What changes occur to the ratio of surface area to volume as a cell
grows?

Answers

Answer 1

Answer:

As a cell grows, its surface area-to-volume ratio decreases


Related Questions

please help
Explain how an organ and organelles are related

Answers

Answer:

Just as organs are separate body parts that perform certain functions in the human body, organelles are microscopic sub-units that perform specific functions within individual cells. Organelles are specialized structures that perform various jobs inside cells.

Organelles are microscopic subunits that carry out certain tasks within individual cells, whereas organs are distinct body sections that carry out specialized tasks for the human body.

What is the relation between organ and organelles?

Literally, the phrase refers to “tiny organs.” Organelles provide specialized functions to keep a cell alive, much like organs like the heart, liver, stomach, and kidneys serve specific functions to keep an individual alive.

Atoms, molecules, organelles, cells, tissues, organs, organ systems, and the human organism are the major levels of organization in the body, going from the simplest to the most complex.

Like an organ in the body, an organelle is a subcellular structure that performs one or more particular functions for the cell.

Therefore, organ and organelles differ in their functioning.

Learn more about organ and organelles here:

https://brainly.com/question/22911736

#SPJ2

Plants release a different gas back into the air. What is the name of that gas?What is the name of the gas that plants absorb from the air and use to grow?

Answers

The name of the gas is t

Why are bananas curved?

Answers

Answer:

It's because of the sun! Bananas are curved so they can retrieve sunlight. Bananas go through a process called 'negative geotropism'.What it means is that bananas grow away from the ground, instead of growing towards it, hence the 'negative' geotropism.

Explanation:

g.o.o.g.l.e lma o

Answer

It's because of the sun!

Explanation:

Bananas are curved so they can retrieve sunlight. Bananas go through a process called 'negative geotropism'. Meaning it grows away from the ground instead of towards it.

multiple choice
Daytime temperatures on Mercury are extremely hot because:

1. it is close to the sun
2. it has long days
3. one side is facing the sun
4. it gives off internal heat
5. there are volcanoes

Answers

Answer: it has long days

Explanation:

Write any three differences between mass and weight


please its aurgent fast ​

Answers

Answer:

See explanation

Explanation:

There are a number of differences between mass and weight, they include;

Mass is  a scalar quantity whereas weight is a vector quantity.

Mass is dependent on the quantity of matter present in a body whereas weight depends on the acceleration due to gravity in a particular location on the earths surface.

The SI unit of mass is kilogram whereas the SI unit of weight is Newton.

Which blood component fights and destroys disease-causing bacteria and
viruses?

Answers

Answer:

white cells

Explanation:

the answer is white blood cells

16. In which of the following situations are the phenotypes of F2 offspring expected to follow
the ratio of 9:3:3:1?
a. monohybrid cross for two unlinked traits
b. a monohybrid cross for two closely linked traits
c. a dihybrid cross for two unlinked traits
d. a dihybrid cross for two closely linked traits​

Answers

Answer:

C

Explanation:

The F2 offspring of a cross would follow the ratio of 9:3:3:1 only if the cross is a dihybrid for two unlinked traits.

There is nothing like a monohybrid cross for two traits. A cross involving two traits is a dihybrid cross. Hence, options a and b are out of the equation.

A dihybrid cross for two closely linked traits would produce F2 offspring in another ratio that is different from 9:3:3:1 depending on the linkage map.

Hence, the correct option is C.

What is a constant?
O a variable
a number that stands alone with no variable
O the number in front of the variable
O two terms that look exactly the same


need help please

Answers

Answer:

a number that stands alone with no variable

Hope this helps!

