I Will Give BRIANIEST
A scientist tests the water in a local pond and finds that it has a pH of 7.9.
What is true about the water sample?
Choose 1 answer:
(Choice A)
A
It is basic.
(Choice B)
B
It is acidic.
(Choice C)
C
It is neutral.
(Choice D)
D
It is both basic and acidic.
Answer:
it is Basic brooooooo. No B NOT C AND NOT D. oNly A
The answer is A. The ph of regular water is about 7.0 or so. so since it's 7.9 it means it's basic. You're welcome :)
What might be the consequences of your choice?
• Political:
• Economic:
• Social:
Answer:
Political: Lobbyists.
Economic:Farmers and industrial companies will significantly reduce their output and reduce local jobs. The companies that sell pesticides and fertilizers to local companies will also suffer losses. Farmers will suffer the most if they are unable to find safer fertilizers and pesticides to use.
Social:After a period of time, water pollutants will reduce to safe levels. This could be a long wait. Poverty may increase in the region due to lost jobs and income.
Explanation:
a sedimentary rock formed from clay deposits
Answer:
is it shale
sorry if that's not right it's kinda confusing how you put the question
Explanation:
the combination of a heart arteries and veins and capillaries is____
Answer:
A (an organ system)
Explanation:
An organism is currently using light energy to make food. Based on what you have learned, this organism will be best classified as
Answer:
This organism is best classified as an autotroph.
Explanation:
Autotrophs can make their own food.
What is the independent variable?
What is the dependent variable?
Answer:
the independent is the age of the tree and the dependent is the diameter
Explanation:
the diamter of the tree is based off of the age as we can see that it gets bigger the older the tree is
Answer: Independent variable: age of the tree (years), Dependent variable: tree diameter (mm)
The diameter of the tree is dependent on what age the tree is. As the tree gets older, the diameter increases. The dependent variable depends/relies on the value(s) of the independent variable.
During a period of drought, members of a community may volunteer to water their lawns every other day, rather than daily. The most important benefit of this action is - It adds nitrogen to the soil It fertilizes the soil It reduces air pollution It conserves the groundwater supply
Answer:
hi love you have a nice day
Explanation:
explain how water properties help get water from the roots of plants to leaves
Answer:
In order for water to move through the plant from the soil to the air (a process called transpiration), soil must be > root > stem > leaf > atmosphere. ... Because of this difference in water potential, water will move from the soil into a plant's root cells via the process of osmosis.
Explanation:
Pls help :)) worth 10 points (:
Answer:
A
Explanation:
just go for A
Whats the answer giving brainliest HELP!!!!!
Answer:
I feel like the first one is the best
Explanation:
widening the roads will just cause more cars.
raising the price is most likely not gonna help but its an option.
expanding just means more cars
How does the double helix structure of DNA support its role in encoding the genome?
1)The sugar-phosphate backbone provides a template for DNA replication
2)tRNA pairing with the template strand creates proteins encoded by the genome
3)Complementary base-pairing creates a very stable structure
4)Complimentary base pairing allows for easy editing of both strands of DNA
Answer: Complementary base- pairing creates a very stable structure
Explanation:
The double helix structure of deoxyribonucleic acid (DNA) support its role in encoding a genome because the: 3. Complementary base-pairing creates a very stable structure.
A double helix can be defined as the spiral configuration of the deoxyribonucleic acid (DNA) molecule.
In Biology, a double helix is typically used to describe the molecular structure of a double-stranded deoxyribonucleic acid (DNA) molecule, which comprises two (2) linear strands that are complimentary and run opposite to each other and twist together (anti-parallel).
Hence, the complementary base-pairing in a double-stranded deoxyribonucleic acid (DNA) or double helix structure of deoxyribonucleic acid (DNA) helps to create a very stable structure, which in turn makes it possible to encode a genome.
Read more: https://brainly.com/question/19755749
what tissue breaks down food for energy
Answer:
When the stomach digests food, the carbohydrate (sugars and starches) in the food breaks down into another type of sugar, called glucose. The stomach and small intestines absorb the glucose and then release it into the bloodstream.
What boundary is present at the Philippine plate and the Eurasian plate?
A convergent boundary resulting in earthquakes and volcanic activity
B transform boundary resulting in fault lines and shallow earthquakes
C divergent boundary resulting in mid-ocean ridge and creation of new sea floor
D convergent boundary resulting in mid-ocean ridge and widening of ocean basic
Answer:
D
Explanation:
A large bowl contains a mixture of soil and iron powder. What would be the best way to separate the iron powder from the soil?
Answer:
Add magnet to the bowl, cover the bowl, and shake well
Explanation:
Anything with MAGNET
MARKING PEOPLE AS BRAINLIDT IF CORRCET
True or False: Bone cells contain different DNA than blood cells.
Answer:
True the bone cells do have different DNA than blood
Explanation:
which of the following are part of the central nervous system?
Answer:
The central nervous system is made up of the brain and spinal cord
Explanation:
ion if that's the answer you were looking for but here go.
