what important fibers are produced by the above structures during mitosis

Answers

Answer 1

Answer:

Spindle Fibers

Explanation:

Spindle fibers form a protein structure that divides the genetic material in a cell.


Related Questions

PLEASE HELP ASAP Match each word with the phrase that best defines it.
informal
a statement that is objective or unchanging
fact
done in a way that is friendly or casual
formal
a statement that is subjective or based on
interpretation
topic
done in a way that is suitable, appropriate,
or based on guidelines
opinion
the main point of a given subject

Answers

Answer:

fact: a statement that is objective or unchanging

informal: done in a way that is friendly or casual

formal: done in a way that is suitable, appropriate,

or based on guidelines

opinion: a statement that is subjective or based on

interpretation

topic: the main point of a given subject

Match each word with the phrase that best defines it.

1. Fact: a statement that is objective or unchanging

2. Informal: done in a way that is friendly or casual

3. Formal: done in a way that is suitable, appropriate, or based on guidelines

4. Opinion: a statement that is subjective or based on interpretation

5. Topic: the main point of a given subject

What are Phrases?

A phrase is a group of words or a singular word which functions as a grammatical unit. For example, the English expression "the very happy boy" is a noun phrase containing the adjective phrase "very happy".

It can be a single word or a complete sentence. Phrases are used to describe the people, things, or events.

There are following types of phrases. They are:

Noun phrase.Adjective phrase.Adverb phrase.Verb phrase.Prepositional phrase.Gerund phraseInfinitive phraseParticipial phrase

Thus, matching the following words with its phrases

1. Fact: a statement that is objective or unchanging

2. Informal: done in a way that is friendly or casual

3. Formal: done in a way that is suitable, appropriate, or based on guidelines

4. Opinion: a statement that is subjective or based on interpretation

5. Topic: the main point of a given subject

Learn more about Phrases, here:

https://brainly.com/question/15806900

#SPJ2

Describe the two signals and pathways that are activated when you touch something and experience pain

Answers

The medial thalamus projects to widespread areas of the forebrain, including the somatosensory cortex. Thus there are two major ascending pathways for pain: a direct lateral spinothalamic pathway and an indirect medial spinoreticulothalamic pathway.

what is the relation between cell cycle disruption and cancer?
I need help!!!?

Answers

Cancer is the result of unchecked cell division caused by a breakdown of the mechanisms that regulate the cell cycle. The loss of control begins with a change in the DNA sequence of a gene that codes for one of the regulatory molecules. Faulty instructions lead to a protein that does not function as it should.
Cancer is the result of unchecked cell division caused by a breakdown of the mechanisms that regulate the cell cycle. The loss of control begins with a change in the DNA sequence of a gene that codes for one of the regulatory molecules. Faulty instructions lead to a protein that does not function as it should.

Process performed by plants (producers) using the sun's energy to make their own food.
A. Conduction
B. Photosynthesis
C. Fission
D. Fusion

Answers

Answer: B.Fotosintesis

Explanation:

Answer:

option B

Explanation:

photosynthesis is the correct answer.

plz mark my answer as brainlist plzzzz.

hope this will be helpful to you.

PLEASE ANSWER ALL QUESTIONS! THANKS!

Which of the following statements about salinity is true?
Question 1 options:

Ocean water near areas with low evaporation has higher salinity.


Ocean water in regions with high levels of precipitation has higher salinity.


Ocean water near rivers has a lower salinity.


Ocean water in areas with high humidity has a higher salinity



How are latitude and temperature related?








Question 2 options:

Lower latitudes will have warmer water because it is closer to the equator.


Higher latitudes will have warmer water because it is closer to the equator.


Higher latitudes will have warmer water because it is closer to the poles.


Lower latitudes will have warmer water because it is closer to the poles


How does salinity vary with freezing and melting?









Question 3 options:

Both freezing and melting decrease salinity.


Both freezing and melting increase salinity.


Freezing decreases salinity, while melting increases salinity.


