What is the name for C2I3

Answers

Answer 1

Answer: The correct name for the compound [tex]C_2I_3[/tex]  is, Dicarbon triiodide.

Explanation:

[tex]C_2I_3[/tex] is a covalent compound because in this compound the sharing of electrons takes place between carbon and iodine.. Both the elements are non-metals. Hence, it will form covalent bond.

The naming of covalent compound is given by:

The less electronegative element is written first.

The more electronegative element is written second. Then a suffix is added with it. The suffix added is '-ide'.

If atoms of an element is greater than 1, then prefixes are added which are 'mono' for 1 atom, 'di' for 2 atoms, 'tri' for 3 atoms and so on.

Hence, the correct name for the compound [tex]C_2I_3[/tex]  is, Dicarbon triiodide..


Related Questions

Fungus is an example of a/an-

A:tissue
B:cell type
C:organ
D:organism

Answers

Answer:

D.organism

Explanation:

A fungus from the kingdom fungi is an organism

Answer:

D. organism

......................

If 10.88 moles of NH3 were produced, how many moles of N2 would be
required?

Answers

Answer:

5.44 moles of nitrogen required.

Explanation:

Given data:

Number of moles of NH₃ = 10.88 mol

Moles of N₂ required = ?

Solution:

Chemical equation:

N₂ +  3H₂         →       2NH₃

Now we will compare the moles nitrogen and hydrogen.

               NH₃          :           N₂

                 2             :           1

               10.88        :         1/2×10.88 = 5.44mol

5.44 moles of nitrogen required.

   

what type of molecule are these and what is the strongest IMFs in between?​

Answers

Answer:

CH2O is formaldehyde a covalent compound and its intermolecular forces are week

KCl is an ionic compound formed by electrostatic force of attraction between positive and negative charge. Ionic compounds also exists in three dimensional crystal lattic that is why intermolecular forces in KCl is stronger.

Moreover melting point of KCl is higher than CH2O

Explanation:

Solid mercury (II) oxide produces liquid mercury and oxygen gas

Answers

Mercury(II) oxide, a red solid, decomposes when heated to produce mercury and oxygen gas. Mercury(II) oxide is a red solid. When it is heated, it decomposes into mercury metal and oxygen gas. A reaction is also considered to be a decomposition reaction even when one or more of the products are still compounds.

how are Ionic and Covalent Bonds are formed with examples ?

Answers

Answer:Comparison of Ionic and Covalent Bonds

In an ionic bond, the atoms are bound together by the electrostatic forces in the attraction between ions of opposite charge. ... For example, sodium (Na), a metal, and chloride (Cl), a nonmetal, form an ionic bond to make NaCl. In a covalent bond, the atoms bond by sharing electrons.

     

pls   add  Brainliest

Why milk sours is chemical change ?

Answers

Answer:

Explanation:

So chemical changes require a change on a molecular level that cannot be reversed because they form some new substance. Souring milk is not something you can reverse, and the process of it souring produces new molecules.

It is a chemical change as the lactose in the milk of is converted to lactic acid by microbes giving a sour taste

pleaseee help thank youu​

Answers

Answer:

i just took it the answers is C

Explanation:

It’s d hope it’s correct I triedjsjjddjsnsnshsje

Which of the following is a radioactive element?Sodium, Fluorine,Oxygen
francium

Answers

Answer:

Fluorine

Explanation:

These particles stick in the atoms and make them radioactive.

Which chemical equations show a precipitation reaction?

Select all the correct answers.

2NaNO3(aq) + NiCl2(aq) → 2NaCl(aq) + Ni(NO3)2(aq)
MgSO4(aq) + CaCl2(aq) → MgCl2(aq) + CaSO4(s)
AlBr3(aq) + 3LiI(aq) → AlI3(aq) + 3LiBr(aq)
FeCl2(aq) + Na2CO3(aq) → FeCO3(s) + 2NaCl(aq)
2AgNO3(aq) + Na2S(aq) → Ag2S(s) + 2NaNO3(aq)

Answers

The equations that show a precipitation reaction would be [tex]MgSO_4(aq) + CaCl_2(aq) --- > MgCl_2(aq) + CaSO_4(s)[/tex], [tex]FeCl_2(aq) + Na_2CO_3(aq) --- > FeCO_3(s) + 2NaCl(aq)[/tex], and [tex]2AgNO_3(aq) + Na_2S(aq) --- > Ag_2S(s) + 2NaNO_3(aq)[/tex]

What is a precipitation reaction?

