What concepts in the US government were influenced by the Magna Carta? Choose FOUR correct answers.

the right to a speedy trial
freedom from unlawful searches and seizures
the right to a trial by a jury of peers
the authority of the president to create laws
the establishment of a church sponsored by the government
protection from losses of property without due process

Answers

Answer 1

Answer:

A B C F

Explanation:

Answer 2

Answer:

(A) the right to a speedy trial

(B) freedom from unlawful searches and seizures

(C) freedom from unlawful searches and seizures

(F) protection from losses of property without due process

Explanation:


Related Questions

How did businesses try to build better relations with workers?

Answers

maybe give them a easier time and maybe not be so hard on them
To give them an easier time, and to not be so hard on them.

Who watched to the news yesterday night

Answers

Answer:

I did ,but i could only watch some of it since it was late at night

Explanation:

Me :))))) yessssssss

Why is it important to respect other political opinions?

O

A. It allows politicians to gain new voters,

B. It creates a more informed electorate,

O

c. It helps citizens change their minds on political issues,

O

D. It leads to improvements in the education system.

Answers

Answer:

B. It creates a more informed electorate,

Explanation:

AP3X

It is important to respect other political opinions because it creates a more informed electorate.

Informed electorate

These are citizens who, when they exercise their right to vote, have the necessary information to protect their own interests. The voting public who actually can vote knowing what is best for them.

Respecting others political opinions

The political opinions are opinions and can be affected by the surrounding environment and the social status. But it is not important that your opinion is right, while others are having wrong opinions. So, respecting other political opinion is important.

Thus, it is important to respect other political opinions because it creates a more informed electorate.

Learn more on political opinions here-brainly.com/question/20522330

#SPJ2

Which word has a syllable (word part) that is related to Greek mythology?
definitive
blockade
hydraulic
equality

Answers

Think it’s hydraulic
It’s Hydraulic:) your welcome

What was one reason why Martin Luther's ideas to reform the church gain popularity?

A: He was a famous Cardinal that served the Pope
B: Martin Luther's ideas originated inside the Vatican City
C: Everyone knew how to read and write in Latin
D: His "Ninety-Five-Theses" could be mass produced because of the printing press

Answers

Answer: I believe the answer is D.

Hope this helps!! <3

Explanation:

Luther's belief in justification by faith led him to question the Catholic Church's practices of self-indulgence. He objected not only to the church's greed but to the very idea of indulgences. ... Over the next few years, however, his Ninety-Five Theses sparked a religious movement to reform the Catholic Church.

Can someone please help me I need to turn this in

1. What role did families play in West African society?

2.How did trading develop in West Africa?

3. What is oral history?

4 Please define the following terms in complete sentences.

Kinship

Clan

Labor Specialization

Griot

5. Please summarize the role of trade in West Africa.

Village life in West Africa

Trade and regional commerce

The oral tradition in West Africa

6. What formed the basis for government in many African societies south of the Sahara?

7. How did trade help cities and states develop?

8. What role did oral tradition play in West African societies?

9. How might the West African oral tradition be different from the written tradition?

10. How did West African farmers' ability to grow more food encourage labor specialization?

Answers

The one yeah correct a becuase it is and a

NO FUNNY BUSINESS PLEASE PUT THE ACTUAL ANSWER PLEASE




1. What role did families play in West African society?

2.How did trading develop in West Africa?

3. What is oral history?

4 Please define the following terms in complete sentences.

Kinship

Clan

Labor Specialization

Griot

5. Please summarize the role of trade in West Africa.

Village life in West Africa

Trade and regional commerce

The oral tradition in West Africa

6. What formed the basis for government in many African societies south of the Sahara?

7. How did trade help cities and states develop?

8. What role did oral tradition play in West African societies?

9. How might the West African oral tradition be different from the written tradition?

10. How did West African farmers' ability to grow more food encourage labor specialization?

Answers

Answer:

oral histroy is the

Explanation:

q - what is oral history ?

answer - Oral history is the collection of historical information using sound of recordings of interviews with people having personal knowledge of past events .

