What do we call an organism that is not native to an environment, but is able to thrive anyway?

Answers

Answer 1

Answer:

An invasive species

Explanation:

Invasive species come from other environments, many times on accident, but usually thrive so much that they end up taking over and starving other native creatures by taking the resources. Hope this helps! (Brainliest appreciated :))


Related Questions

I AM LITERALLY CRYING RIGHT NOW PLEASEE HELPPP WILL MARK BRANLIEST HELPPP MEE

Part 1: Explore

Based on your research and observations of the three common states of matter, answer the

following questions.

Out of the videos, animations, and images you researched, which was your favorite? Why?

Do you feel it accurately represented the differences between each state of matter


How does the space between the particles in each state of matter differ?

How do the particles in each state of matter move?

Part 2: Explain

Examine the heating curve of water below, and then answer the questions about it. If you require the use of a text reader, open the file Heating Curve of Water to receive the information.


Which three parts of the graph’s curve represent the solid, liquid, and gaseous state of water?

Explain your reasoning.

Which point of the graph’s curve represents the melting point of water? Explain your reasoning.

Which point of the graph’s curve represents the boiling point of water? Explain your reasoning.

What happens to the energy of water in Part B and Part D of the graph’s curve? How do you know?

Why does the temperature of the water stay the same when it melts and boils?

Now comes the hands-on part of your project! You will continue to explore phase changes by performing an experiment and creating your own heating curve. Before you begin your experiment, read over the following information.


The materials you will need for your experiment are listed below.


small pot

measuring cup (must have mL and oz markings)

spoon (wooden, plastic, or metal)

ice

water

stove

thermometer (should have units in °C

Time (min) Temperature of Water (°C) Observations of Water

0

1

2

3

4

5

6

7

8

9

10

11

12

13

14

15

Place 14 oz of crushed ice into a small pot. Then add about 125 mL of water to it.

Using the thermometer, measure and record the initial temperature of the ice water. List this temperature in °C in the “0” minutes row of your data table in the lab handout. *Do not allow the thermometer to touch the bottom of the pot when recording measurements.

Place the pot on the stove, and turn the knob to the medium-low setting.

Using the thermometer, measure the temperature every minute until the water begins to boil vigorously. Record this data in the table on your lab handout.

At each measurement, also record what is happening to the water. Be sure to record the times of these events:

The ice melts.

The water forms steam.

The water begins to boil.

Once the water has begun to boil, stir the water constantly with the spoon.

Continue to measure and record the temperature every minute until almost all the water has boiled and the pot is close to empty.

Record the last temperature, and turn off the stove. DO NOT TOUCH THE POT WITHOUT SAFETY EQUIPMENT.

Create the x-axis and y-axis of a graph.

Label the x-axis as follows: Time (min).

Label the y-axis as follows: Temperature of Water (°C).

Along the x-axis, create and label 15 marks, one for each minute of the experiment. (Hint: The origin starts at 0.)

Along the y-axis, create and label temperature markings for every 20 degrees. (Hint: The origin starts at 0.)

Refer to the data from your experiment to plot the points on your graph. Then connect each of the data points with a line.

Look over your graph to make sure it is clear and correctly labeled.

Either save your graph as a computer file, or take a picture of your graph and upload it as a file on your computer.

Describe your experience in performing the experiment. What went well? What could have been

improved?

Examine your line graph. How does the graph’s slope change over time?

Examine your line graph. Why does the slope change?

How could you apply the knowledge gained from this experiment in the real world?

Hint: Think of cooking.

Make a prediction. How do you think adding other substances to the water would affect its

heating curve?

THANK YOU SO MUCH

Answers

Answer:

think of cooking

Explanation:

the reason is that I just know it

Construct an argumentative paragraph. Do you believe it's ethical or unethical to artificially select traits in plants and or animals? Provide evidenco to suoport your claims. It doesn't matter what side you chose, but I need it asap.​I will give you any mark you want.​

Answers

Answer:

The ethics of artificially inserting traits in animals has been in the practice for years in the form of selective breeding, but should scientists really be editing DNA to the extent they are today? I don't believe they should. Life itself should construct itself without us interfering. Making a brand new plant just because it looks nice doesn't account for many factors, including the fact that it could be harmful to nearby plants if pollinated. In addition, generic engineering costs quite a lot of money, which should be used on other more cost effective methods, such as improving agriculture rather than creating a whole new plant that could harm entire crops. Genetic engineering isn't a necessity and humans should not play God with plant and animal life.