It is a reaction in which two soluble salts react in aqueous solutions to form one soluble and one insoluble salt.

Thus, all the equations with an insoluble salt as one of the products will qualify as precipitation reactions. The insoluble is designated as (s).

Hence, the following are precipitation reactions:

[tex]MgSO_4(aq) + CaCl_2(aq) --- > MgCl_2(aq) + CaSO_4(s)[/tex][tex]2AgNO_3(aq) + Na_2S(aq) --- > Ag_2S(s) + 2NaNO_3(aq)[/tex][tex]FeCl_2(aq) + Na_2CO_3(aq) --- > FeCO_3(s) + 2NaCl(aq)[/tex]

More on precipitation reactions can be found here: https://brainly.com/question/24158764

#SPJ2

flourine is more reactive than chlorine . why ? with short reason. ​

Answers

Answer:

Electronegativity is probably the biggest thing that plays into reactivity. Therefore, since fluorine has a higher electronegativity than chlorine, fluorine is more reactive.

Explanation:

I got it right

Number of atoms in 4.5 moles of Au?

Answers

Don’t have a calculator on me but multiply 6.02x10 to the 23rd power by 4.5

A 52 gram sample of an unknown metal requires 714 Joules of energy to heat it from
30.5◦C to 82◦C. What is the specific heat of
this metal?
Answer in units of J/g ·
◦ C.

Answers

Answer:  Approximately [tex]0.267 \frac{\text{J}}{\text{g}^{\circ}\text{C}}[/tex]

===================================================

Work Shown:

We have the following variables

Q = 714 joules = heat requiredm = 52 grams = massc = specific heat = unknown[tex]\Delta t[/tex] = 82-30.5 = 51.5 = change in temperature

note: the symbol [tex]\Delta[/tex] is the uppercase Greek letter delta. It represents the difference or change in a value.

Apply those values into the formula below. Solve for c.

[tex]Q = m*c*\Delta t\\\\714 = 52*c*51.5\\\\714 = 52*51.5*c\\\\714 = 2678*c\\\\2678*c = 714\\\\c = \frac{714}{2678}\\\\c \approx 0.26661687826737\\\\c \approx 0.267\\\\[/tex]

The specific heat of the unknown metal is roughly [tex]0.267 \frac{\text{J}}{\text{g}^{\circ}\text{C}}[/tex]

Will give brainliest

Answers

it shows the atomic number

What is the molar mass of magnesium sulfate, MgSO4?

Answers

Answer:

120.37 g/mol is the molar mass of magnesium sulfate

120.37, hopefully this helps <3

PLEASE HELP ASAPPPP I WILL VENMO YOU MONEY IF YOU DO THIS CORRECTLY Write the name for the following compounds.
1. N2O (Covalent)
2. Cu2S (Ionic)
Write the Chemical Formula for the following compounds.
3. Dichlorine heptoxide (Covalent)
4. Magnesium bromide (lonic)

Answers

Answer:

Dichlorine heptoxide=Cl₂O₇

magnesium bromide=MgBr2

Explanation:

cl2 07 mgbr2 hopefully this helps :)

Describe the process of freezing ice cream in terms of heat flow.

Answers

Answer:

Freezing the mix is one of the most important operations in making ice cream, for upon it depend the quality, palatability, and yield of the finished product. Typically, freezing of ice cream is accomplished in two steps: (1) dynamic freezing, where the mix is frozen quickly while being agitated to incorporate air and to limit the size of ice crystals formed; and (2) static freezing, where the partially frozen product is hardened without agitation in a special low-temperature environment designed to remove heat rapidly. Although these steps primarily encompass freezing, or the formation of ice crystals, there are several other important processes that take place during this time that significantly impact the quality of ice cream. Both the dispersion of air bubbles and rearrangement of fat globules occur during the freezing steps.

