TIME REMAINING
45:50
Read the excerpt from stanzas 3 and 4 of "The Turtle.”

It isn’t even hers but came to her
in the rain or the soft wind,
which is a gate through which her life keeps walking.

She can’t see
herself apart from the rest of the world
or the world from what she must do
every spring.
Crawling up the high hill,
luminous under the sand that has packed against her skin,
she doesn’t dream

Based on what is happening in this part of the poem, the repeated "s” sound most likely relates to

the natural flow of the turtle’s actions.
the turtle’s difficulty building a nest.
how the turtle views the seasons.
how the sand feels to the turtle.

Answers

Answer 1

The effect which the repeated "s” sound have on this part of the poem is;

The addition of rhythm to the poem. It also adds a sneaky mood to the poem.

The repeated use of the 's' sound in this poem is reflective of a poetic device known as alliteration.

Alliteration is the repetition of the initial sounds of consonants in a group of nearby words.

Alliteration is an important poetic device because it helps to add rhythm to a poem.

In the poem, we see an individual being described who got something easily. Just like the crawling of a snake, the 's' sound used in this poem also adds a sneaky feeling/mood to it.


Related Questions

i’m not sure which one it is ):

Answers

Answer:

You were right. It's the last one. Good job~!

Explanation:

3 page on the dangers of driving unlicensed​

Answers

Answer:

Wheres the question???

Final Exam
Status
38
Exam
The words below have a similar
denotation. Which word has the
most positive connotation?
docile, unstable, flexible
A. docile
B. unstable
C. flexible

Answers

Answer:

flexible

Explanation:

docile seems to have a neutral connotation and unstable has a negative connotation. usually, the word flexible is describing a positive aspect, making it have a positive connotation.

write a eassy on why pizza is the best food

Answers

Answer:

The Italian dish, Pizza became my favorite when for the first time I had a margarita cheese pizza with extra cheese on it. It was a medium-sized pizza with servings for six people each or three people if they ate in pairs. The Pizza was hot and spongy to touch. Its top layer was swollen and round shaped. I sprinkled chili flakes and oregano for great taste, and after this when I took a slice of pizza, the cheese was melting and gave yummy taste my tongue. With packed Pizza, inside it also had sachets of tomato sauce that I also tried on another slice of Pizza that I took.  

Background knowledge is

Answers

Background knowledge is the amount of information or knowledge someone has on a particular topic.

In the stories Lost in the Woods and Buried in a Blizzard, the main characters persevered through a difficult time. In your opinion, which character from the two texts is the most legendary? Use evidence from both texts to support your opinion.

Answers

Answer:  

The most legendary character is from the story "Buried in a Blizzard."

  The protagonist of the narrative "Buried in a Blizzard" is the most legendary because, despite being hurt and tired, she was able to make her way back to the safety of the cabin. She was also successful in locating food and shelter for herself and her dog. This is an incredible accomplishment, particularly given her injuries and exhaustion.

The figure from "Lost in the Woods" is likewise a legend, although not to the same degree as the character from "Buried in a Blizzard." This is due to the fact that the protagonist of the narrative in "Lost in the Woods" was only able to find his way back to the safety of the cabin. He couldn't find food or shelter for himself or his dog.

Finally, the most legendary character comes from the story. "Buried in a Blizzard" because she was able to make her way back to the safety of the cabin despite being wounded and fatigued. She was also successful in locating food and shelter for herself and her dog.

Explanation:

Learn more about Legends at:

https://brainly.com/question/1270863

Read the passage from "Christabel. " It was a lovely sight to see The lady Christabel, when she Was praying at the old oak tree. Amid the jaggĂ©d shadows Of mossy leafless boughs, Kneeling in the moonlight, To make her gentle vows; Her slender palms together prest, Heaving sometimes on her breast; Her face resigned to bliss or baleâ€" Her face, oh call it fair not pale, And both blue eyes more bright than clear, Each about to have a tear. Which lines contain diction that creates the overall tone? Check all that apply. It was a lovely sight to see Amid the jaggĂ©d shadows To make her gentle vows Her face, oh call it fair not pale Each about to have a tear.

Answers

I believe that all the answers are correct. They all provide a tone for the story

The corrective statement from the given phrase was the Tone , meas how the narrator presenting the story among the audience and how the narrator hold the audience .

According to the passage the lady love to pray the Oak tree which indicate the believe of the lady towards the worship and the tome of the narrator was so smooth that reader and the audience love to hear the complete story .

