differences the brothers compared to their parents.
Answer:
They recombine in the offspring, bringing the total gene count back up to two per trait per animal. This recombination of genetic material from parents into children is why we have such diversity among both people and rabbits.
Explanation:
I majored in Biology
When is carbon dioxide used during photosynthesis?
A. Light- independent reaction
B. Light-dependent reaction
C. Carbon dioxide is made, not used
Answer:
Pretty sure its b.
Explanation:
a sedimentary rock formed from clay deposits
Answer:
is it shale
sorry if that's not right it's kinda confusing how you put the question
Explanation:
which statement describes what happens to rocky shorelines that absorb energy from ocean waves?
Answer:
Solid rock break apart
Explanation:
TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
Answer:
I don't know the answer
Explanation:
is is this even a question cos I don't think so.
The pigment plants have that they use for photosynthesis is called ————
I don’t want a explanation I just want the answer
Answer:
chlorophyll is the answer
3.4.3 Lab: Why are cells so small?
Answer: The important point is that the surface area to the volume ratio gets smaller as the cell gets larger. Thus, if the cell grows beyond a certain limit, not enough material will be able to cross the membrane fast enough to accommodate the increased cellular volume. ... That is why cells are so small.
Explanation: because they can absorb nutrients much more efficiently. Because they are smaller they can efficiently absorb enough food. ... When a cell doubles in size the volume increases much more then the surface area, which is why large cells cannot receive enough food efficiently for their volume. Cells are small because they are more efficient as smaller entities. Information within small cells is transmitted more quickly and efficiently than within larger cells. ... Thus a higher cell surface area-to-volume ratio, i.e., smaller cell size, is desired for most efficient cellular activity.
The cells are so small because their small size allows them to take in food and get rid of the waste.
The cells are the basic structural and functional unit of all organisms on earth except the Viruses. The size of the cell is so little it allows the organism to maximize the ration of surface area to volume. Smaller cells are expected to have greater ratio which promotes more molecules as well as ions to move across the plasma membrane.The small size of the cell facilitate to get the nutrients inside the cell and waste outside the cell quickly. Hence, small size of cell facilitates to get food inside and get rid of waste.Learn more about cell:
https://brainly.com/question/3142913
1. How can we identify a market for vegetables? Write.
2
How do you get vegetables to the market? Write the procedures in brief.
1.
Marketing is one of the most important factors in determining the success of any fruit and vegetable farming enterprise. Marketing includes all the operations and decisions made by producers. These decisions range from deter-mining the most marketable crops for production to deciding how to best deliver quality produce to the consumers at a profit. However, contrary to popular belief, marketing does not begin after a crop is produced. Instead, marketing alternatives need to be considered even before production takes place.
2.
Recent environmental and food safety concerns in the United States produce sector have brought about increasing interest in organic fruit and vegetable production as an alternative to traditional fruit and vegetable enterprises. As a result, the production and marketing of organic crops has expanded steadily during the 1980s. However, as more organic producers enter the industry and it becomes more and more competitive, existing producers are forced to become better growers and more effective marketers.
Help I need helpppppppoo
Please help I will give a brainliest
Answer:
answer
Explanation:
im not that good w these sorry
What might be the consequences of your choice?
• Political:
• Economic:
• Social:
Answer:
Political: Lobbyists.
Economic:Farmers and industrial companies will significantly reduce their output and reduce local jobs. The companies that sell pesticides and fertilizers to local companies will also suffer losses. Farmers will suffer the most if they are unable to find safer fertilizers and pesticides to use.
Social:After a period of time, water pollutants will reduce to safe levels. This could be a long wait. Poverty may increase in the region due to lost jobs and income.
Explanation:
15. Mutations that affect the body cells of an organism are called a. Enzyme mutations b. Gamete mutations c. Somatic mutations O d. Neutral mutations
Answer:
C. Somatic
Explanation:
hope it helps ya :D
If a stream with a horizontal distance of 5 km begins at an elevation 200 m
higher than where it ends, what is its stream gradient?