Freezing increases salinity, while melting decreases salinity.


How does salinity vary with evaporation?









Question 4 options:

When water evaporates, it takes salt with it, increasing its salinity.


When water evaporates, it leaves salt behind, increasing its salinity.


When water evaporates, it leaves salt behind, decreasing its salinity.


When water evaporates, it takes salt with it, decreasing its salinity.

Answers

Answer:

that guys answers are all wrong except for #3

Explanation:

i took the quiz and got 1/4

Name one adaptation that allows desert plants to survive with little water?

Answers

Answer:

stomata

Explanation:

This adaptation helps cacti reduce water loss by keeping the hot, dry wind from blowing directly across the stomata. The leaves and stems of many desert plants have a thick, waxy covering.

using the count data and observational data you acquired calculate the number of cfus in the original sample

Answers

Answer:

cuales son los datos ?

Explanation:

cuales son los datos

B cells can divide to form plasma cells. Each plasma cell contains many mitochondria
and an extensive endoplasmic reticulum. Referring to the function of plasma cells in your answer, explain why these features are important adaptations.

Answers

Answer:

Explanation:

The presence of mitochondria  and an extensive endoplasmic reticulum are the features that are important for adaptations of the plasma cell because plasma cells (white blood cells) secrete immune proteins also called antibodies which only formed due to the presence of endoplasmic reticulum whose function is to formed proteins for the cell so that's why plasma cells have large sized endoplasmic reticulum.

PLEASE HELP
Match the monomer to the polymer.
A.Amino acid B.glycogen
C. Nucleotide.
D.phospholipid Monosaccharide.
E.DNA
F.Fatty acids and glycerol.
G.protein collagen​

Answers

Nucleotide (DNA)

Amino acid (protein collagen​)

Monosaccharide (glycogen)

Fatty acids and glycerol (phospholipid)

In this lab, you used a dichotomous key to identify organisms. Why would this skill be valuable to you? Check all possible reasons below.

A. It helps you classify organisms.

B. It helps you identify ecosystems.

C. It helps you study and appreciate biodiversity.

D. It helps you analyze an organism’s traits.

E. It helps you understand how organisms interact.

Answers

Answer:

All of Them

Explanation:

got right in edg (see pic)

hope this helps :)

In a sex linked trait, the recessive phenotype is most often found in males because...

Answers

Answer:

X-linked recessive diseases most often occur in males. Males have only one X chromosome. A single recessive gene on that X chromosome will cause the disease. The Y chromosome is the other half of the XY gene pair in the male.

Explanation:

Why are you learning this stuff anyways.Girl????????

Which statement best explains how the gases of the atmosphere affect the temperature of Earth?

Answers

The atmosphere today contains more greenhouse gas molecules, so more of the infrared energy emitted by the surface ends up being absorbed by the atmosphere. Since some of the extra energy from a warmer atmosphere radiates back down to the surface, Earth's surface temperature rises.

How do living organisms return carbon to the atmosphere in the carbon cycle

Answers

Answer:

Carbon enters the atmosphere as carbon dioxide from respiration and combustion. Carbon dioxide is absorbed by producers to make glucose in photosynthesis

Living organisms return carbon to the atmosphere in the carbon cycle by two  process namely respiration and combustion. Carbon dioxide is absorbed by producers to make glucose in photosynthesis.

What is photosynthesis?

A photosynthesis is a biochemical process which occurs in plants, algae, and bacteria, when they are exposed to sunlight. During photosynthesis, water and carbon dioxide join to form sugars and give off oxygen.

Respiration is defined as the inhaling of oxygen and the exhaling of carbon dioxide and combustion is defined as the process in which a substance burns in the presence of Oxygen, produce off heat and light in the process.

