What is the correct type of circulatory system for members of class Reptilia?
Open - Oxygen is delivered to organs by blood washing over organs in the body cavity.
Closed - Oxygen is delivered to organs by blood traveling through arteries and veins.
O Closed - Oxygen is delivered to organs by blood washing over organs in the body cavity.
O Reptiles don't have a circulatory system.

Answers

Answer 1

Answer:

Closed the first one

Explanation:

In amphibians, reptiles, birds, and mammals, blood flow is directed in two circuits: one through the lungs and back to the heart, which is called pulmonary circulation, and the other throughout the rest of the body and its organs including the brain (systemic circulation).

most mammals, have closed cardiovascular systems. The two main circulation pathways in invertebrates are the single and double circulation pathways.


Related Questions

An earthquake occurred three hundred miles off the shoreline, and massive flooding occurred on land as a result.
Which best describes what occurred?
- Continental shifting resulted in a tsunami.
- Continental shifting resulted in a volcano erupting.
- Tidal activity in the subduction zone caused a tsunami.
- Tidal activity in the subduction zone caused a volcano to erupt.

Answers

Answer:

An earthquake occurred three hundred miles off the shoreline, and massive flooding occurred on land as a result. Which best describes what occurred? Continental shifting resulted in a tsunami.

Explanation:

The best thing that describes the scenario that occurred is tidal activity in the subduction zone caused a tsunami. The correct option is C.

What is tsunami?

The violent breaking of rock during an earthquake releases energy that travels through the earth in the form of resonance known as seismic waves.

These seismic waves radiate from the hypocenter in all directions, becoming weaker as they travel further away from the hypocenter.

Tsunamis are a series of large waves with extremely long wavelengths and periods that are usually caused by a violent, impulsive undersea disturbance or activity near the coast or in the ocean.

When a large earthquake ruptures, the faulting can cause vertical slip large enough to disturb the overlying ocean, causing a tsunami to travel in all directions.

Thus, the correct option is C.

For more details regarding tsunami, visit:

https://brainly.com/question/14782736

#SPJ6

Someone please help!!! Anyone!?!? I'll give A Brainliest

Answers

Answer:

These are Punnet squares. The answer for 1 is 50% The answer for 2 is 100%

The answer for 3 is 100%

Explanation:

I hope this helps!! Have a great day!!!

What is the purpose of cellular respiration

Answers

Answer:

Cells do cellular respiration to extract energy from the bonds of glucose and other food molecules. Cells can store the extracted energy in the form of ATP (adenosine triphosphate)

Explanation:

Answer:

The purpose of cellular respiration is to transfer energy from glucose to ATP. This is important because we need energy, and we use it to move.

1.
2.
3.
4.
What is the Answer?

Answers

Answer:

the answer is 3

Explanation:

Which refers to the sum of all the forces that act upon an object?

A. net force

B. absolute force

C. balanced force

D. positive force

Answers

Answer:

Net force

Explanation:

Net force is the vector sum of forces acting on a particle or body. The net force is a single force that replaces the effect of the original forces on the particle's motion. It gives the particle the same acceleration as all those actual forces together as described by the Newton's second law of motion.

Answer:

net force

Explanation:

- Lee el siguiente párrafo y a continuación responde lo que se te pide.Los seres humanos primitivos comenzaron a clasificar las plantas y los animales tanto por su utilidad como por el daño que les causaban, luego fueron profundizando aún más en sus conocimientos sobre la flora y la fauna de su entorno, identificando los ciclos biológicos y hábitat, entre otros aspectos que facilitaron su producción y pronta disponibilidad. Con base en el párrafo anterior se puede afirmar que: * 1 punto A) Empezaron a entablar una relación más estrecha con el medio ambiente. B) Abandonaron su vida primitiva y nómada C) Incrementaron sus conocimientos únicamente sobre el ciclo del agua. D) Empezaron la agricultura y la piscicultura.

Answers

Answer:

A) Empezaron a entablar una relación más estrecha con el medio ambiente.

Explanation:

Desde el pasaje, podemos ver que la gente comenzó a prestar más atención a su entorno y cómo la fauna y la flora afectan la vida humana.

Incluso intentaron desarrollar un sistema burdo de clasificación biológica. Henec, se puede inferir que las personas desarrollaron una relación más cercana con su entorno.