The tone indicate the way of narrating the poem among the present audience and also make the environment that everyone present there will enjoy the story and can relate to their life.

For more information on Tone , please refer the below link :

https://brainly.com/question/1416982

Short stories include what the characteristics?

Answers

Answer:

Length: Short stories typically range from 1,600 to 20,000 words.

Subject: Short stories usually focus on a single subject or theme.

Limited number of characters: Due to the limitations of the genre, short stories typically focus on just one or a couple characters.

9. What does this sign mean?
A. Length limit C. Height limit
B. Speed limit D. Width limit

Answers

Where is the sign dude ??
Your question cannot be answered if you do not provide the image of the sign referenced in the question.

What is an inference that can be made about Dr. Mesmer’s skill?

Answers

Franz Mesmer was a German doctor and he was interested in astronomy. The existence of the natural energy transference is theorised by Franz Mesmer. This term is also called as the animal magnetism. He has deduced the theory on the basis of many methodologies and the experiments which he has done on the patients individually and in groups. A series of experiments was conducted by him and the results were concluded on the basis of further investigations.

he didn't give me a peany
->never

Answers

He never have me a penny......

what is ironic about the words of the second group of aliens in paragraph 45-53?

Answers

After reading the short story "The Wretched and the Beautiful," we can say the following is ironic about the words of the second group of aliens in paragraphs 45-53:

The second group of aliens make it seem as if humans have been treating the first group of aliens with kindness and tolerance, and as if the first group of aliens has been violent and abusive.Those words are ironic because the situation has been the complete opposite. The first group of aliens has behaved well, humbly, and politely. The humans are the ones who have mistreated them - even killed them.

What happens in "The Wretched and the Beautiful"?In the story, two different groups of aliens come to our planet. The first group consists of creatures with an awful appearance. Even though they are humble and polite, they are quickly misjudged by humans.The second group consists of beautiful creatures. Because of their pleasing appearance, they are immediately trusted by humans, even though they have nothing to prove their words to be true.The first group asked for refuge on Earth, which was unwillingly granted by humans. However, it didn't take long for humans to start attacking the aliens, even killing them.The second group comes to take the first group away with them. Humans are happy to let them go, acting as if they have been the victims of the first aliens.

What is ironic in paragraphs 45-53?The irony lies in the fact that the second group of aliens speak as if humans have been nothing but kind to the first group. In reality, it has been the opposite.The first group of aliens never stood a chance due to their appearance. Being different in a way considered strange and ugly, they were doomed to be mistreated by prejudiced humans.

Learn more about irony here:

https://brainly.com/question/2893936

Help, no links please



How does the author of “Finding Flight” incorporate ideas from the poem “‘Hope’ is the thing with feathers” into her work? How does she transform ideas from the poem in her work? Use evidence from the text to support your response. Your response should be at least one complete paragraph

Answers

In Emily Dickinson’s poem, she uses metaphor, likening the notion of hope to a bird that flies despite “the storm”, the cold of “the chilliest land” and the isolation of “the strangest sea” and because such metaphorical bird “flies” inside one’s “soul”, such hope is personified. In Finding Flight, the process is similar although here the text is not a poem but a story in prose. The device of remembrance of the figure of the late grandfather turns a hummingbird into a symbol of hope for the narrator. There is no metaphor here but actually symbolism. The hummingbird symbolizes both hope and the memory of the beloved grandfather who has “passed”. The bird “gives hope” both to the grandfather and the granddaughter. The plot structure is the same for both works, a reflection on the luminosity of hope, then a period of hardship that tests hope and then the resilience of hope despite all the troubles and darkness of life.

write a summary of Macbeth act 5 in one paragraph​

Answers

Answer:

A messenger enters with astonishing news: the trees of Birnam Wood are advancing toward Dunsinane. Enraged and terrified, Macbeth recalls the prophecy that said he could not die till Birnam Wood moved to Dunsinane. Resignedly, he declares that he is tired of the sun and that at least he will die fighting.

Explanation:

Write a poem about economics

Answers

Economics the great big player
Watching everyone so close
The economist vs the world
Nobody will ever know

I HATE THIS SUBJECT

50. Look at the state of the gate. It needs …
as soon as possible.
A, to repair
B. repairing
C. being repaired
D. be repaired

Answers

Option B is the answer.

Look at the state of the gate. It needs repairing as soon as possible.