For more information regarding carbon cycle, visit:

https://brainly.com/question/10861032

##SPJ2

1. DNA base sequence: GACGATGTAGCATCGACCATTG.
What would the mRNA sequence for this sequence of DNA be?

Answers

CUGCUACAUCGUAGCUGGUAAC

I AM LITERALLY CRYING RIGHT NOW PLEASEE HELPPP WILL MARK BRANLIEST HELPPP MEE

Part 1: Explore

Based on your research and observations of the three common states of matter, answer the

following questions.

Out of the videos, animations, and images you researched, which was your favorite? Why?

Do you feel it accurately represented the differences between each state of matter


How does the space between the particles in each state of matter differ?

How do the particles in each state of matter move?

Part 2: Explain

Examine the heating curve of water below, and then answer the questions about it. If you require the use of a text reader, open the file Heating Curve of Water to receive the information.


Which three parts of the graph’s curve represent the solid, liquid, and gaseous state of water?

Explain your reasoning.

Which point of the graph’s curve represents the melting point of water? Explain your reasoning.

Which point of the graph’s curve represents the boiling point of water? Explain your reasoning.

What happens to the energy of water in Part B and Part D of the graph’s curve? How do you know?

Why does the temperature of the water stay the same when it melts and boils?

Now comes the hands-on part of your project! You will continue to explore phase changes by performing an experiment and creating your own heating curve. Before you begin your experiment, read over the following information.


The materials you will need for your experiment are listed below.


small pot

measuring cup (must have mL and oz markings)

spoon (wooden, plastic, or metal)

ice

water

stove

thermometer (should have units in °C

Time (min) Temperature of Water (°C) Observations of Water

0

1

2

3

4

5

6

7

8

9

10

11

12

13

14

15

Place 14 oz of crushed ice into a small pot. Then add about 125 mL of water to it.

Using the thermometer, measure and record the initial temperature of the ice water. List this temperature in °C in the “0” minutes row of your data table in the lab handout. *Do not allow the thermometer to touch the bottom of the pot when recording measurements.

Place the pot on the stove, and turn the knob to the medium-low setting.

Using the thermometer, measure the temperature every minute until the water begins to boil vigorously. Record this data in the table on your lab handout.

At each measurement, also record what is happening to the water. Be sure to record the times of these events:

The ice melts.

The water forms steam.

The water begins to boil.

Once the water has begun to boil, stir the water constantly with the spoon.

Continue to measure and record the temperature every minute until almost all the water has boiled and the pot is close to empty.

Record the last temperature, and turn off the stove. DO NOT TOUCH THE POT WITHOUT SAFETY EQUIPMENT.

Create the x-axis and y-axis of a graph.

Label the x-axis as follows: Time (min).

Label the y-axis as follows: Temperature of Water (°C).

Along the x-axis, create and label 15 marks, one for each minute of the experiment. (Hint: The origin starts at 0.)

Along the y-axis, create and label temperature markings for every 20 degrees. (Hint: The origin starts at 0.)

Refer to the data from your experiment to plot the points on your graph. Then connect each of the data points with a line.

Look over your graph to make sure it is clear and correctly labeled.

Either save your graph as a computer file, or take a picture of your graph and upload it as a file on your computer.

Describe your experience in performing the experiment. What went well? What could have been

improved?

Examine your line graph. How does the graph’s slope change over time?

Examine your line graph. Why does the slope change?

How could you apply the knowledge gained from this experiment in the real world?

Hint: Think of cooking.

Make a prediction. How do you think adding other substances to the water would affect its

heating curve?

THANK YOU SO MUCH

Answers

Answer:

think of cooking

Explanation:

the reason is that I just know it

Biology Grade 8
Match correct terms/meaning given in column 'B' with their correct levels
given in column 'A' with Column 'B'

Column A
a.Cell
b.Plant
c.Tissue
d.nose
e.organelle

column B
a.Group of similar cells
b.Heart
c.Ova
d.Organ
e.Group of different cells
f.Nucleus
g.organism

Answers

Answer:

cell=ova

plant=organism

tissue=group of similar cells

nose=organ

organelle=nucleus

A friend says that all bacteria are harmful to people list three reasons this statement is incorrect.

