The sun's inner core is the hottest part of the sun. (2 points)
True
False

Answers

Answer 1

Answer:

True

Explanation:

Answer 2

Answer:

true

Explanation:

because since the core is the farthest away from space it will continue to burn inside of the core,  leading to more heat building up in the inner parts.


Related Questions

help please 30 points will give brainliest
Plants release the waste ___________ during cellular respiration and ____________ during photosynthesis.

fill in the blanks

Answers

Plants release the waste carbon dioxide during cellular respiration and oxygen during photosynthesis.

How many sugar phospha te backbones are in one strand of DNA?

Answers

Answer: Two

Explanation: In double-stranded DNA, the molecular double-helix shape is formed by two linear sugar-phosphate backbones that run opposite each other and twist together in a helical shape. The sugar-phosphate backbone is negatively charged and hydrophilic, which allows the DNA backbone to form bonds with water.

3) identify and describe three abiotic characteristics of ecosystems. Give an example of how each

characteristic could be affected by a human activity

Answers

Answer:

The abiotic characteristics of an ecosystem that affects man includes: Land surface, rainfall and relative humidity.

Explanation:

In the ecosystem, man occupies the terrestrial habitat which is affected by the abiotic factors listed above.

Abiotic (non- living) factors determine the type of biotic (living) community that is found in an ecosystem. These factors include Land surface, rainfall and relative humidity, just to mention a few.

--> LAND SURFACE: This is responsible for the marked variation in the vegetation of a place. For example, a mountain in the tropics may have a rain forest vegetation at it's base and an afroalpine vegetation near its peak. The gradient of the slope affects the growth of organisms. A steep slope encourage fast run - off of water and therefore encourages erosion, which results in shallow and infertile soil. This in turn AFFECT man's farming activities as there would be little to no crop yield.

--> RAINFALL: Water is a very important abiotic factor that affects life. The main source of water to terrestrial habitat is rainfall. When rain falls, a greater percentage of it sinks into the soil while the rest run- off into water bodies. Water is absorbed by root hairs into the plant and used for photosynthesis to produce food. The absence of rainfall in the environment of man could lead to drought which AFFECTS man negatively.

--> RELATIVE HUMIDITY: This is a measure of the amount of moisture in the atmosphere. It's usually high in hot wet regions. It affects the rate at which water evaporates from the body surfaces of organisms. Low relative humidity cause more water (sweat) to evaporate from body surfaces giving the human body a cooling effect. But in high relative humidity, the sweat cannot evaporate leaving the body feeling hot and sticky. This AFFECTS man as the body tries to cool off in a harder way by increasing rate of respiration and depth of blood circulation.

during an experiment scientists study a portion of a gene found in the white mouse. they determined that the following sets of codons has been translated into a series of three animo acids shown below
mRNA sequence- GCA-UUA-UCG
amino acids sequince- alanine - leucine - serine
which of the following would be the expected outcome of this same set codons were to be found in humans genes
The human cell would be unable to translate the mRNA codons.

The sequence of amino acids would be completely different in the human.

The amino acid sequence would be identical in the human cell.

The human cell would be converted into a mouse cell.

Answers

Answer:

the amino a acid sequence would be  identical to human cell

becuuse the codes sequencing is simialr in all animals

How does competition limit the amount of individuals in populations?

Answers

Answer:

Due to competition, many animals starve, many become prey, etc.

Explanation:

Provide two reasons why it is important to isolate undigested plant cells.
I need this asap

Answers

Answer:

It helps to support growth and helps producing energy to do vital functions.

Hope this helps!

A reliable DNA analysis is based on the DNA conditions. The importance of using undigested cells is that DNA is well-preserved, not affected by external factors, and can be used to compare it to database sequences.

------------------------------------------

Dr. Pringle studies niche partitioning and competition reduction among coexistent species in Africa.

He is interested in knowing the exact source of food of different herbivorous species. To do so, he is using the technique of DNA metabarcoding.

He collects fresh animals' dung and gets the indigested plant cells.

DNA is isolated, sequenced, and compared with the DNI of known species, which are a potential source of food for these animals.

