What is the value of s?

What Is The Value Of S?

Answers

Answer 1

Step-by-step explanation:

Sum of angles in a triangle = 180°.

=> s° + (s/7 + 3)° + (s/7 - 3)° = 180°

=> 9/7 * s° = 180°

=> s° = 180° * (7/9) = 140°

Hence the value of s is 140.


Related Questions

How do you write 872.8% as a decimal?

Answers

Answer:

.82

Step-by-step explanation:

Answer:

8.728

Step-by-step explanation:

"Percent" means "per 100" or "over 100". To convert 872.8% to a decimal rewrite 872.8 percent in terms of per 100 or over 100.

Find the value of f(4) for the function.
f(x) = - 4(x + 5)

Answers

[tex]f(4)=-4(4+5)\\\\=\\ -16-20=-30[/tex]

fun fact

An apple, potato, and onion all taste the same if you eat them with your nose plugged

Answer:  The answer is -36 :)

Step-by-step explanation:

f(x) = - 4(x + 5)  distributive property

-4x-20 plug in the 4 in the -4x

-4(4)-20

-16-20=

-36

Please give me the correct answer ​

Answers

Answer:

(-3,-2)

Step-by-step explanation:

If you draw a line across from Point A to -3, and a line down from Point P to -2, you get the point (-3,-2) and a right triangle.

ill love you forever if you help me:)

Answers

Answer:

D

Step-by-step explanation: WONDERWALL RULES

Wonderwall

Song by Oasis

Today is gonna be the day

That they're gonna throw it back to you

By now you should've somehow

Realized what you gotta do

I don't believe that anybody

Feels the way I do about you now....Ye i cant type the whole song but i tried!!

Colin gets £x wages each week. After he pays his tax of £t, he
then pays his rent of £120. He shares what's left between
himself and his wife. How much do they each get?

Answers

Answer:

They will each get ;

(x-t)/2 - 60

Step-by-step explanation:

Here, we want to know the amount of money that Colin and his wife gets

we start by subtracting the necessary terms

Mathematically, that would be;

x-t-120

So what each of them get will be;

(x-t-120)/2

= (x-t)/2 - 60

The angle bisector of the angle ABC is BP. If angle ABP is 6nº, what is angle ABC?

Answers

Answer:

12n

Step-by-step explanation:

∠ABC is twice the value of 6n°

PLEASE HELP ASAP!! Will give BRAINLIEST for the first correct answer!
Dr. Hammer noticed that the distribution of scores for his psychology class's last unit test was
not normal. In fact, the class results were positively skewed. According to this, which of the
following would be true?

OPTIONS:
A. The mean, median, mode would all be the same

B. The mean would be higher than the median and mode

C. The mean and median would be the same, but the mode would be higher

D. The mode and median would be higher than the mean

Answers

Answer:

E

Step-by-step explanation:

Answer:

B. The mean would be higher than the median and mode

Step-by-step explanation:

could someone answer these?

Answers

the answer is (1 , 2)


hope this helps !! have a great day :))

To graph the equations (sorry i dont have a camera), use the up/down line and on the 6 put a dot, then move one space to the right, and four squares down to place your next dot. This is for y = -4x+6. To graph y = 4x - 2, go back to the up/down line, to the -2 part, and put a dot. then go to the right once, and up four times to place your next dot. when the lines connect, you should be able to find your point, at (1, 2)

Write the expression-
The quotient of x and 8

Answers

Answer:

x ÷ 8

Step-by-step explanation:

please help due in 10 mins.
Tides are measured by the heights of the tide above or below sea level. The difference between the two heights represents how much greater the high tide is than the low tide. The table shows the high and low tides and the difference between their heights at each of three locations. Some of the data in the table are missing. Use this information for the problem below.

Answers

Answer: Location A: 6.04, since a negative and a negative is a positive. 6.04--1.08=7.12

Location C: 6.9

7.34-0.44=6.9

Step-by-step explanation:

Difference between high tide and low tide at location C is equal to 6.9 and high tide at location A is equal to 6.04

What is high tide and low tide ?

Tides originate in the oceans and progress toward the coastlines where they appear as the regular rise and fall of the sea surface. When the highest part, or crest of the wave reaches a particular location, high tide occurs; low tide corresponds to the lowest part of the wave, or its trough.