BRAINLIEST:
in which month is a hurricane most likely to occur: October or December? explain

Answers

Answer:

October

Explanation:

October is one of the hurricane season months

Its easy! If right will give brainlist! Don't overthink..:) Just answer

The virtual image changes with the position of the mirror to the eye when the mirror is..............?
Fill in the blanks

Answers

Answer:

When the mirror is inside the focal point..?

Ribosomes are the site where
protiens
are produced.
Amino acids are coded for by triplet bases in RNA called
condon
.

Answers

Answer:

That's true

Explanation:

But remember. What is produced actually is not a protein. It is a petide chain which is the first structure of protein.

When the peptide chain reaches its fourth structure ،it csn have its function in body.

Thats a complete protein.

Hope it helps.

PLZ HELP (30 POINTS)




Which of the following is a direct benefit of using agriscience to optimize land use for animal grazing?

Reducing soil degradation
Inventing new fertilizers
Updating irrigation
Increasing climate change

Answers

Answer: The answer is D Increasing climate change

Explanation: Which of the following is a direct benefit of using agriscience to optimize land use for animal grazing? hope this helps man

D

Explanation:

i think that's the answer

What is a society that is able to survive and function over a specified time?​

Answers

Answer:because time and society are different

Explanation:

HELP!!!!15 POINTS!!!!!!

i think it's f but idk..

Answers

Answer:

F is good

Explanation:

F is a very good choice

PLEASE HELP
the question is in the pic

Answers

the answer is genetic variation because crossing over leads to changing the traits inherited by the daughter cells

To achieve which of the following goals would rotational grazing be most appropriate? (3 points)
-To maximize livestock populations while minimizing costs
-To preserve vegetation and soil fertility of land
-To involve townspeople in the operations of a nearby farm
-To transform an abandoned city lot into a neighborhood garden

Answers

Answer:

To preserve vegetation and soil fertility of land

Explanation:

.

A person with a low number of white blood cells could have difficulty in fighting infections and A decrease in the number of lymphoid stem cells could result in a decrease in red blood cell.

What is nucleotide?

It is the sub units and buIlding blocks of DNA. It is made up of a five-sided sugar, phosphate group and then a nitrogen base.

These groups make the backbone of the DNA helix. If you look at a DNA helix, they make the side of the ladder or the side portion. They connect to a nitrogen base which make the steps of the ladder.  The type of sugar that is used in a DNA helix is called deoxyribose.

Nitrogen bases are the molecules that make up the steps of the ladders. There are four different nitrogen bases, namely; Guanine, Thymine,Adenine and Cytosine.

Pyrimidines are compounds that make a single 6-sided ring. Examples of pyrimidines are Cytosine and Thymine. Purines on the other hand make 5-sided and 6-sided rings.

Therefore, A person with a low number of white blood cells could have difficulty in fighting infections and A decrease in the number of lymphoid stem cells could result in a decrease in red blood cell.

Learn more about white blood cells on:

https://brainly.com/question/19202269

#SPJ5

Which of the following problems are environmental indicators of acid deposition?


Decreased pH levels in lakes and rivers
Decreased concentration of aluminum in the soil
Changes in development of indicator organisms of an ecosystem
II only
III only
I and III
I and II

Answers

Answer:

I and III

Explanation:

Acid deposition will decrease pH levels in lakes and rivers since it contaminates them and lowers their pH, and organisms may be affected by the increased acidity in their immediate surroundings, but aluminum has nothing to do with pH levels at all.

Hope thish elped!

Option I and III shows the problems of environmental indicators of acid deposition.

The following information should be considered:

The acid deposition should reduce the level of pH in terms of lakes and rivers as it contaminates also the organisms should impact when the acidity should be increased for the surroundings. But the aluminum does not have any relationship with pH levels.

Therefore we can conclude that options I and III are correct.

Learn more: brainly.com/question/13107711

PLSSSSS HELP ILL GIVE U A BRANLIEST

Answers

Answer:

C

Explanation:

the anser is c plz mark me

Answer:

I would say its D

Explanation:

In the United States, most racial discrimination comes in the form of ________ discrimination.

A. Direct
B. overt
C. indirect
D. extra​

Answers

Answer:

C, indirect because most people do not admit that they are racist and claim that they didn't do things because they're racist.