Answer:

to repair

Explanation:

D can also be right if we add to before the 'D' statement


741.5 FRO What section of the library does this book go in?

Answers

it depends on what library your in but ask the library girl or man I don't know ehat they are called but try asking them

what is the meaning of enhanced​

Answers

Explanation:

it sometimes depends on the question but enhance means increase or improve something

for math it will mean increase and for english or something else it will mean improve or make it better

Answer:

enhance: to increase or improve (something)

Explanation:

example: The image has been digitally enhanced to show more detail.

Select the correct answer from each drop-down menu. They decided to leave the cabin in the mountains because there was not enough there to get them through the winter. The appearance of his home contrasted with his easygoing personality. The alchemist tried to the iron into gold. The town was so that no one had heard of it.

Answers

The correct answer from the given passage is :

Option A

They decided to leave the cabin in the mountains because there was not enough there to get them through the winter.

The Englishman has attempted to achieve his Personal Legend by doing research and requesting somebody to simply offer him the response of how to transform lead into gold.

The Alchemist, rather than simply offering him the response, lets him know that he really wants to proceed to attempt. This is a significant illustration.

Throughout everyday life, you can research and learn about others doing what you need to do, yet until you go out and really attempt to do it without anyone's help, you're not achieving anything.

The Englishman fills in as a differentiation to Santiago's technique for learning. Santiago meets him when the two are preparing to join the troop.

The Englishman is hysterically searching for the notable scientific expert who is shown to occupy the Al-Fayoum Oasis. He feels that most of his understanding will be found in books and doesn't acquire in actuality the way in which that Santiago does.

Right when Santiago reestablishes the books he has credited, he reacts in an extreme way, considering inside that his soul should be too rough to even consider evening ponder understanding those things found in the academic books.

For more information, refer the following:

https://brainly.com/question/8692066

Answer:

1 They decided to leave the cabin in the mountains because there was not enough sustenance there to get them through the winter.

2 The austere appearance of his home contrasted with his easygoing personality.

3 The alchemist tried to transmute the iron into gold.

4 The town was so obscure that no one had heard of it.

Explanation:

FOR PLATO/ EDMENTUM USERS

There is a park near my house with a brand-new baseball field.

What is the function of the word near in the sentence?
adverb

interjection

conjunction

preposition

Answers

Answer: Preposition

Explanation:

Essay on why soccer players should wear headgear

Answers

um Concussions

Answer:

Un  why would yall do an essay on soccer get a life.

Explanation:

Select all words that make up the prepositional phrase in the sentence.


The town officials have to survey the area around the park.

Answers

Answer:

around the park

Explanation:

Is this transitive or intransitive???

The parade will begin in front of City Hall.

Answers

Answer:

Intransitive Verb

Explanation:

Intransitive is a finite verb that does not need an object to make a complete sentence is called an intransitive verb. Examples of Intransitive Verb: A flock of birds is flying over our heads. We laughed so hard that we could not talk for a few minutes.

A transitive verb can take more than one object. Donovan gave his sister a laptop. In this sentence, there is an indirect object, "his sister," and a direct object, "a laptop." However, there is another way to say this same idea using a prepositional phrase. Donovan gave a laptop to his sister.

Answer:

Intransitive

Explanation:

Modified True or False

Direction: Write True if the statement is correct. If it is incorrect, underline the word that makes the statement untrue then write the correct word. Write your answer in your test notebook.
________1. Mango is an example of fruit with high acidity.
________2. Foods with low amounts of hydrogen ion have low ph.
________3. Oily products tend to spoil slowly when inadequately packaged.
________4. When foods undergo chemical processes, foods may already be considered spoiled.
________5. Secondary package allows for the unit packs to be carried in bulk.
________6. Use of the primary package is normally for bulk transport in large warehouses.
________7. Foil packaging is one of the oldest and most common methods of food packaging in homes.
________8. Manufacturers should appear on the label of the food package.
________9. Canned foods come in a limited variety.
________10. When labelling, instructions for use should appear on the food package.

Answers

Answer:

.false .false .true

Explanation:

1.false 2 false 3.true

Can someone plz help me? :(

Answers

the answer to your question is B.) Tense

The answer is B!!, good luck

1) According to section six of the passage, the easiest way to assemble the quilt is by using the reverse bag method. Based on this
information, you can tell that the author
A) invented the reverse bag method.
B) dislikes the final steps in assembly
has trouble assembling her own quilts.
D) has used the reverse bag method before.

Answers

It is D, I would not put the section in there if I had not used the method myself!