Given here Difference between high tides and low tides                                = high tide - low tide

= HT - LT    . . . . . . . (1)

thus, Difference between high tide and low tide at location C is = 7.34 -0.44    

                                                                                                          =  6.9

And high tide at location A is = (Difference between HT & LT) +  LT  (from  eqn 1)

                                                = 7.12 + ( -1.08)

                                                = 6.04

Hence, Difference between high tide and low tide at location C is equal to 6.9 and high tide at location A is equal to 6.04

Learn more about high tide and low tide here:

https://brainly.com/question/14683300

#SPJ2

2 times what gives you 7

Answers

Answer:

You cannot do 2 times whatever number because 7 is an odd number, whilst numbers getting multiplied by 2 are always even

Step-by-step explanation:

Hope this helps!!!!!

(ノ◕ヮ◕)ノ*:・゚✧

Answer:

nothing!

unless you mean 1 x 7  or 7 x 1

Step-by-step explanation:

In which of the following sets can each
number only be classified as rational?
A {0, - 18 , 124, -3, 3)
B {3.5, -4, 23.8, -1.2, 0}
C {-5, 13, 233, 42,3)
D {-7.75, -5.8, 0.125, 4, 21}

Answers

The answer to the question is A

Find the 6th term of the geometric sequence whose common ratio is 3/2 and whose first term is 6.

Answers

Answer:

The 6th term will be:

[tex]a_6=\frac{729}{16}[/tex]

Step-by-step explanation:

Given

a₁ = 6common ratio r = 3/2

To determine

a₆ = ?

A geometric sequence has a constant ratio r and is defined by

[tex]a_n=a_1\cdot r^{n-1}[/tex]

substituting a₁ = 6, r = 3/2

[tex]a_n=6\cdot \left(\frac{3}{2}\right)^{n-1}[/tex]

Determining 6th term

substituting n = 6 in the given equation

[tex]a_n=6\cdot \left(\frac{3}{2}\right)^{n-1}[/tex]

[tex]a_6=6\cdot \left(\frac{3}{2}\right)^{6-1}[/tex]

    [tex]=6\cdot \frac{3^5}{2^5}[/tex]

    [tex]=\frac{3^5\cdot \:6}{2^5}[/tex]

    [tex]=\frac{3^5\cdot \:2\cdot \:3}{2^5}[/tex]

Cancel the common term

     [tex]=\frac{3^6}{2^4}[/tex]

     [tex]=\frac{729}{16}[/tex]

Therefore, the 6th term will be:

[tex]a_6=\frac{729}{16}[/tex]

How many times should you multiply 15 to equal 60 seconds PLEASE HELP!

Answers

Answer:

4 times 15 = 60 answer 4

Step-by-step explanation:

4 times

15+15+15+15=60

(GIVING BRAINLIEST!!)
A teacher buys 5 pizzas. Each slice is 1/8 of a pizza. How many slices are there in total?

A) 1/40 slice
B) 4 slices
C) 20 slices
D) 40 slices

Answers

Answer:

D) 40

Step-by-step explanation:

5 pizzas and as saying above 1/8 that means the pizza is being cut into 8 slices and their is 5 pizzas so the answer will be provided by multipling 8 by 5

Answer:

There are 8 slices in =1 box

8*5

=40 slices in all 5 boxes

(WILL GIVE BRIANLIEST TOO FOR THE CORRECT ANSWER!)
TRUE OR FALSE FOR EACH QUESTION
1. The units for mass are based on Newtons.
2. The units for length are based on meters.
3. Area = width x length
69 points!

Answers

1. False 2. True 3. True

find the area of the adjoining figure.
please help and find it
i really need it my exam is tomorrow
i will mark you the brainlliast​

Answers

first lets find Area of triangle bellow

(SRT triangle):

FORMULA: (Base×height)/2

(18×5)/2=90/2=45 cm²

now lets find area of trapezoid (PQSR):

FORMULA: ((base+base)/2)×height

((18+20)/2)×4=19×4=76cm²

now lets add both of the figure's areas to get final answer:

45+76=121 cm²

area of figure is 121cm²

please mark❤️

Find a probable next term for the sequence 9,20,39,72,125,204,315

Answers

Answer:

464

Step-by-step explanation:

The first term is 9.