Which of these is the form in which
igneous rock begins?
A. sediment
B. magma
C. carbon
D. soil

Answers

Answer:

B)Magma

Explanation:

The function of mitochondria and chloroplasts is related to energy. In what way does their function differ?
A.
Mitochondria produce energy in prokaryotic cells, while chloroplasts produce energy in eukaryotic cells.
B.
Mitochondria produce energy from food, while chloroplasts produce food from the Sun’s energy.
C.
In plants, mitochondria provide energy in non-green cells, while chloroplasts provide energy to cells in parts of the plant that are green.
D.
Mitochondria provide energy in the night, while chloroplasts provide energy in the day.
E.
Mitochondria provide energy from food synthesized by organelles other than chloroplasts, while chloroplasts provide energy through photosynthesis using the Sun’s energy.

Answers

Answer:

The answer is option E- Mitochondria provide energy from food synthesized by organelles other than chloroplasts, while chloroplasts provide energy through photosynthesis using the Sun’s energy.

Explanation:

It’s E the answer is E mitochondria provide energy from food synthesized by organelles other than chloroplasts while chloroplasts provide energy through photosynthesis using the sun’s energy

why does the temp of the air increase with the height of the stratosphere?

Answers

Answer:

The hot air rises and the cool air falls

Explanation:

In mature animals when do cells still need to differentiate?

Answers

Answer:

As an organism develops, cells differentiate to form different types of cells. Most types of animal cell differentiate at an early stage. Many types of plant cells retain the ability to differentiate throughout life. In mature animals, cell division is mainly restricted to repair and replacement.

Explanation:

''.''

In mature animals cells differentiate during : Repair and replacement of  animal cells

Cells differentiate in organisms and plants to create more cell types, as the organism and plants continue to mature. While cell differentiation in animals occur mostly before maturity, plants cells continue to differentiate until they die.

While in mature animals, cells differentiates at maturity only when the cells of the mature animal needs repair or replacement due to damage caused to the a cell or tissue.

Hence we can conclude that in mature animals cells differentiate during repair and replacement of cells.

Learn more : https://brainly.com/question/19015367

Select the correct bisector of the segment.
B
A
B
B
B
А
M
B
B
D

Answers

Answer:

C

Explanation:

it has the example figure number 7 and also it has the correct bisector

tall pea plants are dominate over pea plants if two hybrids (Tt) are crossed ​

Answers

Answer:

Naruto usamaki is the greatest hokagey in the leaf village

4 points
The inferred temperature and pressure of Earth's
interior at a depth of 3,000 kilometers are
approximately
(1) 1000°C and 0.5 million atmospheres
(2) 1000°C and 1.0 million atmospheres
(3) 5000°C and 1.5 million atmospheres
(4) 5000°C and 3.0 million atmospheres

Answers

Answer:

(4) 5000°C and 3.0 million atmospheres

Explanation:

The inferred temperature is 5000°C and pressure of Earth's  interior is 3.0 million atmospheres at a depth of 3,000 kilometers. At the depth of 3000 kilometers, core of the earth is present which is very hot and it is mostly consist of iron. The inner core has a radius of about 1,220 kilometers while the outer core is about 1,400 miles thick which comprise of iron, Nickle, gold, platinum, and uranium elements.

When covalent bonds form. the amount of energy present decreases. What happens to the stability of the atoms in the bond?

Answers

Covalent bonding occurs when pairs of electrons are shared by atoms. Atoms will covalently bond with other atoms in order to gain more stability, which is gained by forming a full electron shell. By sharing their outer most (valence) electrons, atoms can fill up their outer electron shell and gain stability.

True of False: Marsh was able to prove that animals changed over time.

Answers

Answer:

True

Explanation:

Hope this helps :D Have a great day..can i hav brainliest?

I think the answer is true


:):):):):):):):)

A simple life cycle is one in which the offspring look similar to their parents.
True
Or
False

Answers

False — life cycles have to do with birth to death progressions, not genetic traits.

Why most foods needs to be digested? Give at least 3 reasons

Answers

Answer:

Why most foods needs to be digested? Give at least 3 reasons.