In paragraph form, briefly explain what the purpose of a timeline is

Answers

Answer:

The purpose of a timeline is to show a series of actions within a certain period of time in a chronological order, that can help someone to better understand the change, recurring events, causes and effects, and key events of historical, social, and scientific importance.

Sorry if this does not make sense, I used translate because English is still difficult and sometimes confusing for me.

Answer:

The purpose of a timeline is to show a series of actions within a certain period of time in a chronological order, that can help someone to better understand the change, recurring events, causes and effects, and key events of historical, social, and scientific importance.

Explanation:

How is the vice president of the United States selected?

A. The vice president is elected by a vote in the Senate.
B. The vice president is elected by a vote in the House.
C. The vice president is elected with the president.
D. The vice president is appointed by the president.

Answers

Answer:

it c

Explanationthe other person wrong

Answer:

c is the answer

Explanation:

edrfghjhgfdsa

In paragraph form, describe what the five characteristics of classical civilizations are.

Answers

The five characteristics of a classical civilization are democracy, individualism, monotheism, architectural proportion, and musical harmony. All of these concepts were first developed by the classical civilizations of ancient Egypt, Mesopotamia, Israel, Greece and Rome.

In 1983 President Reagan signed this bill making it a law that Martin Luther King would have a national holiday in January. How many signatures were collected to show Congress that many people wanted this day to exist?

Answers

The King Center kept up its efforts. It organized a march on Washington that included an estimated 500,000 people. Coretta Scott King, along with Wonder, presented a petition signed by 6 million people to House leader Tip O'Neill. The House took up the bill in 1983 and it passed by 53 votes.

Do you guys know how to do this.

Answers

Answer:

no.

Explanation:

if it helped Ghana to rise you drag to the rise, but if it did not helped you put on the fall (I think I explained right)

please help asap I wasn't paying attention

Which of the following Great Lakes does not border both Canada and the United States?
A.
Lake Erie
B.
Lake Huron
C.
Lake Michigan
D.
Lake Superior

Answers

Answer:

C. Lake Michigan

Lake Michigan does not border Canada and the United States.

hope this helps :)

Please help me out with the 3 questions for civics asap

Answers

Answer:

1. Congress should have the power to regulate interstate commerce

2. The commerce clause

3. It allows cooperation between federal and state agencies (I'm not too sure with this one)

Explanation:

Brainliest?

Answer:

1. Cov Congress yuav tsum muaj lub hwj chim los tswj kev ua lag luam interstate

2. Kev lag luam kab lus

3. Nws tso cai kev koom tes ntawm tsoomfwv thiab xeev cov koomhaum

Explanation:

The mechanical energy "lost" from machines is transformed into:

Answers

Answer:

heat/thermal energy

Explanation:

friction/ conservation of energy lol

Answer:

thermal energy

Explanation:

What instruments were used to navigate the Missouri River? (select ALL that apply)

Answers

Answer: All of them are correct.

Explanation: I did the puzzle in class today

Paddles, poles, sails and ropes were used to navigate the Missouri River. Thus, all options are correct.

What is the peculiarity about Missouri River?

The Missouri River is the country's longest river. The Missouri River rises in the Eastern Centennial Mountains in Southwestern Montana's Rocky Mountains and travels 2,341 miles east and south until joining the Mississippi River north of St. Louis, Missouri.

More than 500,000 square miles of sparsely inhabited, semi-arid basin, including portions of ten U.S. states and two Canadian provinces, are drained by the river.

Although the Missouri River is a tributary of the Mississippi, it is substantially longer and transports a similar amount of water. It joins the lower Mississippi River to create the fourth-longest river system in the world.

People have relied on the Missouri River and its tributaries as a source of food and transportation for over 12,000 years.