The difference between the second and first term = 20 - 9 = 11

The difference between the third and second term = 39 - 20 = 19

The difference between the fourth and third term = 72 - 39 = 33

The difference between the fifth and fourth term = 125 - 72 = 53

The difference between the sixth and fifth term = 204 - 125 = 79

The difference between the seventh and sixth term = 315 - 204 = 111

The differences are 11, 19, 33, 53, 79, 111

From the difference: 19 - 11 = 8, 33 - 19 = 14, 53 - 33 = 20, 79 - 53 = 26, 111 - 79 = 32

We can see from the first difference (8), if we add 6 we get 14, if we add another 6 we get 20, if we add 6 we get 26, if add 6 we get 32

We get the eight term using:

32 + 6 = 38

let x be the difference between the eight term and the seventh term, hence:

x - 111 = 38

x = 111 + 38

x = 149

Therefore:

eighth term - seventh term = 149

eighth term - 315 = 149

eighth term = 149 + 315

eighth term = 464

The next probable term is 464

7th grade math please help

Answers

Answer:

3.8 x 4.5

+

3.8 x 5.1 divided by 2!

Step-by-step explanation:

You can turn it into 2 squares, or follow the hints!

(12 divided by 3) 2 – (18 divided by 3 2)) < (4 divided by 2)

Answers

Answer:

[tex](12 \div 3)(2 - (18 \div 32) \\ = 4(2 - \frac{19}{16} ) \\ = 4( \frac{23}{16} ) \\ = \frac{23}{4} \\ since \: (4 \div 2) = 2 \\ \frac{23}{4} is \: not \: < 2 \: but \: its \: > 2[/tex]

Is 3^2 ⋅ 3^−5 equivalent to 1/3^-3

Answers

Answer: No

Step-by-step explanation:

3^2 * 3^-5 = 3^(2+-5) = 3^-3, and 3^-3 is obviously not 1/3^-3.

Hope that helped!

Can someone help me please

Answers

Answer:

-15

Step-by-step explanation:

it’s b! because it is a negative and has no absolute value sign.

Carlos needs to save an additional $565 before he can purchase a car for his son he plans to save $25 each week at this rate at the end of how many full weeks will he have enough money to purchase the car

Answers

Given:

Savings for each week = $25

Amount required before Carlos purchase a car = $565

To find:

The number of full weeks in which he will have enough money to purchase the car.

Solution:

Let the required number of weeks be x.

Savings for 1 week = $25

Savings for x week = $25x

Savings must be greater than equal to $565 to purchase the car.

[tex]25x\geq 565[/tex]

Divide both sides by 25.

[tex]x\geq \dfrac{565}{25}[/tex]

[tex]x\geq 22.6[/tex]

So, the smallest possible integer value of x is 23.

Therefore, 23 week are required to have enough money to purchase the car.

PLEASE HELP I NEED DONE BY 3 10!!!!!! NUMBER 7

Answers

Answer:

115

Step-by-step explanation:

Answer:

there are 120 animals

Step-by-step explanation:

if cows are 40%, then "not cows" is 60%

so 72 animals 60% of all the animals on the farm

60% of 120 is 72

45k+34=979 i need help

Answers

Answer:

I think its 21 because 45x21= 945+34= 979

Step-by-step explanation:

Which fraction is equivalent to 2/8??

Answers

The answer to that is 1/4

HELP PLS!!!!!!!!! :DD

Answers

Step-by-step explanation:

1 minute = 90 words

3.5 minutes = 90 * 3.5 = 315 words.

Hence Jim can type 315 words in 3.5 minutes.

Step-by-step explanation:

one minute equal 60s

3.5 minutes means 3 and half a minute

3 minute = 180s

1/2 minute =30s

therefore 3.5minutes = 210s

60s ----- 90words1s ------ 90/60= 3/2 =1.5words210s ------ 315words

What is the slope of the line that passes through the points
(

4
,

3
)
(−4,−3) and
(
14
,
0
)
?
(14,0)? Write your answer in simplest form.