Explanation:

In the United States, most racial discrimination comes in the form of indirect discrimination. Therefore, option C is the correct option.

What is indirect discrimination?

Indirect discrimination involves the policies or practices that appear neutral on the surface, but deep down have adverse effects on the people belonging to a particular race.

Indirect discrimination can be seen in various areas, such as employment. During a job vacancy, the job applicant requires to speak a high level of proficient English which appears to be a reasonable requirement for the job, but it can lead to a significant impact on non-native English speakers.

Indirect discrimination can be seen in the education field where schools give admissions to only those students who will qualify for a specific education test which may seem unfair to students belonging to a specific race, and having different educational backgrounds.

Therefore, indirect discrimination is the most common form of discrimination observed in the United States.

Learn more about indirect discrimination here:

https://brainly.com/question/14710203

#SPJ7

People are more likely to seek treatment if they
A. are in a minority
B. live in a rural community
C. have medical insurance
D. have a diagnosis

Answers

Answer:

C. have medical insurance

Explanation:

People are more likely to seek treatment if they D. have a diagnosis as it helps in the treatment of disease.

The clinical diagnosis lets in a clinical expert chart a listing of clinical signs after which evaluate them to different data. A high-quality fitness final result is primarily based totally one scale of being alive and not using a long-time period results to death.

What is the diagnosis?

The act of spotting a disorder from its symptoms and symptoms and signs the realization this is reached following and trying out .The prognosis turned into pneumonia.

Thus it is well explained.

To learn more about the medical insurance refer to link :

https://brainly.com/question/1941778

17. Match the major types of cancer with the types of cells they occur in
Adenocarcinomas
a. The lowest layer of the epidermis (skin)
Basal cell carcinoma
b. upper layers of skin, the lining of stomach, lungs,
kidneys
Squamous cell carcinoma
c. melanin-producing cells of the skin
Sarcoma
d. immune cells in the blood (T cells, B cells, and
bone marrow)
Leukemia and lymphoma
e. bones, fat, blood vessels, tendons, ligaments
Multiple myeloma
1. cells that produce fluids (breast, colon)
Melanoma
g. plasma cells (a type of immune cells)​

Answers

LolsbdgsbcgcsnnsjzkmcjMCk

Chemicals and proteins in the cell read the DNA ___________ for building that make cells, tissue and organs.
(A.Instructions
(B.Genes
(C.Recipe
(D. Life manual

Answers

You answer will be B!! Good luckkk!

Genes of DNA can be read by chemicals and proteins for building that can make cells, tissue, and organs. Therefore, option "B" is correct.

What are genes?

Genes are composed of  DNA which is the genetic material. Gene is the functional unit of heredity. Chromosomes are comprised of multiple genes. Genes code for a particular trait. More than one gene can code for a particular trait.

The function of DNA and RNA is controlled by genes. There are more than 3000 genes present. Mutation can occur in genes. Deletion and insertion are some types of mutation genes. Transposomes are called jumping genes. Sickle cell anemia and cystic fibrosis are some examples of gene mutations.

Genes code for the traits such as the color of eyes, height quality of hair, and more.

Learn more about genes, here:

https://brainly.com/question/31121266

#SPJ2

explain how darwin's journey to the galapagos islands contributed to his creation of the theory of evolutions.

Answers

Explanation:

During his visit to the islands, Darwin noted that the unique creatures were similar from island to island, but perfectly adapted to their environments which led him to ponder the origin of the islands' inhabitants.

Among those that struck Darwin so greatly were the finches that are now named in his honor. Darwin would later base some of his thought from the supposing that these finches were all descendents of the same lineage.

What is an advantage to SMRs?
Select all that apply.


less atmospheric emissions


use fusion instead of fission

reduced cost


reduced construction time

Answers

Answer:

PLEASE MARK ME THE BRANIEST THANK YOU :)

Explanation:

The next decades are crucially important to putting the world on a path of reduced greenhouse gas emissions.

By the end of the century, demand for energy will have tripled under the combined pressure of population growth, increased urbanization and expanding access to electricity in developing countries. The fossil fuels that shaped 19th and 20th century civilization can only be relied on at the cost of greenhouse gases and pollution.