Answers

-autotrophic bacteria give off oxygen (O2)
-flavor foods such as vinegar, yogurt, cheese, etc. (pasteurization)
-decomposers (bacteria)- recycle nutrients in food web
-enviromental clean-up- bacteria eat oil from oil spills
0health and medicine- bacteria break down food in your intestines/make

Despite his fear of germs, Howard Hughes neglected his own hygiene despite having those around him follow strict cleanliness practices. Hughes had these odd behaviors because __________.
A.
he believed he was unable to escape any infection
B.
he developed obsessive-compulsive disorder at an old age
C.
he thought he would be contaminated from the outside
D.
his paralysis at a young age prevented him from being self-sufficient

Answers

Answer: it’s c he thought he would be contaminated from the outside

Explanation:

I took the test

Howard Hughes neglected his own hygiene despite having those around him follow strict cleanliness practices. Hughes had these odd behaviors because he thought he would be contaminated from the outside.

What is importance of cleanliness?

Cleanliness gives rise to a good character by keeping body, mind, and soul clean and peaceful. The cleanliness only which helps to improve our personality by keeping clean externally and internally.

Thus, option "C" is correct.

To learn more about cleanliness click here;

https://brainly.com/question/4279403

The Colorado River provides water and electricity for over 40 million people. But so much water is withdrawn from this river for agriculture/livestock and drinking water, that very little of it reaches the sea. Due to drought and overuse, it currently is drying up. This will be a major problem because crops and livestock in the USA depend on this water. What percent of the nation's crops and livestock rely on the river's water?​

Answers

Answer:

About 80%

Explanation:

I might be wrong but at least 80%

explain how the cells, tissue, and organs within the circulatory system work together to enable it to perform its function of pumping materials around the body and removing waste products such as carbon dioxide.

Answers

Answer:

the body has levels of organization that build on each other.Cells make up tissues,tissues make up organs,and organs make up organs system.

Which of the following options best depicts the process of protein synthesis?

1. protein → RNA → DNA
2. DNA → amino acid → RNA → protein
3. DNA → RNA → protein
4. RNA → DNA → RNA → protein

Answers

During translation, the genetic code in mRNA is read and used to make a protein. These two processes are summed up by the central dogma of molecular biology: DNA → RNA → Protein.

where is the gene found?
what's the function of the gene?
what's the structure of the gene?

Answers

Answer:

gene found in the Dna its in the nucleus

Put "Sympatric Speciation" in a sentence

Answers

Answer:

A 2008 study suggests that sympatric speciation has occurred in Tennessee cave salamanders.

Explanation:

Hope this helps

If one DNA strand reads CCGTAATGCAT, what will be the sequence of the complimentary strand?

Answers

The complimentary strand would be GGCATTACGTA

What is the universe made of

Answers

Answer:

composition

Explanation:

the universe is composed almost completely of dark energy, dark matter , and ordinary matter

Answer: matter , atoms

Explanation:

HELP NEED THIS BY TODAY!
What did Mendel study that lead him to his discovery

Answers

Answer:

A monk, Mendel discovered the basic principles of heredity through experiments in his monastery's garden. His experiments showed that the inheritance of certain traits in pea plants follows particular patterns, subsequently becoming the foundation of modern genetics and leading to the study of heredity.

Explanation:

Answer:

Mendel studied the genetics of pea plants.

Explanation:

Mendel looked at the pea plants in his monastery garden to determine genetics. He found that some plants had white flowers, while some did not, and he used that discovery to determine the genetics of the plants.

5. All cells
a. Are enclosed in a membrane that maintains internal conditions different from the surroundings
b. Have DNA as genetic material
c. Require energy to function
d. All of the above are correct

Answers

I’m pretty sure it’s D

15 Which of the following mutations would have the potential to affect future
generations of a species?
A A frame shift mutation in the X chromosome of a cheek cell
B A chromosomal mutation in the Y chromosome of a kidney cell
CA point mutation in the first chromosome of a sperm cell
D A substitution mutation in the third chromosome of a uterus cell

Answers

Answer:

c i think

Explanation:

I don't know just trying to help hope you have a good day

The answer is c a point mutation in the first chromosome of a sperm cell

In guinea pigs, white coat color is determined by the allele W. Black coat color is controlled by the allele w. Cross a white & black spotted pig with a black pig.