Explanation:

Foods must be digested cause of the following reasons:

1. To get energy the food must be digested.

2. To provide nourishing vitamins and minerals to our body.

3. You will be affected by some diseases if you didn't digest your food.

When do you think the rays of the sun encounter particles

Answers

All of the energy from the Sun that reaches the Earth arrives as solar radiation, part of a large collection of energy called the electromagnetic radiation spectrum. Solar radiation includes visible light, ultraviolet light, infrared, radio waves, X-rays, and gamma rays.

What are the three main classifications that describe galaxies? By what one visible
characteristic do scientists categorize galaxies?

Answers

Answer:

Spiral Galaxies, Elliptical Galaxies  & Irregular Galaxies

Explanation:

How did galaxies originate? Astronomers believe that after the big bang, the explosion which began the universe 10 billion to 20 billion years ago, gravity began to compress masses of free-floating gas. Two main theories, bottom-up and top-down, explain what happened next. According to bottom-up theories, clusters began to form and assembled together into the larger units we know as galaxies. Top-down theories suggest that galaxies formed first, and the stars and other objects within them were subsequently produced. They categorized different galaxies to maintain their tests from the other galaxies.

Answer 15 and 16 correctly and I will mark as brainliest

Answers

Answer:

I think its A and G

Answer:

15. B.

16. H

Explanation:

If you were on the ISS (International Space Station), how would you know that a solar eclipse took place on Earth?

Answers

Answer:you could ask your family or look it up you ar probably right next to a sadelite

so connection should be pretty good

decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Answers

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

Question 14 (2 points)
(06.03 MC)
Which of the following correctly identifies a lymphatic organ and describes how it
can fight cancer? (2 points)
1) Lymph vessel; removes fluid from tissues
2) Lymph trunk; returns lymph to the blood
3) Spleen; replaces damaged red blood cells
4) Thymus; exposes lymphocytes to antigens

Answers

All of the statements correctly identify a lymphatic organ. In vertebrates, the lymphatic organs, also known as the lymphoid system, are an organ system that is a part of the immune system and works in conjunction with the circulatory system.

The Lymphatic OrgansLymphatic vessels, which are found all over your body and transport lymph away from tissues, are a network of capillaries (microvessels) and a huge network of tubes.By emptying into the corresponding subclavian veins, the lymph ducts, which are formed by the lymph trunks, restore lymph to circulation.Red blood cells that are outdated or damaged are eliminated by the spleen, which also removes cellular waste from circulation.Training specific white blood cells known as T-lymphocytes or T-cells is the thymus gland's main job.

Hence, all of the statements correctly identify a lymphatic organ.

How lymphatic system fights Cancer?Regional lymph nodes, which are predictive of distant organ metastases and poor survival, are accessible to tumor cells via lymphatic arteries.As the lymph fluid moves through the lymph nodes, it is filtered. B cells and T cells, two types of white blood cells, assault any viruses or bacteria they discover in the lymph.

To learn more about the Lymphatic System refer to:

https://brainly.com/question/13676212

#SPJ1

What are three differences between rocks and soil

Answers

Answer:

Rocks are made of one or more minerals. based on the way the rock was formed: sedimentary metamorphic and igneous Soil is formed of fine rock particles mixed with air, water and particles from dead plant and animal matter.

give two examples of asexual Productions​

Answers

Answer:

Asexual Reproduction Examples

Blackworms or mudworms reproduce through fragmentation. Hydras reproduce through budding. Organisms such as copperheads undergo parthenogenesis. Sugarcane can be grown through v

Which human activity negatively affects the stability of the environment?

Answers

Answer:

Some human activities that cause damage (either directly or indirectly) to the environment on a global scale include population growth, overconsumption, overexploitation, pollution, and deforestation, to name but a few.

Explanation:

Brainliest?

Describe some of the reasons for exploring the mid-Cayman ridge.

Answers

Answer:

Life on Earth goes back almost 4.1 billion years, but photosynthesis as characterized by cyanobacteria only appeared around 3.5 billion years ago (Ga). Since life on Earth predates photosynthesis, the exploration of this deep-water environment that lacks any source of light could provide information on what those life forms looked like.

