Under the federal system of the United States government, which power is reserved for the states?

Answers

Answer 1

Answer:

options?

Explanation:

Answer 2

setting the legal driving age


Related Questions


Which is the correct order for impeachment proceedings?
The Senate brings charges of misconduct; the official is removed.
The House brings charges of misconduct; the Senate holds an impeachment trial; the official is
removed if found guilty.
The Senate brings charges of misconduct; the House holds an impeachment trial; the official is
removed if found guilty.
The House brings charges of misconduct; the official is removed.

Answers

the second one, the house brings charges, then the senate votes on them, then (if the senate votes it) the official is removed. hope this helps!

PLESS HELPPP MY GRAED IDPANES ON ITTTT
Why do you think the memoir is called Night? Why does he keep saying: “Night was falling?” “Night fell?” “Night had fallen.” "My life had become one giant night", etc. Write about the difference between day and night, light and darkness, good and evil, spring and winter .

Answers

maybe because it changed the mood and character of the story, maybe it changes the prespective, maybe the author of anted to create a visualization for the mind

It was in ________ , countries with primarily agricultural economies, that many covert operation took place.

Answers

Answer:

your awnser is "military-industrial complex"

Explanation:

European competition for colonies, resources, and world markets through the use of militarism was one of the causes of __________.
A.
the Russian Revolution
B.
the Cold War
C.
World War I
D.
World War I

Answers

Answer:

C or D World War 1. (Pick whichever option says World War One)

Explanation:

As these European powers such as Britian, France, Germany, Austria-Hungary, and Russia were industrializing due to the coming of a modern age (20th Century). Resources had become the primary target of vast colonial empires. Strategic territories as well such as British occupied Eygpt or India had multiple advantages over other countries through the African and Asian markets. Germany in comparison had a little number of colonies in Africa and South-East Asia. Competition like this would favor a World War to gain an advantage over rival empires.

please answer please i need help lol

Answers

Just put what you think

The Declaration of Independence lists a number of offenses committed by the British king against the American colonists. Which of the following offenses refers to a protection first established by Magna Carta?


For depriving us in many cases, of the benefits of Trial by Jury
For depriving us in many cases, of the benefits of Trial by Jury

For cutting off our Trade with all parts of the world
For cutting off our Trade with all parts of the world

For imposing Taxes on us without our Consent
For imposing Taxes on us without our Consent

For transporting us beyond Seas to be tried for pretended offence

Answers

Answer:

A

Explanation:

The colonists were denied in many cases, of the benefits of Trial by Jury In addition, the judges were bribed by king George III using the money he got from the colonies.

Which aspect of the government created by the new nation, the United States of America, was designed to prevent one person or group from galning too much power?

Answers

Answer:

Separation of powers

Explanation:

The Framers thought that this was necessary because they wanted to avoid having a government or a part of government that was too powerful. ... So the decided to create a government in which neither the executive nor the legislature (nor the judicial, for that matter) could have too much power.

Answer:A system of checks and balances

Explanation:

Took the test and this is the right answer.

how was the upper class viewed in the past?

Answers

In the past past, during Great Depression no one liked them because they had a whole bunch of rights and things that the poor/ lower class didn’t. Also in 1800s the upper class was the kings and rich men of the world, no one liked them because they were greedy and didn’t care for others but themselves

ILL GIVE BRAINLY THING

What was the result of the French and Indian War?

1) France began moving west

2) France lost land claims in North America and Britain gained Canada and most French lands east of the Mississippi.

3) Land east of the Mississippi was divided equally between France and Britain.

4) Spain gained Canada and Britain gained New Orleans.

Answers

Answer:

2)

Explanation:

They were fighting for claims in North America and since France lost, Britain made them give up most of their claims in North America.

Under what ruler did the Byzantine Empire
reconquer large areas of the Western Roman
Empire?

Answers

Answer:

Justinian I was the ruler of the Byzantine Empire that reconquered large areas of the Western Roman Empire.

Explanation:

What factors led the founding fathers to create a constitutional democratic republic?

Answers

Answer:

The Founders were ever mindful of the dangers of a tyrannical government. So they built a system in which the powers of each branch would be used to check the powers of the other two branches. Additionally, each house of the legislature could check one another.

Explanation:

Hope this helped

A student learning about Texas history is instructed to write a paper about American Indians in Texas. Which of the following facts would be most relevant to the student's assignment?

The Europeans saw the American Indians as superior and had great respect for the cultures.
The Europeans saw the American Indians as superior and had great respect for the cultures.

Geographic factors of Texas determined whether American Indians were nomadic or sedentary.
Geographic factors of Texas determined whether American Indians were nomadic or sedentary.

American Indians adopted the idea of "owning land" from Spanish conquistadores.
American Indians adopted the idea of "owning land" from Spanish conquistadores.