Once he matches the cells' DNA with the corresponding plant species from the database, he can use this information to detail the animal's source of food.

The importance of getting fresh, undigested cells from the dung, is that

The animal's digestive enzymes have not broken the cell walls and digested the cell content. The dung environmental conditions such as pH, temperature, or microbiota have not affected the cell's DNA. Undigested cells' DNA is well-preserved and can be used to compare it with the plant species database.

------------------------------------------------------

Related link: https://brainly.com/question/19670710?referrer=searchResults

                    https://brainly.com/question/15195300?referrer=searchResults

Meiosis and Mutations are both sources of/for:
O Genetic Drift
O Polyploidy
O Mutations
Genetic Diversity

Answers

Answer:

genetic drift

please mark as brainlest

Match each idea about evolution to the person or group where it originated from the drop down menu

Answers

Hello. You did not present the ideas about evolution to which the question refers, which makes it impossible for your question to be answered. However, I will try to help you in the best possible way, showing you the main ideas about evolution and the people who originated them.

According to Jean-Baptiste organisms evolve as a way of seeking perfection.

According to the ancient Greeks and Romans, all living things are in a constant process of change. This change causes evolution and when a living being evolves it causes the evolution of another living being, since everyone is connected and related.

According to Darwin, evolution occurs over time and through an ancestor. For him All living beings have a common ancestor, which evolved over time and generated new species. Darvin also believes that any characteristic acquired by evolution could be passed on to the descendants.

According to Malthus, living beings generate a number of descendants disproportionate to the resources necessary for their survival and this causes evolution.

Explain why only certain substrate can combine with enzymes.
Help me please​

Answers

Answer:

sry i cant i too dubm need points tho

Explanation:

Vacuoles are found in plats, animals, and single-celled organisms.
In plants, vacuoles can occupy up to 90% of the cell while in animals, vacuoles are much
smaller and also help store ions and nutrients.
Single-celled organisms that live in aquatic environments like the paramecium, have a
contractive vacuole to maintain homeostasis.
Based on the information given, how does a vacuole help an organism maintain homeostasis?
A. It helps by regulating water amounts within the cell.
B. It helps by keeping a rigid structure at all times,
C. It helps by excreting salt as part of osmosis
D. It helps by controlling the movement of gases into the cell.

Answers

Answer: c

Explanation: because it helps by excreting

An organism with a mutated cell

Answers

Answer:.

An organism with a mutated cell is mutant

Hope this helps!

The image represents the mitosis process and it is important because:

A. produces gametes with half genetic information than parent cell.
B. allows processes as growing and repair tissues in the body.
C. does not produce cells with the same genetic information than parent cell.
D. always produce somatic cells with the same characteristics, it does not matter the organ in the body.

Answers

Answer:

B. allows processes as growing and repair tissues in the body.

Explanation:

Mitosis is a process where a single cell divides into two identical daughter cells. During mitosis one cell divides once to form two identical cells and the dividing cell's chromosomes are copied and then distributed equally between the two new nuclei of the daughter cells.

The major purpose of mitosis is for growth and to replace worn out cells. It also plays an important part in the development of embryos.

Mitosis is divided into five stages:

1. Interphase- during interphase, the DNA in the cell is copied resulting in two identical sets of chromosomes. Microtubules also extend from the centrosomes outside the nucleus

2. Prophase- during this phase, the sister chromatids in each chromosome pair up, the nuclear membrane dissolves and the mitotic spindle consisting of microtubules and other proteins extend across the cell between the centrioles which move to opposite ends of the cell.

3. Metaphase- the chromosomes line up at the centre of the cell and the mitotix spindle attaches to eachmof the sister c hromatids.

4. Anaphase- the sister chtomatids are pulled apart to each end of the cell by the mitotic spindle.

5. Telophase- at each pole, a full set of chromosomes gather together, a membrane encloses each chromosome, the cell pinches at the middle and then divides into two. This is known as cytokinesis.