Explanation:

QUESTION 3
Identify the number that has 3 significant figures.
O A. 100
OB. 12.0
O C. 120
OD. 123.00

Answers

Answer:

D

Explanation:

One mole of a substance has a different number of particles as one mole of another substance.
O True
O False

Answers

False
Explain: I just did this question on my quiz and I got it right
Hope that helps please like my answer
Have a good day ❤️

what element is in group 13, period 4

Answers

Answer:

Gallium

Explanation:

Answer:

Gallium

Explanation:

please helpppppppppp

Answers

Answer:

Environmental factors such as diet, temperature, oxygen levels, humidity, light cycles

And the presence of mutagens can all impact which of an animal's genes are expressed, which ultimately affects the animal's phenotype.

Environmental factors such as diet, temperature, oxygen levels, humidity, light cycles, and the presence of mutagens can all impact which of an animal's genes are expressed, which ultimately affects the animal's phenotype.

Atoms are stationary and don't move when in solid form.

False

True

Answers

Answer:

True? The don't stay exactly still i dont think, but i'd say true.

Explanation:

Answer:

TRUE

Explanation:

In a solid, atoms are packed tightly together and move very slowly. In fact, they do not flow at all: they simply vibrate back and forth.

Key words vibrate, not movement.

Correct me if I'm wrong of course

Write down the possible types of atomic
Orbitals of n=4​

Answers

Answer:

2

Explanation:

because first shell ( k shell ) needs only 2 electron to complete its octet .

hope it helps

It’s actually 16 orbitals for n = 4!

1pt Copper chloride and aluminum react to produce
aluminum chloride and copper. Which of the
following is the correctly balanced chemical
equation for this reaction?
O A. CuCl, + Al -> AICI, + u
O B. 3CuCl, + Al -> AlCl, + 2Cu
OC. 3CUCI, + 2Al -> 2AICI, + 3Cu
OD. CuCl, + 3Al -> AICI, + 2Cu

Answers

Answer:

None of the above

but it must be:

for Copper(I)chloride

3CuCl + Al ==> AlCl3 + 3Cu

for Copper (II) chloride

3CuCl2 + 2Al ==> 2AlCl3 + 3Cu

What is the correct formula to determine density?

Answers

D=M/V I hope this helps

Answer:

density =mass/volume

Explanation:

p=m/v

p means raw

m means mass

v means volume.

How would a long period without sunlight affect the food web? PLEZZ HELP MEH IF YOU WANT BRAINEIST AND LIKE COMMENTED


It would cause consumers to consume more food.

It would have no effect on the food web.

It would stop decomposers from breaking down matter.

It would stop producers from producing food.

Answers

Answer:

im pretty sure its the last one

Explanation:

if plants dont have sun light they will die because the sunlight gives them the nutrients to survive

A compound is found to contain 2.270 % hydrogen, 34.80 % phosphorus, and 62.93 % oxygen by mass. What is the empirical formula for this compound

Answers

Answer: The empirical formula is [tex]H_4P_2O_7[/tex]

Explanation:

If percentage are given then we are taking total mass is 100 grams.

So, the mass of each element is equal to the percentage given.

Mass of H= 2.270 g

Mass of P = 34.80 g

Mass of O = 62.93 g

Step 1 : convert given masses into moles

Moles of H =  [tex]\frac{\text {given mass}}{\text {Molar mass}}=\frac{2.270g}{1g/mol}=2.270[/tex]

Moles of P =  [tex]\frac{\text {given mass}}{\text {Molar mass}}=\frac{34.80g}{31g/mol}=1.122[/tex]

Moles of O = [tex]\frac{\text {given mass}}{\text {Molar mass}}=\frac{62.93g}{16g/mol}=3.933[/tex]

Step 2 : For the mole ratio, divide each value of moles by the smallest number of moles calculated.

For H =  [tex]\frac{2.270}{1.122}=2[/tex]

For P=    [tex]\frac{1.122}{1.122}=1[/tex]

For O =   [tex]\frac{3.933}{1.122}=3.5[/tex]

The simples ratio will be = H: P : O= 4: 2: 7

Hence the empirical formula is [tex]H_4P_2O_7[/tex]

Throwing a snowball during snowball fight is most like an example of

Answers

ittttt’ssss erosion.

what is the mass of 8.07 x 10^24 molecules of 02?

Answers

Answer:Avogadro's number 6.02 x 10^23 of O2 molecules has a mass of 32 gm (atomic weight of O = 16 gm, 2 x 16 = 32).

