Two submarines began dives in the same vertical position to meet at a designated point.

If one submarine was on a course approximated by the equation x + 4y = -14 and

the other was on a course approximated by the equation x + 3y = -8, at what location would they meet?

Answers

Answer 1

Answer:

(10, -6)

Step-by-step explanation:

The solution of the system of the equations given would be the location that they would both meet.

Let's solve:

x + 4y = -14 ----› Eqn. 1

x + 3y = -8 -----› Eqn. 2

Subtract Eqn. 2 from Eqn. 1

y = -6

Substitute y = -6 into Eqn. 1.

x + 4y = -14 ----› Eqn. 1

x + 4(-6) = -14

x - 24 = -14

x = -14 + 24 (addition property of equality)

x = 10.

The answer is: (10, -6)


Related Questions

So the African bush elephant weighs between 4.4 tons and 7.7 tons what are its least and greatest weights rounded to the nearest ton ?

Answers

Answer:

least: 4 tons, greatest: 8 tons

Step-by-step explanation:

.4 round down (5 and up, round up rule)

.7 round up

18.) Which expression is equivalent to -6x + 7.5?
A. -3(2x - 2.5) B. -3(2x + 2.5) C. -3(2x - 7.5)
D.-3(2x + 7.5)

Answers

Answer:

D

hope this helped:)

Tom enjoys going to the hardware store. In the past three
weeks, he has spent a total of $85.84 on a hammer, nail
gun, and box of nails. What amount shows his average
spending per week?
A) $14.31
B) $28.61
C) $69.93
D) $85.84

Answers

Answer:

B) $28.61

Step-by-step explanation:

Average  spending per week:

85.84 ÷ 3 ≈ 28.61

lines DE and AB intersect at point C.
What is the value of X?

12
25
38
52

ignore the answer i marked, i was guessing around. ​

Answers

Answer:

B

Step-by-step explanation:

∠ACE and ∠ECB form a straight angle whose sum = 180°, hence

2x + 2 + 5x + 3 = 180

7x + 5 = 180 ( subtract 5 from both sides )

7x = 175 ( divide both sides by 7 )

x = 25 → C

Write the equation of the line graphed below. ​

Answers

Answer:

Because the line has no slope, we can define this line very simply as:

y = 3

The 7th grade basketball team has won 15 games out of the 20 games they have played this season. If they were to keep up this winning ratio, what is the probability they will win their next game?

Answers

Answer: 3/4

Step-by-step explanation:

I will give a brainliest for if you give me answers

Answers

Answer: When graphing start at (0,6). (1, 8) (3,12) (5,16) The total cost for 7 rides is $20.

Step-by-step explanation:

Answer:

the total cost for 7 rides is $14 plus how much it is to get in the fair is $6 so the total cost to get in and do 7 rides is $20 but the total cost for 7 rides is $14

Step-by-step explanation:

Answer is $14 for 7 rides

PLZ GIVE BRAINLIEST

Given that ABC~LMN
What is the length of AC?

Answers

Answer:

B. 12

Step-by-step explanation:

✔️Find the value of x

The side lengths of two similar triangles are always proportional.

Given that ∆ABC ~ ∆LMN, therefore:

[tex] \frac{AB}{LM} = \frac{AC}{LN} [/tex]

AB = 5

LM = 10

AC = x + 5

LN = 3x + 3

Plug in the values

[tex] \frac{5}{10} = \frac{x + 5}{3x + 3} [/tex]

Cross multiply

[tex] 5(3x + 3) = 10(x + 5) [/tex]

[tex] 15x + 15 = 10x + 50 [/tex] (distributive property)

Collect like terms

[tex] 15x - 10x = -15 + 50 [/tex]

[tex] 5x = 35 [/tex]

Divide both sides by 5

x = 7

✔️Find AC

AC = x + 5

Plug in the value of x

AC = 7 + 5

AC = 12

what is 5 quarts converted to liters

Answers

Answer:

1 quart = 0.95 liters. with this said, we can conclude that 5 quarts equals 4.73 liters

Answer:

4.73176

Step-by-step explanation:

okay so this is the exact decimal but you can just write you answer as 4.73

hope this helps

the ratio of boys to girls in a class is 4:5 what frqction if the class are boys ​

Answers

Answer:

4/9 to 5/9

Step-by-step explanation:

So, out of every 9 students, 4 are boys. Therefore, 4/9 of the students are boys. The ratio of boys to girls is 4:5. So let 4x be the number of boys and 5x be the number of girls.