Compare cladistics with Linnaeus's classification

Answers

Cladistic is the arrangement of organisms according evolution, while in linear taxonomy, organisms are classified on the basis of similarities.

issues of food insecurity in high income countries​

Answers

Not sure i guess people are just insecure to eat in front of people

A complex multicellular organism has different levels of organization. What is the order of the levels from least complex to most complex?

1organ system, organ, tissue, cell
2cell, tissue, organ, organ system
3cell, organ system, organ, tissue
4organ, tissue, cell, organ system

Answers

Answer:

A. tissue, cell, organ, organ system, organism

Explanation:

The order of the levels from least complex to most complex are 3cell, organ system, organ, tissue.

What is complex multicellular?

The term multicellular organism is known to be a type of an organism that is made up of multiple cell.

These organisms are known to be complex due to the fact that they have different kinds of differentiated cells such as 3cell, organ system, organ, tissue.

Learn more about multicellular organism  from

https://brainly.com/question/11801282

Help!!
Cells of the skeletal system are specialized in their structure to store minerals. Which of the following is the function of these cells?

Produce chemicals that transmit signals.

Prevent the spread of disease in the organism.

Provide support to the body.

Absorb excess water released by digestion.

Answers

Answer: Provide support to the body.

Explanation:

The skeletal system is a system which is formed by the bones. The bones are important for the structure and function of the body. The bones are connected with the muscles to allow the movement of the body, and they protect the vital organs like heart, lungs, brains, and others. They provide support to the soft tissues, organs, and muscles of the body. They keep the human body upright. The skeletal system provide shape to the body. It provides support by acting as regions of attachment of soft body parts and muscles.

The behavior of an organism is influenced by both internal and external factors. How might a bear be influenced by external factors in its environment? A. A decrease in the number of fish causes bears to start consuming more plants. B. An increase in hunting causes bears to stay in covered areas and avoid humans. C. A decrease in temperature causes bears to look for food during the day instead of at night. D. all of these

Answers

Answer:

D. all of these

Explanation:

I just got it right in study island (:

Answer:

it's D

Explanation:

Explain how organisms in both of the ecosystems are dependent on their environmental interactions with other living things and with nonliving factors.

Answers

Answer:

Explanation:Organisms, and populations of organisms, are dependent on their environmental interactions both with other living things and with nonliving factors. ... Mutually beneficial interactions, in contrast, may become so interdependent that each organism requires the other for survival.

The organism that considered for an ecosystem that should be dependent on the environmental interactions should be explained below,

Environmental interactions:

The organism and the organism population should be based on the environmental interactions along with the other living things also even with the non-living things of factors.

On the other hand, Mutually beneficial interactions should be considered as the independent where each and every organism should needed other for the survival purpose.

learn more about an organism here: https://brainly.com/question/18167856

Determine the mRNA and amino acid sequence for the below DNA sequence.

Answers

AUGAGCCCCGCUAGGUUCUC

5 5. Normally, the temperature inside the scrotum is slightly lower than normal body temperature. What do you predict would happen if the temperature inside the scrotum were a few degrees higher than normal body temperature instead? A. Sperm would not be able to travel through the vas deferens. B. Sperm would be stored in the epididymis rather than in the testes. c. Sperm would not be able to develop properly. D. The rate of sperm production would increase,​

Answers

Answer:

C. Sperm would not be able to develop properly.

Explanation:

There is an optimum temperature where sperm production is at its best. An increase or decrease in temperature may affect the quality and quantity of the sperm.

If the temperature inside the "sc-rotum" raises by few degree than normal body temperature, than the "sp-erm" would not be able to develop properly.

What is the function of "sc-rotum"?

A pouch, which is suspended from the groin, and comprising the "tes-tes" and some of the male "s-ex" accessory ducts is known as the "sc-rotum". The prime function of the "sc-rotum" is to maintain the temperature essential for the process of "sper-matogenesis", that is, by situating the testes external of the body cavity.

Within the human "sc-rotum", the temperature is 3.1 degree C lesser than the usual temperature of the body. In case, if the temperature elevates of the "sc-rotum", the degeneration of the germinal epithelium will take place, which will eventually result in sterility. Therefore, for the production of sperms within the testes, a lower temperature is needed, otherwise the development of the "sp-erm" will not take place appropriately.

