Answer: Your answer is A
Explanation: I just took the test
what direction was the texas annexation in?
Identify the converted product of the photosynthesis process.
Which objects have the most eccentric orbits?
A. Uranus and Neptune
B. Jupiter and Earth
C Saturn and Venus
D. Mercury and Pluto
!!pls help!!
taj incorrectly states that autographs are also known as consumers that need to feed on other organisms, including plants and animals, to gain energy. which of the following best describes consumers that feed on other organisms such as plants and animals for energy?
A. carnivores
B. trophic levels
C. heterotrophs
D. herbivores
Herbivores best describes consumers that feed on other organisms such as plants and animals for energy.
What do you mean by herbivores?A herbivore is an animal anatomically and physiologically adapted to eating plant material, for example foliage or marine algae, for the main component of its diet.
Many herbivores have large, dull, flat teeth. These teeth are excellent for chewing and breaking down tough plant material. Carnivores have sharp, narrow teeth that are better for biting and tearing flesh. However, some herbivores also have strong, sharp teeth.
Examples of large herbivores include cows, elk, and buffalo. These animals eat grass, tree bark, aquatic vegetation, and shrubby growth. Herbivores can also be medium-sized animals such as sheep and goats, which eat shrubby vegetation and grasses.
Learn more about herbivores:
https://brainly.com/question/16786804
#SPJ2
All planets in the solar system have surfaces that are made up of either one of two materials. What are the two materials?
Answer:
are made of rock, containing common minerals like feldspars and metals like magnesium and aluminum.
Explanation:
The function of mitochondria and chloroplasts is related to energy. In what way does their function differ?
A.
Mitochondria produce energy in prokaryotic cells, while chloroplasts produce energy in eukaryotic cells.
B.
Mitochondria produce energy from food, while chloroplasts produce food from the Sun’s energy.
C.
In plants, mitochondria provide energy in non-green cells, while chloroplasts provide energy to cells in parts of the plant that are green.
D.
Mitochondria provide energy in the night, while chloroplasts provide energy in the day.
E.
Mitochondria provide energy from food synthesized by organelles other than chloroplasts, while chloroplasts provide energy through photosynthesis using the Sun’s energy.
Answer:
The answer is option E- Mitochondria provide energy from food synthesized by organelles other than chloroplasts, while chloroplasts provide energy through photosynthesis using the Sun’s energy.Explanation:
Can you share some interesting information about HIV?
Answer:
yes HIV can be transmitted through sex or already chewed food like your mom did for you when you were a baby it can also your mothers breast so i hope u drank out of a bottle
Explanation:
explain in details the mechanism of transportation in plants
Answer:
Plant transport systems move energy from leaves and raw materials from roots to all their parts. The xylem (tissue) moves water and minerals obtained from the soil to all other parts of the plants.
Explanation:
I hope I helped:)
At which type of technonic plate boundary is a volcano least likely to occur
Answer: A
coz its just sliding one another
Hope it is correct
^_^
Which is most likely the last to form
Write any three differences between mass and weight
please its aurgent fast
Answer:
See explanation
Explanation:
There are a number of differences between mass and weight, they include;
Mass is a scalar quantity whereas weight is a vector quantity.
Mass is dependent on the quantity of matter present in a body whereas weight depends on the acceleration due to gravity in a particular location on the earths surface.
The SI unit of mass is kilogram whereas the SI unit of weight is Newton.
How is the rock in the deep mantle similar to the rock in the parts of the mantle nearest the surface? How is it different?
Answer:
Rocks within the mantle contain more magnesium and iron than the ones in the crust. Difference: Rocks in the deep mantle are under intense heat and pressure.
when an experiment shows that two variable are closely related the experiment shows what
Answer:When an experiment shows that two variables are closely related, the experiment shows correlation between the two variables. Correlation helps to show how two variables are related and connected. Related variables are said to be correlated. For example, we can say, good health is correlated to daily exercise routine.
Explanation:
what happens to the neuron when u do drugs
Answer:
Explanation:
well different kinds of drugs can affect neuron activity an example is if you take pain pills it blocks the neurons that sense pain other drugs can give you high levels of dopamine, dopamine is the hormone that makes you feel good. that is why drug addictions are serious, and many cannot stop the addiction because it makes them feel good. and if you take the same dose over time your body gets a tolerance to the drug and you need a higher dose every time to get the same feeling and that can lead to an overdose or even death.
and no this is not copied :)
What determines which bases will be brought to the DNA strand during DNA replication?
Explain which processes take place during meiosis that lead to variation in inherited traits.
Answer:
We are left with four haploid cells; each one genetically different from each other and the parent cell. 8. Describe the three ways meiosis produces genetic variability. We have seen that meiosis creates variation three ways: crossing over, mutations caused during crossing over, and independent assortment.
what were some of the earliest life forms? and what were they like
Identity Factors in an Experiment
WARM-UP
Consider what you already know about scientific design. To set up an experiment testing whether
students' grades are affected by their level of exercise, which factors do you think you would need to keep
in mind? Check all that apply.
student gender
vpe of exercise
amount of exercise
what grades are measured
how long the experiment will last
what time of day the students exercise
how much time the students spend studying
DONI
Answer:
Did you copy and paste this from somewhere because i want to help but i don't understand it at all.