The Mountain Spring Water Company is moving their backup supply of drinking water to a different site. Each tank weighs according the table shown here. Determine if the function is linear or not.

both
neither
linear
nonlinear

Answers

Linear, because the X is increasing by one!

PLEASSEEEEEEEE HELLPPPPPPPP MEEEEEEEE

Answers

Answer:

D

Step-by-step explanation:

Answer:

The answer is D. Associative and Distributive Properties.

Step-by-step explanation:

P.S Can I have brainliest?

What is the area of this figure? *
15 m
5 m
8 m
8 m

Answers

Answer:

Where is the picture of the figure ?

Answer:

where’s pic

Step-by-step explanation:

?

-8 - 1 = ?

Please show work for credit/ brainliest

Answers

Answer: The answer is -9

Step-by-step explanation:-8 - 1 = -9

It’s simple ! -8 and your getting smaller ( -1) = -9

When are two lines perpendicular?

A. when the slopes are opposites
B. when the slopes are reciprocal
C. when the slopes are negative
D. when the slopes are opposite and reciprocal​

Answers

Answer: C I think

Step-by-step explanation:

What is an equation of the line that passes through the points (3, 0) and (6, -1)

Answers

Y= -1/3x + 1

Please mark BRAINLEST!!

Answer:

(Note: This is assuming that the answer can be in any format.)

[tex]y - 0 = -\frac{1}{3} (x - 3)[/tex]

Step-by-step explanation:

When given at least two points, you can find write an equation using the point-slope formula: [tex]y - y_1 = m (x - x_1)[/tex]. The [tex]x_1[/tex] and [tex]y_1[/tex] are the x and y values from one point that need to be substituted in to make an equation, as well as the [tex]m[/tex] which represents the slope.

Find the slope by using the slope formula [tex]\frac{y_2 - y_1}{x_2 - x_1}[/tex] and the two points given:

[tex]\frac{-1-0}{6-3}[/tex]

[tex]\frac{-1}{3}[/tex]

So, the slope is [tex]-\frac{1}{3}[/tex].

Next, choose a point (in this case, I chose (3,0)) and substitute its x and y values into [tex]x_1[/tex] and [tex]y_1[/tex] respectively, and also substitute  [tex]-\frac{1}{3}[/tex] for m. This forms an equation of a line in point-slope formula:

[tex]y - 0 = -\frac{1}{3} (x - 3)[/tex]

Determine if true. select all that apply

Answers

Answer



1: top one
2:second one

verticle asphotes for the problem depicted in the screen shot.

Answers

Answer:

a. x=3

Step-by-step explanation:

find slope of the line that passes through the two points (3,11) and (9,16)​

Answers

Answer:

5 over 6

Step-by-step explanation:

y2-y1 over x2-x1 is the equation you need. Y2 in this case is 16, Y1 is 11 and X2 is 9 and X1 is 3 so then you just plug it is. 16 - 11 is 5 and 9 - 3 is 6

Simplify {n-1-[n-1-(0 - 1)]​

Answers

Anwser would be -1

Hope this helps

Ricardo ran four miles in 31 minutes. It took him 6.25 minutes to run the first mile. Ricardo ran the remaining miles at a slow and steady speed. How long did it take him to run each of the last three miles?​

Answers

Answer:

8.25 minutes

Step-by-step explanation:

31 minutes-6.25 minutes=24.75 remaining miutes between the last 3 miles so then you take 24.75 minutes÷ 3 miles remaining= 8.25 minutes each last 3 miles

PLEASE ANSWER ASAP I WILL GIVE YOU FREE THANKS

Answers

Answer:

infintely mainly is the answer

Step-by-step explanation:

anyone wanna help me out

Answers

4

slope formula is y2-y1/x2-x1

(18-(-10))/(-4-(-11))
28/7
4

why is it when you take a shower and you come out clean, how does the towel become dirty? This some real mathematics

Answers

okay. so, when you wash your hair, there is no way to get 100% of the shampoo/conditioner out of your hair, so the excess it rubbed onto the towel. Say you have no hair. The shower isn't germ-free, so even if you feel clean, the towel and yourself is still a harbor of germs, good and bad.

Expanded form of 6(y+x)

Answers

Answer:

6y + 6x

Step-by-step explanation:

the expanded form would be 6 multiplied to each item in the parenthesis

this gets you 6x + 6y

The answer is 6x+6y multiply the 6 by everything inside the brackets

F(x)=1/2x+4 and g(x)=−8f(x). What equation shows the correct rule for the function g? A. g(x)=−8x−32. B. g(x)=−4x+4. C. g(x)=−4x−32

Answers

Answer:

f(x)=1/2x+4.