A new large-scale, sustainable and carbon-free form of energy is urgently needed. The following advantages make fusion worth pursuing.

Abundant energy: Fusing atoms together in a controlled way releases nearly four million times more energy than a chemical reaction such as the burning of coal, oil or gas and four times as much as nuclear fission reactions (at equal mass). Fusion has the potential to provide the kind of baseload energy needed to provide electricity to our cities and our industries.

Sustainability: Fusion fuels are widely available and nearly inexhaustible. Deuterium can be distilled from all forms of water, while tritium will be produced during the fusion reaction as fusion neutrons interact with lithium. (Terrestrial reserves of lithium would permit the operation of fusion power plants for more than 1,000 years, while sea-based reserves of lithium would fulfil needs for millions of years.)

No CO₂: Fusion doesn't emit harmful toxins like carbon dioxide or other greenhouse gases into the atmosphere. Its major by-product is helium: an inert, non-toxic gas.

No long-lived radioactive waste: Nuclear fusion reactors produce no high activity, long-lived nuclear waste. The activation of components in a fusion reactor is low enough for the materials to be recycled or reused within 100 years.

Limited risk of proliferation: Fusion doesn't employ fissile materials like uranium and plutonium. (Radioactive tritium is neither a fissile nor a fissionable material.) There are no enriched materials in a fusion reactor like ITER that could be exploited to make nuclear weapons.

I HOPE YOU LIKE MY ANSWER THANK YOU:)

to which class of macromelules do anitbodies belong to

Pls answer now I am giving 40 points

Answers

Answer

:proteins

The four classes of macromolecules are carbohydrates, proteins, nucleic acids, and lipids. These biomolecules can also be referred to as polymers. In turn, we will discuss how these four classes of macromolecules are synthesized in the cell from their constituent building blocks or monomers.

Explanation:

Antibody Classes. Antibodies can be divided into five classes—IgM, IgG, IgA, IgD, IgE—based on their physiochemical, structural, and immunological properties. IgGs, which make up about 80 percent of all antibodies, have heavy chains that consist of one variable domain and three identical constant domains.

Answer:

Antibodies are proteins. An antibody (Ab), also known as an immunoglobulin (Ig), is a large Y-shape protein produced by plasma cells that is used by the immune system to identify and neutralize foreign objects such as bacteria and viruses

Explanation:

34. Education, Fuel, Food and Clean water are all listed as important factors in limiting….
a. Human Development index
b. Gross Domestic Product
c. Infant Mortality
d. Carrying Capacity

Answers

Answer:

A. Human Development index

Explanation:

The Human Development Index is a statistic composite index of life expectancy, education, and per capita income indicators, which are used to rank countries into four tiers of human development.

hope i helped

its not gdp nor infant mortality nor carrying capacity

and much more

Answer: the answer is A

Explanation:

Which of the following statements regarding prokaryotic and eukaryotic cells is true

Answers

Answer:

I would need the statements to answer that. however prokaryotic cells are plant cells and eukaryotic cells are animal cells

Answer:

They are typically smaller than eukaryotic cells. The DNA of a prokaryotic cell is contained in the nucleoid. There are several ways in which prokaryotic cells are different from eukaryotic cells. Firstly, they are generally smaller in size, their organelles are not membrane bound, and they have no nucleus. They, however, share commonalities with eukaryotic cells including the presence of a bilipid plasma membrane, presence of ribosomes and DNA.

Hope this helps, have a great day/night, and stay safe!

Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide
chain, identifying the codons, anticodons, and amino acid sequence.
DNA: CGATACAATGGACCCGGTATGCGATATCC

Answers

I don’t feel like answering all that but....
C=G G=C T=A A=U
C=G A=T dont know the rest have a gcodocododd dday

what is the complementary dna strand of C-C-T-A-G-C-T

Answers

Answer:

G-G-A-T-C-G-A

Explanation:

The A-T pairs are connected by two hydrogen bonds, while the G-C pairs are connected by three hydrogen bonds.