Treaties were always successful in creating peace and determining boundaries between Anglos and American Indians.
Treaties were always successful in creating peace and determining boundaries between Anglos and American Indians.

Answers

Answer:

D

Explanation:

The "casta system" was
a governmental bureaucracy put into place to
address the unique needs and concerns of citizens
* from various racial backgrounds in Spanish colonies.
a method by which indentured servants of specific
racial backgrounds could earn their freedom by
converting to Christianity.
a categorization index that permitted some men to
become Spanish citizens depending on their racial
backgrounds.
O a system of complex categories that legally
separated racial groups into different legal classes.

Answers

Answer:

D

Explanation:

a system of complex categories that legally separated racial groups into different legal classes.

Answer:

D

Explanation:

why didn't' Georgians like the Georgia platform

Answers

They didn’t like their plat for because of low flood production

Answer:

Because they wanted to disrupt the interstate slave trade, weakening  the fugitive slave laws, or abolishing slavery in the district of Colombia.  

Explanation:

I am really into history/ social study's.

Why did the Age of Imperialism begin?

Answers

Answer:

In the Age of New Imperialism that began in the 1870s, European states established vast empires mainly in Africa, but also in Asia and the Middle East. European nations pursued an aggressive expansion policy that was motivated by economic needs that were created by the Industrial Revolution.

Explanation:

What important documents came out of each revolution?

Answers

Answer:

A view of the Federal Hall of the City of New York, as appeared in the year 1797

A View of the Federal Hall of

the City of New York, as Appeared

in the Year 1797.

Henry R. Robinson, Lithograph, 1847.

Prints & Photographs Division.

Reproduction Number:

LC-USZC4-1799

George Washington's Commission as Commander in Chief (1775)

Virginia Declaration of Rights (1776)

Lee Resolution (1776)

Declaration of Independence (1776)

Articles of Confederation (1777)

Treaty of Alliance with France (1778)

Treaty of Paris (1783)

Northwest Ordinance (1787)

Constitution of the United States (1787)

Federalist Papers (1787-1788)

George Washington's First Inaugural Address (1789)

Judiciary Act of 1789 (1789)

Residence Act (1790)

Bill of Rights (1791)

Jay's Treaty (1794)

George Washington's Farewell Address (1796)

Alien and Sedition Acts (1798)

Jefferson's Secret Message Regarding the Lewis & Clark Expedition (1803)

Marbury v. Madison (1803)

Louisiana Purchase (1803)

Treaty of Ghent (1814)

Explanation:

What types of persecution did the Roma face before, during, and after the Holocaust?

Answers

Answer:

n 1933, police in Germany began more rigorous enforcement of pre-Nazi legislation against those who followed a lifestyle labeled "Gypsy." The Nazis judged

Explanation:

Answer:

German department began enforcing pre-Nazi rules against those who maintained a Gypsy lifestyle more aggressively in 1933. The Nazis made their choice.

Explanation:

how did literature help in innovation and preservation of our culture as Filipino?​

Answers

The correct answer to this open question is the following.

Although there are no options attached, we can say the following.

Literature can help in the innovation and preservation of our culture as Filipino because it is an art that includes the sentiment of Filipino authors and represents a collection of stories of the history, culture, customs, and traditions of the Philippines; past, present, and future.

Through literature, people can preserve the valuable history of the island and can serve as a way to support the richness of the life of the Filipino people. The literature contains part of the heritage of values and belief systems of this nation.

That is why it is so recommended to read Filipino authors such as Nick Joaquin, Jessica Hagedorn, José Rizal, and Luis Francia.

What was not true about the economy at the end of World War II? A. The GMP and corporate profits doubled B. National debt quadrupled during the war C. Wage freezes reduce consumer spending D. Efficiencies in farming reduce manual labor needs

Answers

Answer: A

Explanation:

C. Wage freezes reduce consumer spending

The made by João de Castro (1540) depicts a variety of
shing developed by Spain Advancements in technology
including the design of vessels for transoceanic travel
resulted in
greatly expanded trade efforts in the Americas, Africa,
and Asia due to greater shipping capacities and
defensive capabilities,
decreased military tension between European
empires due to the mutual benefit of increased trade.
the development of missionary tleets by the Vatican
to convert indigenous peoples of the Americas, Africa,
and Asia to Christiania
the adoption of new shipping technologies by the
Incan and Aztec empires as they sought to compete
economically with Europe

Answers

Answer:

A) greatly expanded trade efforts in the Americas, Africa, and Asia due to greater shipping capacities and defensive capabilities

Explanation:

took the test

Answer:

A

Explanation:

What country did the Second Crusade begin from?

Answers

Answer: Europe I believe.

Europe
May be
I hope

Did Scott have a good reason to believe that he would win his case? What political events changed this?