Desert plants and animals are adapted to the lack of what and high
Answer:
lack of water and high concentration of heat and dryness
Explanation:
Deserts don't get that much rainfall, so desert wildlife are adapted to survive in such a dry climate. Take the camel, for instance, it can store three bathtubs of water in it's hump, so it can go a very long time without water. And without that rainfall, the desert is dry and, usually, very hot. Animals have adapted to this by only coming out in the nighttime when it's cooler.
hope this helped:)
plz help me i beg of you!???
Answer:
Pretty sure it's D, because the birds beak evolves to crush those grains as a result of certain food available in their habitat, although it does not say "diet" as an option so D is your best guess.
Explanation:
TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
Answer:
I don't know the answer
Explanation:
is is this even a question cos I don't think so.
In organisms other than plants, when and where is the most ATP produced?
in cytoplasm, during photosynthesis
in nuclei, during cellular respiration
in chloroplasts, during photosynthesis
in mitochondria, during cellular respiration
Answer:
D. In mitochondria, during cellular respiration.
Explanation:
A cell can be defined as the fundamental or basic functional, structural and smallest unit of life for all living organisms. Some living organisms are unicellular while others are multicellular in nature. A unicellular organism refers to a living organism that possess a single-cell while a multicellular organism has many (multiple) cells.
All living organisms such as plants and animals require energy to function properly (life activities). Thus, the organelle where energy from nutrients is released is generally referred to as mitochondria. Animals retrieve energy using mitochondria to do cellular respiration because they typically act like a digestive system by taking in nutrients, breaking them down and obtaining energy rich molecules for cell-life activities.
Cellular respiration can be defined as a series of metabolic reactions that typically occur in cells so as to produce energy in the form of adenosine triphosphate (ATP). During cellular respiration, high energy intermediates are created that can then be oxidized to make adenosine triphosphate (ATP). Therefore, the intermediary products are produced at the glycolysis and citric acid cycle stage.
Basically, mitochondria is one of the cell organelles found in all living organisms and it is known as the powerhouse. Therefore, mitochondria provides all the energy required in the cell by transforming energy forms through series of chemical reactions; breaking down of glucose into Adenosine Triphosphate (ATP) used for providing energy for cellular activities in the body of living organisms.
In organisms other than plants, the most ATP is produced in mitochondria, during cellular respiration.
Answer:
D
Explanation:
got it right on edge
Help. It is due today
Answer: B
Explanation: tadpoles lack limbs and possess longtails, adult frogs on the other hand have two hind limbs and two fore limbs
Which relationship is an example of commensalim?
Lister cultured the bacteria responsible for milk spoilage.
True
False
Answer:
True
Explanation:
Artificial selection applies only to dog breeding?
True OR False.
Answer:
Domestication is the act of separating a small group of organisms (wolves, in this case) from the main population, and select for their desired traits through breeding. ... Dog breeding is a perfect example of how humans select for desirable or fashionable traits.
true...?
Explanation:
Answer:
False.
Explanation:
The bananas we have today were created using artificial selection. Same thing with peanuts by the way.
A botanist finds that when compared to pink flowers, the population of purple flowers is very high. Ten years later, the population of purple flowers is nearly gone, and the number of pink flowers has tripled. Why would this be?
Answer:
Because of the reduction or near extinction of the purple flowers noticed by the botanist Ten years after it was in abundance, this fall in the population could be caused by the unfavorable change in the plant's environment. While the pink flowers tripled because some factors in the environment were favorable for its growth.
Explanation:
From the question, it was mention that the botanist noticed at first purple flowers had more population than the pink flowers and that changed after 10 years when the population of the pink flowers tripled and purple flowers were nearly gone. Some of the causes that could be responsible are:
1. Disease and pest attack on the purple flowers.
2. The pink flowers developed a good survival mechanism even in adverse conditions.
3. Environmental stress could also come into play on the purple flowers.
4. Climate which initially supported the growth of the purple flowers had changed. Because variations exist in plants and the ideal conditions necessary for plant growths and proliferation varies among plants.
.
Is a seed a living organism
Answer:
Yes they are living organisms
Your class is using engineering principles to improve the design of football helmets to prevent brain injury. Your teacher divides you into groups and gives you various supplies (such as tape, bubble wrap, and foam) to create, design, and build a new helmet. Which of these is a benefit of this type of project in STEM education?
Students learn to follow steps provided by their teacher.
Students use household items to create new products.
Students participate and apply engineering principles.
Students become confident in working independently.
Answer:
B
Explanation:
Answer:
#2
Explanation:
Students use household items to create new products.
An idea in science is supported or rejected after several
Question 23 options:
publications
experiments
alterations
meetings
Answer:
experiments
Explanation:
Answer:
experiments
Explanation:
I took the test
And, what else it literally says CHECK ALL THAT APPLY like....
Answer:
i dont understand??????
Explanation:
Answer:
What??
Explanation:
This makes no sense to me...
I need help. Due today.
Answer:
D) common ancestry among vertebrate species