Baby Brain Power
How does the bar graph on page 5 expand on
information presented in the passage?
It shows exactly how many synapses a person's
brain has at birth
Speech, emotional regulation, movement, and
vision-all of these extraordinary abilities and
many more are possible thanks to the organ
that serves as the body's control center. When
one thinks of "brain power, it is the faces of
adult inventors, professors, and novelists that
Ekely come to mind. Remarkably the most
critical time period with respect to brain
development occurs relatively soon after an
individual is bom.
A newborn enters the world as a fairly helpless
creature, but her brain hos billions upon
bitions of specialized cells coiled neurons.
It gives more information than the passage by
showing that the number of synapses returns to
what it was at birth.
It provides specific information about how many
synaptic connections are formed in each year of a
person's life.
It gives information about synaptic connections
beyond the time period described in the passage.
2
3
4
5

Answers

Answer:

C

Explanation:

Took it

Which statement best describes homeostasis in a cell?

A. Molecules are in equilibrium (balance) inside and outside the cell

B. Active transport causes molecules to move from low to high concentration the molecules are un-equal

C. Pathogens enter cells and infect those cells, causing them to malfunction

D. Cells do not maintain homeostasis with their external environments.

Answers

Answer:

I believe the answer is A. The cell is in an equilibrium inside and out when it goes through homeostasis.

Explanation:

the other liquid waste product in cellular respiration is

Answers

Answer: During the process of cellular respiration, carbon dioxide is given off as a waste product. This carbon dioxide can be used by photosynthesizing cells to form new carbohydrates. Also in the process of cellular respiration, oxygen gas is required to serve as an acceptor of electrons.

Explanation: Hope dis helps :)))))  

Answer:

the waste products are carbon dioxide and water

Other Questions
A 3900 kg truck is moving at 6.0 m/s what is the kinetic energy Robert is risk manager at TPT Bank has been asked to implement an updated badge reader system for addressing access control risk. Even though the risk was migrated, Robert observes some remaining risk linked with access control. What type of risk has been observed by Robert Create a five station circuit to practice and develop skills for a specific sport. Give the purpose free station. plz save me I need help as sonic The state of being united is called Populism monopoly unification Read the following lines from "Tangled in Pride."She was an artist with such flair,Her gift, to create beauty.What does the word flair mean as it is used in the poem?Lively energyStyle and natural talentExcellent speaking skillsBright and clean Will give brainlist if correct! Thanks if you do help! What is the value of the missing exponent in the equation 7.4 10= 0.074? Which of these are true of physical therapists? Check all of the boxes that apply.All physical therapists can diagnose.Physical therapists strengthen muscle and improve balance.Physical therapists do not prescribe medication.Physical therapists are considered doctors.Physical therapists are commonly called physiatrists. What ended the persicution of all Christians?A) The edict of constantineB) The fall of the Roman EmpireC) The spread of the Roman EmpireD) The death of the Apostle Paul please help its math!!! will give brainly and more points if correct please I need help The equations of four lines are given. Identify which lines are perpendicular.Line 1: y+8x=5Line 2: x+16y=5Line 3: y=6x7Line 4: y+3=18(x1) Lines 2 and 3 are perpendicular. Lines 1 and 2 are perpendicular. All four lines are perpendicular. Lines 1 and 4 are perpendicular. An element or compound used to enhance a semiconductor is called a(n) ____. The function f(x) = 2,000(1 + )12t models the balance in a savings account.The savings account had an initial balance of _ and compounds _ at an interest rate of _ Two fathers and two sons are in a car, yet there are only three people in the car. How? Burgers are sold in packs of 6Buns are sold in packs of 10Liam wants to buy the same number of burgers and buns.Work out the smallest number of packs of each items he could bu Earth's plate boundaries (edges) are usually found in the middle of the continents. True False how to graph y = x^2+3 A hotel has 128 rooms on each floor. There are 3 floors in all.If 334 of the rooms in the hotel have been cleaned, how many rooms still need to be cleaned? rooms still need to be cleaned. James and Mary were both saving some of their lunch money to purchase a new skate board. James started off with only $7 and he will save 56each week and Mary started off with $13 and she will save 57 each week. How much money will James and Mary have after 8 weeks? *BRAINLIEST BRAINLIEST BRAINLIEST BRAINLIEST**Determine whether or not each expression below is a perfect square. Explain why the expression is or is not a perfect square. If it is not a perfect square, find the perfect square that seems closest to the given expression and show how the perfect square can be adjusted to be the given expression.1. A(x)=x^2+6x+132. A(x)=2x^2+8x+14