4. What does O.Henry mean when he says that “life is made up of sobs, sniffles, and
smiles, with smiles predominating"?

Answers

Answer:

Maybe, O.Henry means...In life you won't always get what you want and have everything go your way all the time. There will be times with disappointment and there will be times with unbelievable gratitude. But there is always a choice to how you will respond or react in that moment.

How can we see the actions/behaviors/theme of “my soul it’s too much charged with the blood of thine already” in society today

Answers

Answer:

PFFT whatever this is, it looks hard

Explanation:

Sorry, I'm just stoopid, and I really do apologize if I'm annoying you

Choose the best answer to complete the following sentence.Eat ……………… junk food. It makes you fatA.manyB.littleC.moreD.less

Answers

Answer:

Option C (more)

Explanation:

Option B and D won't be used because little or less junk food won't make you fat now we are left with option A and option C. Many is used to express quantities that are countable and the word more is used to express quantities that are uncountable and since junk food is uncountable we will be using the word 'more' for this sentence.

Eat more junk food, it makes you fat.

Answer:

C

Explanation:

b/c less and little food not makes fat. and also many used for countable things

4. Why should main points be limited in a speech?

Answers

Answer:

Because you will need to further elaborate.

Explanation:

If you have too many main points, you will need to have a long speech, and most speeches are supposed to be concise and to the point.

Other Questions
Gravitational force acts on all object in proportion to their masses. Why then, a heavy object does not fall faster than a light object? Eleventh gradeX.1 Identify and correct errors with subject-verb agreement 08SYou have book covers to reveal! Co toFind the error with subject-verb agreement. Select the incorrect verb and type it correctiy.The metric system, first created by French scientists in the 1790s, isbased on a unit of length known as the meter. Approximately 3.28 feetare the equivalent of one meter,This is for English !!! Blair worked for 4 2/5 hours and earned $36.30. How much would she earn if she worked for 5 4/5 hours? Enter your answer in the box.PLEASE HELP ASAPPPPP!!! I WILL GIVE BRAINLIEST AND 50 POINTS!!! PLEASE HELP!You are camping and have only a 3 cup container and a 5 cup container. You need to measure 1 cup of water into a pot. How can you do this? Is there more than one way? Explain. How does Equiano's fear of being eaten by slavers serve as a metaphor for slavery itself ? 12 for every 2 male birds in a bird cage there are 5 females. What is the ratio of the males to females 2.5kg of potatoes cost 1.40work out the cost of 4.25kg pls help (written response pls) 3) Match the outline for the Federalist Papers written in Federalist No. 1. (in order as they appear) the additional security which its adoption will afford to the preservation of that species of government, to liberty, and to property the insufficiency of the present confederation to preserve that Union its analogy to your own state constitution the necessity of a government at least equally energetic with the one proposed, to the attainment of this object the utility of the Union to your political prosperity the conformity of the proposed Constitution to the true principles of republican government Julia went into a movie theater and bought 2 bags of popcorn and 5 pretzels, costing a total of $37.25. Zoe went into the same movie theater and bough 8 bags of popcorn and 9 pretzels, costing a total of $102.25. Write and solve a system of equations to determine the price of each bag of popcorn and the price of each pretzel. HELP URGENT!!! RESPOND QUICKLY!!! Why do regions/places have different types of climates? Try to give an example in your answer (PLEASE HELP - This is a essay thing that needs done!! I am so behind in assignments I BEG YOU FOR HELP!!) Sometimes, people do not realize justhow amazing they really are; this is evidentin Alberto Moravias Poor Fish. Usingtextual evidence, explain the narratorsstruggle in Poor Fish. Then, discusswhether one persons support and belief ofanother can positively affect that person.*This must be written in third person, andeach body paragraph should include at leastone direct quote from the text. Which of the following are valid names for the given triangle? Check all thatapply. Transcribe the following Strand of DNA:GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT PLS ANSWER QUICK I HSVE EXAMS COMING UP VERY SOON 42) Which equation best represents the line of best fit for thisscatter plot?A. y = 4x - 4B.y= 4x-2C. y = x-4D. y=x-2-5-4-3- e. Observe: notice or perceivef. Infer:g. Repetition:h. Replication:i. Data What does the narrators description of the wallpaper reveal about the context of the story? The narrator feels imprisoned by her life. The narrator wants everyone to study the wallpaper. The narrator thinks that the wallpaper hides a secret room. The narrator prefers to do her writing work at night. Which phrase best describes the harlem renaissance?. Which graph could potentially have a correlation coeffiecient (r value) of 0.95?