Step-by-step explanation:

A sales person makes $200 each week plus an additional $24 per sale. This sales person wants their weekly paycheck to be at least $500.Which inequality could be used to solve for how many sales () the sales person will have to make to reach or exceed their goal?

Answers

Answer: a.200 + 24x= 500
b. 12.5 sales but since you can’t make half a sale the answer will be 13

Which statement is true of normally distributed data?

A.
Approximately 90% of data falls within 2 standard deviations (±2) of the mean.

B.
Approximately 90% of data falls within 3 standard deviations of (±3) the mean.

C.
Approximately 95% of data falls within 2 standard deviations (±2) of the mean.

D.
Approximately 95% of data falls within 3 standard deviations (±3) of the mean.

Please explain and no answering just for points.

Answers

C

have a nice day!!!!!!!!!!!!!!!!!!!!!!!

Approximately 95% of data falls within 2 standard deviations (±2) of the mean. Option D is correct.

What is a normal distribution?

A normal distribution is a type of continuous probability distribution for a real-valued random variable such that the values are symmetric about a mean and the curve has bell shape.

Standard deviation is the measure of the randomness of the distribution. The curve has its peak at the mean.

As standard deviation increases, the peak of the curve comes lower and the distribution becomes more and more dispersed.

In a normal distribution 68% of the values falls within 1 standard deviation

and 95% of the values falls within two standard deviations. 99% of the values falls within three standard deviations.

Hence, approximately 95% of data falls within 2 standard deviations (±2) of the mean.

To learn more about normal distribution visit:

https://brainly.com/question/15103234

#SPJ1

Consider a binomial experiment with n = 5 trials where the probability of success on a single trial is p = 0.30. (a) Find P(r = 0). (b) Find P(r ≥ 1) by using the complement rule.

Answers

Answer:

0.16807 ; 0.83193

Step-by-step explanation:

Given that:

Number of trials, n = 5

Probability of success, p = 0.30

P(r = 0)

Using the binomial probability relation :

P(x =r) = nCr * p^r * (1 - p)^(n - r)

(a) Find P(r = 0).

P(r = 0) = 5C0 * 0.3^0 * (0.7)^(5- 0)

= 1 * 1 * 0.16807

= 0.16807

(b) Find P(r ≥ 1) by using the complement rule

P(r ≥ 1) = 1 - P(r = 0)

P(r ≥ 1) = 1 - 0.16807

P(r ≥ 1) = 0.83193

12x+5y=95
find the x-intercept

Answers

Answer:

(95/12,0)

Step-by-step explanation:

Answer:

(7.916, 0)

Step-by-step explanation:

In order to find the X-intercept, let y=0

12x + 5(0) = 95

12x = 95

95/12x = 7.91666...

Therefore, the x intercept is (7.916, 0)

Other Questions
An architect draws a plan for a wheelchair ramp on the plan, the ramp is 2cm high and 24cm long what might the dimensions of the actual ramp be (use equivalent ratios) What is the definition of fourteen points? What became of most of the Central powers colonies after World War I? They became independent nations. They remained colonies of Central Powers nations. They became League of Nations mandates. They were run by the League of Nations. TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA The slope of the line below is -1/7. Write a point-slope equation of the lineusing the coordinates of the labeled point. What might be the consequences of your choice? Political: Economic: Social: What are the two ways a subduction zone can be generated? Quienes intervienen en este caso de violencia? En la fragmento de la novela corazn a shop is having a sale all items are reduced by 30% work out the sale price of an item normally priced at 110 Hello can someone help me with this question please! 2 3/8 x 3 3/4 divided by 2 2/3 HELP PLEASEAt Love Canal in the 1970s, there was an environmental disaster. In response, the Superfund law was passed. Why can we view Love Canal and the creation of the Superfund as a positive environmental event? A. It allowed the EPA to find toxic waste sites and force the responsible parties to clean up the sites. B. It provided money to businesses responsible for toxic waste sites to clean up their pollutionC. It helped boost the economy among those waste sites D. It helped identify toxic waste site and move people away from them what do you understand by the term current state and define its SI unit......... help please! thank you!The ratio of cats to dogs is 8/6, which can be simplified to 4/3. The ratio of fish to birds is 20/2. Can it be simplified to 10? Why or why not? Answer in complete sentences. Its an inequality I need the work for it ik the answer do you have any song writing tips whats 43.6 rouded to the nest tenth I dont know how to do this can someone help? What should be included in the conclusion of an informative essay? Check all that apply.A hookA thesis statementA summary of key detailsA restatement of the thesisA judgment or observation I'm very confused please help