Fill in the blanks the world banks the word bank is on the picture provided below :)

Answers

Answer:

1 is pioneer species 2 is limiting factor 3 is ecological succession

Explanation:

Answer:

1) pioneer

2) limiting factor

3) ecological succession

How can you determine the number of bonds an atom can make

Answers

Answer:

The number of bonds for a neutral atom is equal to the number of electrons in the full valence shell (2 or 8 electrons) minus the number of valence electrons. This method works because each covalent bond that an atom forms adds another electron to an atoms valence shell without changing its charge.

Virtual Lab
Active
Create a dichotomous key.
O
Magnifying Glass
Drag your question here.
Legs
Wings
Antennae
Stinget
Claws
Please help

Answers

Answer:

WHAT ARE YOU TRYING TO ASK BRO

Process performed by plants (producers) using the sun's energy to make their own food.
A. Conduction
B. Photosynthesis
C. Fission
D. Fusion

Answers

Answer: B.Fotosintesis

Explanation:

Answer:

option B

Explanation:

photosynthesis is the correct answer.

plz mark my answer as brainlist plzzzz.

hope this will be helpful to you.

Can someone answer this for me?

Answers

Answer:

Outside

Explanation:

The word outside makes the most sense in this sentence.

Hope it helps!

HELP NEED THIS BY TODAY!
What did Mendel study that lead him to his discovery

Answers

Answer:

A monk, Mendel discovered the basic principles of heredity through experiments in his monastery's garden. His experiments showed that the inheritance of certain traits in pea plants follows particular patterns, subsequently becoming the foundation of modern genetics and leading to the study of heredity.

Explanation:

Answer:

Mendel studied the genetics of pea plants.

Explanation:

Mendel looked at the pea plants in his monastery garden to determine genetics. He found that some plants had white flowers, while some did not, and he used that discovery to determine the genetics of the plants.

which statement best describes the difference between the sympathetic and parasympathetic nervous systems?

Answers

Parasympathetic system calms you down lets all your organs have the same amount of oxygen delivered. The sympathetic system gets your muscles moving and makes you excited.

Please help!!!! Grizzly bears and polar bears are very closely related, so much so that they can reproduce to form hybrid offspring. Use your understanding of natural selection to describe how polar bears became a separate classification from the grizzly.

Answers

Scientists believe that at first these bears scavenged seal carcasses that had washed ashore, and gradually began to hunt the seals by waiting at the water's edge as the seals surfaced to breathe. This is believed to be an important step in the evolution of a new bear species, the polar bear

Over time the new polar bears were used to the cold climate and learnt how to fish, they then separated from the grizzly bears, they developed new creatures which would help them survive in one of the most dangerous climate.

Polar bears become separate classification from the grizzly by the natural selection known as divergent and adaptive evolutionary change.

Polar bears and grizzly bears are considered as closed to one another so they can interbreed. They both diverged from one another due to the harsh climate of the Arctic and the ecology of the region.

The changes that took place are camouflaging and pigment-free fur-coat that helped them in order to adapt to the different climates.The genetic mutation leads to such Adaptive changes when the polar bears migrated northwards.The populations living in different climates undergo natural selection that is divergent natural selection and the adaptive evolutionary changes that result in different species.

Learn more about speciation:

https://brainly.com/question/4493180

Name one adaptation that allows desert plants to survive with little water?

Answers

Answer:

stomata

Explanation:

This adaptation helps cacti reduce water loss by keeping the hot, dry wind from blowing directly across the stomata. The leaves and stems of many desert plants have a thick, waxy covering.

I hit a substance with a hammer and it shatters.It is a

Answers

Answer:

non metal ,so it is brittle in nature

Which of the following options best depicts the process of protein synthesis?

1. protein → RNA → DNA
2. DNA → amino acid → RNA → protein
3. DNA → RNA → protein
4. RNA → DNA → RNA → protein

Answers

During translation, the genetic code in mRNA is read and used to make a protein. These two processes are summed up by the central dogma of molecular biology: DNA → RNA → Protein.