Answers

Answer

y= 1/6x -2.3

Step-by-step explanation:

hope this helps :)

The slope of the line passing through (-4, -3) and (14, 0) is 1/6.

A linear equation is in the form:

y = mx + b

where y, x are variables, m is the slope of the line and b is the y intercept.

The slope of the line passing through (-4, -3) and (14, 0) is:

[tex]m=\frac{y_2-y_1}{x_2-x_1} \\\\m=\frac{0-(-3)}{14-(-4)} \\\\m=\frac{3}{18} \\\\m=\frac{1}{6}[/tex]

The slope of the line passing through (-4, -3) and (14, 0) is 1/6

Find out more at: https://brainly.com/question/13911928

Given that, 1 Turkish lira = £0.17, convert £312 into Turkish lira. Give your answer to the nearest lira.

Answers

Answer:

£53

Step-by-step explanation:

According to the scenario, the computation of the given data are as follows,

1 turkish Lira = £0.17

Now convert £312 into turkish lira

So it can be calculated below:

= £0.17 × £312

= £53.04

After converting into turkish lira, it is £53

Complete the following statement.
p(x)=x^(2)+7x+3
If is divided by x+4, the remainder is

Answers

Answer:

x + 3 with the remainder of -9

Step-by-step explanation:

       ___x__+__3_____

x + 4 | X^2 + 7x + 3

          - (x^2 + 4x)

                       3x + 3

                      -(3x + 12)

                                -9

So the answer is x + 3 with the remainder of -9

Other Questions
pls help asap!! no trolls 1. Many plants can reproduce asexually. How is this an advantage for the plant? Why can it sometimes be a disadvantagefor the plant? Use details to support your answer. PLS ANSWER ASAP. ILL GIVE BRAINLIEST! Match the system for each of the following bodily organs.1.Nose a. Skeletal System2.Skull b. Circulatory System3.Kidneys c. Urinary System4.Veins d. Respiratory System 2 Which piece of evidence explains WHY the five themes of geography were created (A) In 1984. educators sought to better organize the teaching of geography in kindergarten through 12th grade classrooms. (B) The themes were created by the National Council for Geographic Education and the Association of American Geographers. (C) While these five themes have been since replaced by the National Geography Standards, they still provide an effective organization for the teaching of geography (D) Humans shape the landscape through their interaction with the land; this has both positive and negative effects on the environment Fill in the blank with the appropriate preposition.Paris est _____________ New York.a.) prs deb.) loin dec.) surd.) dans plz help timed MATHHHH 12 pointes Use the restriction enzyme EcoRi to cut DNAVictim DNA :GGAAG ATTCTACATTACTGACGGACGTGACGTGACCTTCTTAA GATGTAATGACTGCCTGCACTGACTNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 1 DNA :GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAANumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 2 DNA :CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGGGGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCCNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :PLEASE HELPPP!!!!I WOULD APPRECIATE A LOT :) Select one of the readings in this unit, EXCEPT the Gettysburg Address, and in at least 150 words, discuss the historical context or cultural context the author demonstrates. i cant ever forgive the vampire diaries producers and directors for killing enzo but letting ratty matty the human LIVE?? like why did they keep matt alive when no one liked him but KILLED ENZOOOOOO How did Tisquantum help the Pilgrims????i will give brainliest and extra points Find the value of x in the image Read and choose the option with the regular verb in the imperfect tense.La princesa ley el libro.El rey no hablaba.La reina fue a la torre.El prncipe tom caf, Do you believe that parents should have all of the powers described in the Parents Constitution? Why or why not? answer the pic below How can you use density to separate mixtures like sand and small plastic pellets? What is the x- coordinate of the zero of the graphed line? How does the setting influence the theme of the story (pieces in the past ) story 15 points Why do you think that some bacteria/diseases are harder to eradicate than others? kareem drew a diagram to compare flatworms and segmented worms which label belongs in the area marked X?a. can reproduce sexuallyb. are always parasites c. are all sessiled. are covered in setaePLEASE HELP Jackson biked k kilometers. Maria biked 8 more kilometers than Jackson. Peter biked 2 fewer kilometers than Jackson.Drag and drop the expressions into the boxes to write an expression that represents the total number of kilometers Jackson, Maria, and Peter biked in all.k812k+2k+8k+10k-2k-8