Explanation:
Lloyds lab partner is looking down into a test tube while he hears the contents by using a flame. Which action should Lloyd recommend to his partner if heating must continue?
Answer:
To stop looking throught the test tube. lol
Explanation:
Is sand called sand because its in between the sea and the land?
I'm asking the questions that need to be asked people! :'D
No, not at all. ... The English word 'sand' comes from Old Dutch/proto-German 'zand', which has nothing to do with either sea OR land, but referred originally to unstable ground, as near rivers.
I hate the English language sometimes, like: "waterfall". But anyways, I hope this helps ^^
Hmmm... I've never thought of that before... nice catch lol
Have a great day :D
If an organism is heterozygous for a particular trait, the organism
A.
has the same allele on both chromosomes in a chromosome pair.
B.
is missing alleles on the chromosomes in a chromosome pair.
C.
has different alleles on the chromosomes in a chromosome pair.
D.
has extra alleles on both chromosomes in a chromosome pair.
Answer: C.
has different alleles on the chromosomes in a chromosome pair
Explanation:
Hetero means different.
A heterozygous condition is one in which the child inherits various eye-color genes from both biological parents. For that particular gene, a heterozygous genotype exists when there are two distinct versions. Thus, option C is correct.
What is the particular trait for heterozygous organism?When two distinct alleles of a gene (one mutant allele and one wild-type allele) are present in a diploid organism's cells, that organism is said to be heterozygous at that particular gene locus.
Heterozygosity describes a particular genotype, since the cell or organism is referred to be a heterozygote just for the particular allele in question.
The heterozygote may, however, occasionally have a phenotype that is somewhere between the phenotypes of both homozygous parents.
Therefore, has different alleles on the chromosomes in a chromosome pair.
Learn more about heterozygous here:
https://brainly.com/question/29327683
#SPJ2
The primary function of DNA is to
(ONLY ANSWER IF YOU KNOW ITS RIGHT)
direct RNA to make lipids
store and transmit genetic information
control chemical processes within the cell
prevent mutations
Which of the following processes is NOT a physical or chemical change?
a. crushing
b. weighing
c. melting
d. passing electric current
Answer:
b
Explanation:
doesn't change anything
give two examples of asexual Productions
Answer:
Asexual Reproduction Examples
Blackworms or mudworms reproduce through fragmentation. Hydras reproduce through budding. Organisms such as copperheads undergo parthenogenesis. Sugarcane can be grown through v
please help
Explain how an organ and organelles are related
Answer:
Just as organs are separate body parts that perform certain functions in the human body, organelles are microscopic sub-units that perform specific functions within individual cells. Organelles are specialized structures that perform various jobs inside cells.
Organelles are microscopic subunits that carry out certain tasks within individual cells, whereas organs are distinct body sections that carry out specialized tasks for the human body.
What is the relation between organ and organelles?Literally, the phrase refers to “tiny organs.” Organelles provide specialized functions to keep a cell alive, much like organs like the heart, liver, stomach, and kidneys serve specific functions to keep an individual alive.
Atoms, molecules, organelles, cells, tissues, organs, organ systems, and the human organism are the major levels of organization in the body, going from the simplest to the most complex.
Like an organ in the body, an organelle is a subcellular structure that performs one or more particular functions for the cell.
Therefore, organ and organelles differ in their functioning.
Learn more about organ and organelles here:
https://brainly.com/question/22911736
#SPJ2
16. In which of the following situations are the phenotypes of F2 offspring expected to follow
the ratio of 9:3:3:1?
a. monohybrid cross for two unlinked traits
b. a monohybrid cross for two closely linked traits
c. a dihybrid cross for two unlinked traits
d. a dihybrid cross for two closely linked traits
Answer:
C
Explanation:
The F2 offspring of a cross would follow the ratio of 9:3:3:1 only if the cross is a dihybrid for two unlinked traits.
There is nothing like a monohybrid cross for two traits. A cross involving two traits is a dihybrid cross. Hence, options a and b are out of the equation.
A dihybrid cross for two closely linked traits would produce F2 offspring in another ratio that is different from 9:3:3:1 depending on the linkage map.
Hence, the correct option is C.
decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Answer:
GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong
Not all members of a species are the same. Every species exhibits (blank)
. For example, some beetles are green, while others are brown.
Not all individuals in a population will survive to reproduce. Those that do, pass their (blank)
to their offspring.
Answer:
Not all members of a species are the same. Every species exhibits
variation.
For example, some beetles are green, while others are brown.
Not all individuals in a population will survive to reproduce. Those that do, pass their traits, genes to their offspring.
Explanation:
Got it right. Hope it helps :)
I need help with this (last question I had had the picture all black)
Answer:
I only know A
I think it's the lap
construct a flowchart (using “->”) (or explain) that depicts all the energy transfers that occur from the sun to the milk of your cereal
Answer:
dragon warrior or whatever it is called I don't maybe I am right