PLEASE HELP
Match the monomer to the polymer.
A.Amino acid B.glycogen
C. Nucleotide.
D.phospholipid Monosaccharide.
E.DNA
F.Fatty acids and glycerol.
G.protein collagen​

Answers

Nucleotide (DNA)

Amino acid (protein collagen​)

Monosaccharide (glycogen)

Fatty acids and glycerol (phospholipid)

What is the universe made of

Answers

Answer:

composition

Explanation:

the universe is composed almost completely of dark energy, dark matter , and ordinary matter

Answer: matter , atoms

Explanation:

The Colorado River provides water and electricity for over 40 million people. But so much water is withdrawn from this river for agriculture/livestock and drinking water, that very little of it reaches the sea. Due to drought and overuse, it currently is drying up. This will be a major problem because crops and livestock in the USA depend on this water. What percent of the nation's crops and livestock rely on the river's water?​

Answers

Answer:

About 80%

Explanation:

I might be wrong but at least 80%

The vocal cords stretch across the opening of the larynx. True or false??

Answers

Answer:

True

Explanation:

Vocal cords are bands of smooth muscle tissue located in the larynx. When air passes through, the vocal cords vibrate.

Answer: True

Explanation:

The vocal folds, also known popularly as vocal cords, are composed of twin infoldings of mucous membrane stretched horizontally across the larynx. They vibrate, modulating the flow of air being expelled from the lungs during phonation.

What are some factors that can cause observed evolutionary change?

Answers

Answer:

There are four such forces: mutation, gene flow, genetic drift, and natural selection.

Explanation:

Answer:

natural selection, random genetic drift, mutation, population mating structure, and culture.

Explanation:

I hope this helps! ^^

☁️☁️☁️☁️☁️☁️☁️☁️

A friend says that all bacteria are harmful to people list three reasons this statement is incorrect.

Answers

-autotrophic bacteria give off oxygen (O2)
-flavor foods such as vinegar, yogurt, cheese, etc. (pasteurization)
-decomposers (bacteria)- recycle nutrients in food web
-enviromental clean-up- bacteria eat oil from oil spills
0health and medicine- bacteria break down food in your intestines/make

Which feature of chytrids makes them different from the other types of fungi? the material that strengthens their cell walls the special digestive material they release their use of budding to reproduce their ability to live in dry environments

Answers

Answer:

the material that strengthens their cell walls

Explanation:

Chytrids originate from the kingdom fungi and a division known as Chytridiomycota. They contain a feature of unique characteristics by the presence of the chitin and the cellulose cell wall. The chitin made up the component of their cell wall in fungi but in Chytrids, the cellulose helps to strengthens their cell walls.

Answer:

A. the material that strengthens their cell walls

explain how the cells, tissue, and organs within the circulatory system work together to enable it to perform its function of pumping materials around the body and removing waste products such as carbon dioxide.

Answers

Answer:

the body has levels of organization that build on each other.Cells make up tissues,tissues make up organs,and organs make up organs system.

Help me please, I’m confused

Answers

Answer:

Photosynthesis-

Photosynthesis is a process used by plants and other organisms to convert light energy into chemical energy that, through cellular respiration, can later be released to fuel the organism's metabolic activities. Photosynthesis occurs in the chloroplast of a plant, which contains chlorophyll. In order for photosynthesis to take place, it needs to have water and carbon dioxide, the two very important raw materials necessary for this process. In the presence of carbon dioxide, such cells are able to convert this solar energy into energy-rich organic molecules, such as this energy-rich molecule known as glucose. Oxygen the by product of photosynthesis is inhaled by heterotrophs which aids in cellular respiration and other internal processes and then exhales carbon dioxide. ... In like manner, carbon dioxide passes from blood to the alveoli and exhaled after

Explanation:

WILL GIVE BRAINLIEST

DNA molecules are the instructions to make what?

-proteins

-carbohydrates

-lipids

-plasmids

Answers

Answer:

A

Explanation:

DNA is used to make mRNA, which is then used alongside tRNA to make a polypeptide chain. This chain folds to make a protein.

1. DNA base sequence: GACGATGTAGCATCGACCATTG.
What would the mRNA sequence for this sequence of DNA be?

Answers

CUGCUACAUCGUAGCUGGUAAC

A cell containing 20 chromosomes undergoes mitosis, each daughter cell will have 20 chromosomes
a.True
b.False

Answers

Answer:

the answer is true because a cell containing 20 chromosomes undergoes mitosis, each daughter cell will have 20 chromosomes

If one DNA strand reads CCGTAATGCAT, what will be the sequence of the complimentary strand?

Answers

The complimentary strand would be GGCATTACGTA

using the count data and observational data you acquired calculate the number of cfus in the original sample

Answers

Answer:

cuales son los datos ?