Learn more about Missouri River, here

https://brainly.com/question/28604557

#SPJ2

 

Please help me i really need help!!!

Answers

The reason why some Hindu temples resemble mountains that that Hinduism is a nature-based religion.

What does it mean that Hinduism is nature based?

Hindus believe that the gods and goddesses are present in all of nature, including mountains. Mountains are seen as sacred places, and they are often associated with gods such as Shiva and Vishnu.

Mountains are often seen as a bridge between the human world and the divine world. The steep peaks of mountains represent the challenges that humans face on their journey to enlightenment.

The temples of Khajuraho were built to reflect these beliefs. They are designed to resemble mountains, both in their overall shape and in their many intricate carvings. The temples are also located in a mountainous region, which further reinforces their connection to the natural world.

Find out more on Hinduism at https://brainly.com/question/18156260

#SPJ1

What do almost all of the inaugural addresses have in common?

Answers

Answer:

They all have something to do with the president in or getting in the office

Explanation:

or something :)

Answer:

A lot of Inaugural addresses involve someone talking about what they plan to do as a leader

Explanation:

2) What actions did Jackson take as president that showed he was a president for the " common man?

Answers

Answer: The period from Jackson’s inauguration as president up to the Civil War is known as the Jacksonian Era or the Era of the Rise of the Common Man. This period constituted great change and issues warranting debate, such as slavery, Indians, westward mobility, and balance of power between the executive and the legislative branches of government. The United States had no strict class system. Most Americans identified themselves into the middle class. The common man now had the right to vote, without the distinction of owning land, nominating candidates to office, and rewarding the politicians that represented the common man’s interests. The 1820s, a time of transition and transformation called for a man who could guide the people through the changeful age. The election of 1828 signaled a unique change; never before had a man who made his name and fortune outside the thirteen colonies been elected to the office of president.

To work out our problems with France President John Adams sent 3 diplomats to Paris. This turned into a scandal when the French asked for a bribe. What was the name of this incident?

Answers

The XYZ Affair was a diplomatic incident between French and United States diplomats that resulted in a limited, undeclared war known as the Quasi-War. ... President John Adams dispatched three U.S. envoys to restore harmony between the United States and France—Elbridge Gerry, Charles Cotesworth Pinckney, and John Marshall.
(A.)

NEED HELP ASAP DUE AT 11:30PM
Which statement describing the Aztec Empire is true?
Question 50 options:

Runners used an intricate road system to carry messages from one part of the empire to another.

It was a small empire with few natural resources.

It was known for its island capital and brutal human sacrifice.

Good relations with neighboring peoples led to strong alliances in time of war.

Answers

Answer:

The third one

Explanation:

Answer: It was known for its island capital and brutal human sacrifice.

Explanation:

AAAAAAAAAAAA- my class is almost over! Can you guys help me PLEASE!!!

Answers

Answer:

Eight Reasons The Americans Won The Revolutionary War 1. Logistics 2. Guerilla Warfare 3. The French 4. Lack of Loyalist and Native American Support 5. British Political Division 6. British Arrogance 7. War Was Fought Differently 8. British Incompetence

Explanation:

i agree with the person above me

pls i need help
1) Explain how the French & Indian war led to the tax acts such as the Townshend Act.

2) What were the three most important results of the Treaty of Paris?

3) What is the difference between a Patriot and a Loyalist? Which one would you have been? Explain why you would have chosen this side.

Answers

Answer:

1. Britain was in debt after the war.

2. France gave up there territories, Brittian increased taxes, and colonists grew unhappy.

3. nag cheif

The answer is d just took the test

Which two Seattle communities are closest to the downtown area?

Central Seattle and Capitol Hill
West Seattle and Rainier Valley
Greenwood and Lake City
Magnolia and Queen Anne

Answers

Answer: Central Seattle and Capitol Hill

Central seattle and capitol

What is the context of this year’s inauguration?

Answers

Biden is the new president of United States he has been through slot

What is the Tidewater?