Answers

Answer:

The argument Scott used was that because he had lived in a territory where slavery was illegal, he could never again be an enslaved person. He did have reason to believe he would win because this was a doctrine that was recognized in common law for centuries in Europe.

Scott said he could never again be an enslaved person since he had lived in a region where slavery was prohibited.

He had a good reason to think he would prevail because this approach has been upheld in European common law for many years. If Scott wasn't a citizen of the United States, he couldn't file a lawsuit in federal court, and the case would have been improperly granted.

Dred Scott Case in Missouri, 1846–1857. The United States Supreme Court supported slavery in American territory, rejected the legitimacy of black citizenship in the country, and ruled that the Missouri Compromise was unconstitutional in its 1857 ruling, which shocked the whole country.

Learn more about the Dred Scott decision here:

https://brainly.com/question/23987166

#SPJ4

please help me with history

Answers

Answer:

D

Explanation:

Please give me braianliuest

The answer is d jhhhhhhhuhhshshrhdhhfhrhrjrjjffjjrjdjfjfhf

- What were three major events in order from beginning middle end of the War of 1812

Answers

Answer:

America declaration of war against the British is issued. The war is later known as “Mr Madison's War” or “The Second American Revolution.”

Answer:

Explanation:

Battle of Tippecanoe-1811-Ohio River Valley

Congress declares -"Mr. Madison's War"-June 18, 1812-Washington, D.C.

British capture Ft. Mackinac-August 16, 1812-Michigan

Invasion attempts of Canada-1812-U.S.--Canadian border

I need to know if this is right!!

Answers

Answer:

nope

Explanation:

I think is A because each section has different colors which means something

Name four groups that appealed to Wilson for independence

Answers

Answer:

Armenians, Jews, Ukrainians, and Poles

Explanation:

GIVING BRAINLEIST+20 POINTS

What was one restriction placed on free African Americans?
O A. They were responsible for paying for the freedom of their enslaved
OB. They had to pay for public services that were free for white
OC. They were not allowed to participate in antislavery organizations.
D. They were forbidden in many states to learn to read and write.
relatives.
Americans.

Answers

Answer: FIXED VERSION: D, They were forbidden in many states  to learn to read and write. Such as in a story this African American girl, had bodyguards to get into a school but her parents had the money because she was so smart that she got in but there were no other african americans with her. Many african americans had their own way less educated schools. I hope this helped anyone who finds it

Explanation:

Answer:

D

Explanation:

The U.S. acquired all its territory peacefully from countries that wanted to sell land.

True or False

Answers

Answer:

i think its false

Explanation:

3) The center of life in Athens was...*
A) The Parthenon
B) The Acropolis
C) The Agora
D) None of the Above

Answers

I think it is number B........

George Washington talked about foreign alliances in his farewell address. How did George Washington feel about foreign alliances?
A.
He believed alliances were the best chance at protection.
B.
He did not want to see permanent foreign alliances.
C.
He only wanted the U.S. to form alliances with European nations.
D.
He did not want to form alliances with nations already at war.

Answers

Answer:

d because he did not like the war

Other Questions
What is the volume of Box 3? What advice does the RCMP give about handling Cyberbullying? List the strategies provided:a.__________b.__________c.__________d.__________e.__________f.__________g.__________ How were salt and sugar represented differently in the simulation? Why is it a positive thing when the LV (left ventricle) hypertrophies with exercise? Where is Europe located in relation to the United States? What about the location of New York state makes it a good location for trade between the United States and Europe? At Breakfast Break, 2 eggs and 1 sausage patty cost $2.23 and 3 eggs with 2 sausage patties cost $3.76. Assuming that these amounts only pay for the eggs and sausage, how much does one sausage patty cost? what does hi mean in spanish How did technology contribute to the expansion of European power through imperialism? Hey guys can one of you help me pls its only one small question The plugin that changes Jenkins to use green balls instead of blue for successful builds is ________. Decide whether the pronunciation is correct or incorrect. Drag and drop the word into the correct column.encourage en-KUR-Correct PronunciationIncorrect Pronunciationexplain ik-SPLAYNjustity JUHS-tun-tahyplayful PRET-tuhmspecial SLISP-uhtheroic hi-ray-IT An architect draws a plan for a wheelchair ramp on the plan, the ramp is 2cm high and 24cm long what might the dimensions of the actual ramp be (use equivalent ratios) What is the definition of fourteen points? What became of most of the Central powers colonies after World War I? They became independent nations. They remained colonies of Central Powers nations. They became League of Nations mandates. They were run by the League of Nations. TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA The slope of the line below is -1/7. Write a point-slope equation of the lineusing the coordinates of the labeled point. What might be the consequences of your choice? Political: Economic: Social: What are the two ways a subduction zone can be generated? Quienes intervienen en este caso de violencia? En la fragmento de la novela corazn a shop is having a sale all items are reduced by 30% work out the sale price of an item normally priced at 110