W = white

w = black

What percentage of the offspring will be black?

Answers

Answer:

About 75%

Explanation:

About 75% will have two ww alleles, while the rest will have Ww alleles.

75 percent I think that’s right

How can a material at a certain temperature have all of its molecules at the same energy?

Answers

it can be frozen (32°F or 0°C) which would slow the energy of the molecules. or it could be boiled (212°F or 100°C) which would rapidly increase the speed of the molecules.
Other Questions
Please help!!!! Grizzly bears and polar bears are very closely related, so much so that they can reproduce to form hybrid offspring. Use your understanding of natural selection to describe how polar bears became a separate classification from the grizzly. Which of the following did Truman promise in the Truman Doctrine?THIS IS A UNIT QUESTION HELP!-Econmic assistance to democratic countries who were threatened by communism-Political assistance to democratic countries who were threatened by communism-Free education to democratic countries who were threatened by communism -Military assistance to democratice countries who were threatened by communism Encontrar la media, mediana, moda y rango de los siguiente valores:84,91, 72,68,87, 78,65,87,79. Harry and his family travel 204 miles in 3.4 hours. If they continue at this constant speed, how long will it take them to travel 420 miles? structures of bacterial cells. what are the major macromolecule for Capsule, gram-positive cell wall, endospore, pilus, fimbriae, plasmid, plasma membrane, and ribosomes? Please help I will give brainliest 16Select the correct answer.Which of these numbers are 11 units from 0 on the number line?A: 0B: +11C: -11O A.A and BO B.A and CO C.B and COD. Conly Question 8Using Henry's Law: Sz/P1-S2/P2To increase the solubility of a gas at constant temperature and 202kPa pressure from0.85g/L to 5.1g/L, the pressure would have to be increased to:A.505kPaB.17.2kPaC.606kPaD.1212kPa A mooncake with two egg yolks costs $2 more than a mooncake with one egg yolk. The cost of 6 mooncakes with two egg yolks and 5 mooncakes with one egg yolk is $130.80. Find the cost of a mooncake with two two egg yolks.Plz do in algebraic method Yep here we go again:The x-axis represents the number of hours before or afternoon, and the y-axis represents the temperature in degrees Celsius.At 9 a.m., it was below freezing. In what quadrant would this point be plotted? Use Roman Numerals in your answer: Either I, II, III, or IV At 11 a.m., it was 10 degrees Celsius. In what quadrant would this point be plotted? Here is the image T ^ T ( I will also give brainliest!) entre las fracciones 33/96 y 34/96 podran encontrarse ms nmeros fraccionarios? cuntos? The mass (in grams) of FeSO4.7H2O required for preparation of 125 mL of 0.90 M solution is difference between teacher and doctor What is Newton's Second Law?1.The attraction between objects2.An object at rest tends to stay at rest and an object in motion tends to stay in motion unless acted upon by an unbalanced force3.An object's acceleration depends on its mass and on the net force acting on it.4.For every action there is an equal and opposite reaction Please help ten points I don't know I need help.Which of the following numbers can be expressed as repeating decimals?3 over 7, 2 over 5, 3 over 4, 2 over 9 2 over 9 and 3 over 4 3 over 7 and 2 over 5 2 over 5 and 3 over 4 3 over 7 and 2 over 9 I'LL GIVE BRAINLIEST: CHOOSE TWO PHRASES Which of the following remain a part of your driving recored for life?Having no insurance and or DWI Vehicle crashesParking ticketsTraffic violations Congress passed a bill creating the Freedmen's Bureau, a government agency to help former slaves. Lincoln signed the bill. Can any one help me on this question ?