Explanation:pls brainless

Which is the weakest type of intramolecular force/bond?
a. Polar covalent b. Ionic c. Metallic d. Nonpolar covalent

Answers

Answer:

Non polar covlant

Explanation:

Which of the following would be most likely to experience strong intermolecular forces?

A. Molecules that contain no electrically charged regions.
B. Molecules that contain atoms of oxygen.
C. Molecules that are composed of solely ions.
D. Molecules that have both negatively and positively charged parts.

Answers

Answer:

The correct answer is D

Explanation:

Just took quiz

Other Questions
After the government ordered the removal of all American Indians from Illinois, a. Black Hawk attacked a militia led by Isaiah Stillman. b. the Sauk fought until they ran out of supplies. c. Black Hawks followers killed three delegates of a peace convention sent under a white flag to Saukenuk. d. Sauk forces attacked U.S. troops as they attempted to retreat across a river. Read this excerpt from the Supreme Court's Hazelwood v. Kuhlmeier dissenting opinion: The state educator's undeniable, and undeniably vital, mandate to [teach] moral and political values is not a general warrant to act as "thought police" stifling discussion of all but state-approved topics. . . . Official censorship of student speech on the ground that it addresses "potentially sensitive topics" is . . . impermissible.4 The reasoning in this opinion is most similar to the reasoning in which other Supreme Court ruling? A. New Jersey v. T.L.O. B. Miranda v. Arizona C. Gideon v. Wainwright D. Tinker v. Des Moines 1. Many plants can reproduce asexually. How is this an advantage for the plant? Why can it sometimes be a disadvantagefor the plant? Use details to support your answer. PLS ANSWER ASAP. ILL GIVE BRAINLIEST! Match the system for each of the following bodily organs.1.Nose a. Skeletal System2.Skull b. Circulatory System3.Kidneys c. Urinary System4.Veins d. Respiratory System Fill in the blank with the appropriate preposition.Paris est _____________ New York.a.) prs deb.) loin dec.) surd.) dans plz help timed MATHHHH 12 pointes Use the restriction enzyme EcoRi to cut DNAVictim DNA :GGAAG ATTCTACATTACTGACGGACGTGACGTGACCTTCTTAA GATGTAATGACTGCCTGCACTGACTNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 1 DNA :GGAATTAAGCTTATTG AATTCTTATAG AATTCGGGGCCCAAGCTTATG AATTCAATT CCTTAATTCGAATAACTTAA GAATATCTTAA GCCCCGGGTTCGAATACTTAA GTTAANumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :Suspect 2 DNA :CCATATAG AATTCAAGCTTAAG AATTCGGGGGAACGTTG AATTCAATTAATTGGGGGTATATCTTAA GTTCGAATTCTTAA GCCCCCTTGCAACTTAA GTTAATTAACCCNumber of restriction fragments ( pieces of DNA after digestion) :Size of restriction fragments ( count the number of bases on the top strand of each fragment , listed from largest to smallest ) :PLEASE HELPPP!!!!I WOULD APPRECIATE A LOT :) Select one of the readings in this unit, EXCEPT the Gettysburg Address, and in at least 150 words, discuss the historical context or cultural context the author demonstrates. How did Tisquantum help the Pilgrims????i will give brainliest and extra points Find the value of x in the image Read and choose the option with the regular verb in the imperfect tense.La princesa ley el libro.El rey no hablaba.La reina fue a la torre.El prncipe tom caf, Do you believe that parents should have all of the powers described in the Parents Constitution? Why or why not? answer the pic below How can you use density to separate mixtures like sand and small plastic pellets? How does the setting influence the theme of the story (pieces in the past ) story 15 points kareem drew a diagram to compare flatworms and segmented worms which label belongs in the area marked X?a. can reproduce sexuallyb. are always parasites c. are all sessiled. are covered in setaePLEASE HELP what is a technique that synchronizes two different audio and video signals, enabling you to mix images and graphics?WILL GIVE BRAINLY! Someone pls help me with both :( An ant bed contains about 230 ants. If there are 6 of these beds on the playground, how many ants are there? What was an effect of the Teapot Dome scandal?A. It increased public support for U.S. membership in the League ofNations.B. It increased public support for signing the Treaty of Versailles.O C. It resulted in laws passed by Congress to reform federal elections.D. It confirmed public concerns about relationships betweenbusiness and the Harding administration.