A. a mountainous area along the Mason-Dixon line


B. a flat, swampy area along the coast of the Southern Colonies


C. another name for the Georgia coastline

Answers

Answer:

Another name for the georgia coastline

Explanation:

Answer:

c

Explanation:

"TIDEWATER is a term commonly used to designate that portion of the Atlantic coastal plain lying east of the points in rivers reached by oceanic tides. This region, the first to be occupied by settlers from the Old World, slowly became an area of comparative wealth."

20 points & brainliest
Which agricultural method is most commonly used in dense rainforest, and causes significant environmental damage?
terrace farming
levy flooding
slash and burn
irrigation

Answers

Answer:

slash and burn

it was really fast

Explanation:

Answer:

C.

Explanation:

Edge 22.

In what way did the outcome of the Spanish American War help lead to the building of the Panama Canal?
Please Help!

Answers

The answer closet to it is c hope this helps
i just took the test a day ago and i’m pretty sure the answer is c! :)

Congress shall make no law respecting an establishment of religion, or prohibiting the free exercise thereof; or abridging the freedom of speech, or of the press; or the right of the people peaceably to assemble, and to petition the Government for a redress of grievances.” —United States Constitution, Amendment I Rewrite this passage from the First Amendment IN YOUR OWN WORDS

Answers

Answer:

he First Amendment protects several basic freedoms in the United States including freedom of religion, freedom of speech, freedom of the press, the right to assemble, and the right to petition the government. It was part of the Bill of Rights that was added to the Constitution on December 15, 1791.

Explanation:

Describe Hellenistic culture in the city of Alexandria.
(Ill give brainlest to whoever is first and does a correct answer)

Answers

Alexandrian Greeks placed an emphasis on Hellenistic culture, in part to exclude and subjugate non-Greeks. The law in Alexandria was based on Greek—especially Attic—law. There were two institutions in Alexandria devoted to the preservation and study of Greek culture, which helped to exclude non-Greeks.
Other Questions
Does (3,4) satisfy the equation-5x + 2y = 23? The plugin that changes Jenkins to use green balls instead of blue for successful builds is ________. Decide whether the pronunciation is correct or incorrect. Drag and drop the word into the correct column.encourage en-KUR-Correct PronunciationIncorrect Pronunciationexplain ik-SPLAYNjustity JUHS-tun-tahyplayful PRET-tuhmspecial SLISP-uhtheroic hi-ray-IT An architect draws a plan for a wheelchair ramp on the plan, the ramp is 2cm high and 24cm long what might the dimensions of the actual ramp be (use equivalent ratios) slope of 2,11 and 5,2 Hey guys please help!! What is the definition of fourteen points? breakout edu keyla winter wonderland questioni CAN'T DO THIS I've tried so many times how do you do it What became of most of the Central powers colonies after World War I? They became independent nations. They remained colonies of Central Powers nations. They became League of Nations mandates. They were run by the League of Nations. Express 10 : 12 as a decimal.(Round to the nearest hundrerdth) TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA Why did debates among civil rights activists increase after 1965? What were the causes and effects of these debates? (Look into SNCC, CORE, Black Power, and the SCLC, Stokeley Carmichael, Huey Newton &/or Bobby Seale) 1 1 The slope of the line below is -1/7. Write a point-slope equation of the lineusing the coordinates of the labeled point. What might be the consequences of your choice? Political: Economic: Social: What are the two ways a subduction zone can be generated? The local lighting company found that 2 out of every 10 lightbulbs was defective. Ifthere are a total of 120 bulbs in a box, how many can they predict will be defective? Quienes intervienen en este caso de violencia? En la fragmento de la novela corazn a shop is having a sale all items are reduced by 30% work out the sale price of an item normally priced at 110 Which court would hear this case? Mr. Jones is suing Ms. Brown for the cost ($2,000) to fix his fence when her tree fell and crushed the fence. Hello can someone help me with this question please!