Explanation:

cuales son los datos

Which statement best explains how the gases of the atmosphere affect the temperature of Earth?

Answers

The atmosphere today contains more greenhouse gas molecules, so more of the infrared energy emitted by the surface ends up being absorbed by the atmosphere. Since some of the extra energy from a warmer atmosphere radiates back down to the surface, Earth's surface temperature rises.

PLEASE HELP ASAP Match each word with the phrase that best defines it.
informal
a statement that is objective or unchanging
fact
done in a way that is friendly or casual
formal
a statement that is subjective or based on
interpretation
topic
done in a way that is suitable, appropriate,
or based on guidelines
opinion
the main point of a given subject

Answers

Answer:

fact: a statement that is objective or unchanging

informal: done in a way that is friendly or casual

formal: done in a way that is suitable, appropriate,

or based on guidelines

opinion: a statement that is subjective or based on

interpretation

topic: the main point of a given subject

Match each word with the phrase that best defines it.

1. Fact: a statement that is objective or unchanging

2. Informal: done in a way that is friendly or casual

3. Formal: done in a way that is suitable, appropriate, or based on guidelines

4. Opinion: a statement that is subjective or based on interpretation

5. Topic: the main point of a given subject

What are Phrases?

A phrase is a group of words or a singular word which functions as a grammatical unit. For example, the English expression "the very happy boy" is a noun phrase containing the adjective phrase "very happy".

It can be a single word or a complete sentence. Phrases are used to describe the people, things, or events.

There are following types of phrases. They are:

Noun phrase.Adjective phrase.Adverb phrase.Verb phrase.Prepositional phrase.Gerund phraseInfinitive phraseParticipial phrase

Thus, matching the following words with its phrases

1. Fact: a statement that is objective or unchanging

2. Informal: done in a way that is friendly or casual

3. Formal: done in a way that is suitable, appropriate, or based on guidelines

4. Opinion: a statement that is subjective or based on interpretation

5. Topic: the main point of a given subject

Learn more about Phrases, here:

https://brainly.com/question/15806900

#SPJ2

help me out girlies its due

Answers

the stereotype is that all australians are some sort of zookeepers? and wear clothes like that. also that they drink beer a lot.

Answer:

the stereotype is that all australians are zookeepers? and wear clothes like that.

Explanation:

Other Questions
Ms. Mathews wants to put a fence around the north, south and east sides if her square garden. The garden has an area of 100ft2. How much fencing does she need? twice the square root of a number is 12 2. The full name of the German organist, composer, and violinist who wrote over 1100 compositions charges and electric fields of two items that have just beenremoved from a clothes dryer.ormation When manager Mariah Pitner delivered the company's financial report to local bankers and analysts, she was acting in a(n) _____ role. A scientist evaluates its livestock and determines which livestock it isgoing to allow to mate. What is this process called and how will this impactthe genetic traits of the livestock? Escribe cul es la importancia de la escenografa en una obra teatral simplify 7/341 and give step by step explanation! I will mark you a brainliest. Plzzzzz I need help ASAP What is the identity of the planets?A: B: C: D: Fallon collected data for her favorite TV show. She recorded the number of viewers and the number of weeks since the show premiered. With the data in hand, she created this scatter plot and drew a line of best fitWhat are the slope and the y-intercept of the line of best fit? Which of the following might be a factor in judging distance accurately for some people? In Lines 23 and 24 of his poem "Chicago", Sandburg uses which poetic device? A Simile - a comparison of two unlike things using "like" or "as" B. Metaphor - a comparison of two unlike objects C. Repetition A heron is perched in a tree 50 feet above sea level. Directly below the heron, a pelican is flying 17 feet above sea level. Directly below the birds is a trout, swimming 23 feet below sea level. What is the distance between the heights of the pelican and the heronA.67 feetB. -67C. 33D.-33 Which answer best explains a reason people wanted to build a railroad across the United States?A.The railroad companies wanted to put the canal builders out of business.B. The government wanted the route completed before the Civil War started.C. The railroad companies wanted to prove they could build such a long track.D. The Gold Rush of 1849 inspired the railroad companies to try to get trains to California. god has created our beautiful earth change the voice How can language mask reality? What is the area of a square with side length:3cm Pls help Ill brain-lest ASAP The part that's cut off it says To the nearest tenth of a percent, what's percent... and is the answer 3.3?