Explanation:

This was the answer on edge

The major reason for exploring the mid-Cayman ridge is to provide

information on what those life forms looked like.

What is Photosynthesis?

This is the process in which plants manufacture their food in the presence

of sunlight and other compounds.

The mid-Cayman ridge which is present in a deep water environment has

lacks any source of light has some life-forms present. The exploration was

to find out the type of life forms present and how they appear.

Read more about Mid-cayman ridge here https://brainly.com/question/2747950

70 POINTS Use the library and other reference materials to research the discovery of radioactivity and its current applications. Then, write a 500 word report on what you have learned. Be sure to include the contributions of French chemists Marie Curie and Pierre Curie and the medical uses of radiation.

Answers

Answer:

can I write an essay

Explanation:

On April 20, 1902, Marie and Curie with success isolate radioactive  metallic element salts from the mineral uranium ore in their laboratory in Paris. In 1898, the Curies discovered the existence of the weather radium and metallic element in their analysis of pitchblende. One year once analytic  radium, they might share the 1903 Nobel prize in physics with French soul A. Becquerel for his or her groundbreaking investigations of radioactivity.

Marie Curie was born Marie Sklodowska in Warsaw, Poland, in 1867. The girl of a physics teacher, she was a talented student and in 1891 visited study at the university in Paris. With highest honors, she received a degree in physical sciences in 1893 and in arithmetic in 1894. That year she met state capital Curie, a noted French man of science and chemist who had done vital add magnetism. Marie and Pierre married in 1895, marking the start of a scientific partnership that will accomplish world renown.

we need a picture ..
Other Questions
Can someone find the factors of this equation Ill mark u as brainlist A charter bus travels 225 miles in4.5 hours. Assume thedistance traveled is directlyproportional to the time spent.Write a direct variation equation.A) x + 50 = yB) y + 50x = 0C) x= - 50 yD) y = 50x what are sedimentary rocks 16. Which of the Olympian gods did not spend much time on Mount Olympus? I need to know then measurement of c Margo can purchase tile at a store for $.99 per tile and rent a tile saw for $10. At another store she can borrow the tile saw for free if she buys tiles there for $1.49 per tile. How many tiles mushy by for the cost to be the same at both stores? On a coordinate plane, a graph decreases between (2.5, 2) and (4.5, 0.25). How does this graph change between (2.5, 2) and (4.5, 0.25)?A. IncreaseB. DecreaseC. No Change Find the volume of this shape 11 cm 16 cm PLZZ ANYONE TO ANSWER MY QUESTIONS.....I WILL GIVE BRAINLIEST. ....... 20% of 260 students at hill middle school ride a bus to school. how many students ride a bus to school? Find the Value of x and y. Iready find QR. help please and thank you n the experiment "What Effect Does Vinegar Have on Plant Growth?" some plants were given only water, some were given only vinegar, and the others were given various mixtures of water and vinegar. Which of the following groups is the control group in the experiment?50% water and 50% vinager100% water100% vinageror 25% vinager and 75% water Which number is irrational?-42/9Square root 118.26 repeating 6 Hello! I really need help! I am stumped on these analogies for a CLUE stems sheet. 11. Ergatocracy : gerontocracy :: a. Elderly : manual b. Hard hat : cane c. Fraternity : fraternal d. Eohippus : horse 12. Status quo : revolution :: a. Form : metamorphosis b. Taxidermy : animal c. Autotroph : heterotroph d. Vivisect : dissect 13. Phenomena : phenomenon :: a. Fraternize : fraternity b. Benevolent : benevolence c. Fungi : fungus d. Saprophyte : saprogenic Solve for xPlease Help! (can u guys help me PLSSSSS ) A company sets sales goals for employees each month. A: At her current pace, how many items will Kristina sell in 28 days?B:Is she on track to meet the goal? Explain What is the percent composition of Phosphorus in Li3PO3 10. One number is twenty more than eight times another number. The sum of thenumbers is eleven. Find the two numbers. The difference of n and 2 is 10