Thus, the correct answer is option C.

Find out more information about the function of "sc-rotum" here:

https://brainly.com/question/940283

which are examples of steroids? A. testosterone and trans fats B. cholesterol and phospholipids C. cholesterol and vitamin D D. estrogen and phospholipids

Answers

Answer:

A

Explanation:

because it really is suppose. to make u more stronger tougher and high testosterone.

clearing of these has a harsh effect on animal population. What is it called?

Answers

Trees I’m guessing is the answer

Neuromodulation is the release of chemicals (other than ____________ ) from cells that locally regulate or alter the response of neurons to neurotransmitters. The substances released are called ____________ . Neuromodulation generally results in either facilitation or inhibition. When there is greater response from a postsynaptic neuron because of the release of neuromodulators it is ____________ . This may result from either ____________ amount of neurotransmitter in the synaptic cleft or ____________ number of receptors on postsynaptic neurons. When there is less response from a postsynaptic neuron because of the release of neuromodulators, it is called ____________ . This results from either ____________ amount of neurotransmitter in the synaptic cleft or ____________ number of receptors on postsynaptic neurons.

Answers

Answer:

Neurotransmitters; neuromodulators; facilitation; an increased; an increased; inhibition; a decreased; a decreased.

Explanation:

In Biology, stimulus can be defined as an obvious change in either the chemical or physical structure of an organism' environment (either external or internal). Thus, all living organisms (both animals and plants) respond to changes in their environment and consequently, an appropriate response or reaction is made. Also, stimulus arising from within the organism is known as internal stimulus while those from its environment are known as the external stimulus.

In organisms, the specialized cells that detect stimulus are generally known as sensory receptors while a group of these receptors is referred to as sense organ.

Neuromodulation is the release of chemicals (other than neurotransmitters ) from cells that locally regulate or alter the response of neurons to neurotransmitters. The substances released are called neuromodulators. Neuromodulation generally results in either facilitation or inhibition. When there is greater response from a postsynaptic neuron because of the release of neuromodulators it is facilitation. This may result from either an increased amount of neurotransmitter in the synaptic cleft or an increased number of receptors on postsynaptic neurons. When there is less response from a postsynaptic neuron because of the release of neuromodulators, it is called inhibition. This results from either a decreased amount of neurotransmitter in the synaptic cleft or a decreased number of receptors on postsynaptic neurons.

The real length of one villus is 0.8 mm
Calculate the image length if the villus is viewed at a magnification of x20

magnification = size of image / size of real object

Answers

Answer:

Explanation:

Re arrange formula=Size of image=Magnification*size of real image

0.8mm*20=16mm

The image length will be "16 mm". A further explanation is below.

Given:

Magnification,

20

Size of real image,

0.8 mm

As we know the formula,

→ [tex]Magnification = \frac{Size \ of \ image}{Size \ of \ real \ image}[/tex]

or,

→ [tex]Size \ of \ image=Magnification\times Size \ of \ real\ image[/tex]

By substituting the values, we get

→                         [tex]=20\times 0.88[/tex]

→                         [tex]= 16 \ mm[/tex]  

Thus the response above is correct.

Learn more:

https://brainly.com/question/24716995

state the taxonomic family to which the virus that causes EVD belongs​

Answers

Ebolavirus, genus of viruses in the family Filoviridae, certain members of which are particularly fatal in humans and nonhuman primates. In humans, ebolaviruses are responsible for Ebola virus disease (EVD), an illness characterized primarily by fever, rash, vomiting, diarrhea, and hemorrhaging.

Describe Why are trochophores of interest to biologists?

Answers

Answer:

Because it is also one of the larval stages in some other groups of invertebrates, and are used by biologists to deduce evolutionary relationships among different groups of invertebrates

Explanation:

hope it will help you.

Pls help me and thank youuuu

Answers

Is between B and C but the correct answer should be B
The answers should probably be B

In the 1860s Gregor Mendel performed numerous dihybrid crosses between pea plants. Dihybrid crosses involve the study of the inheritance patterns related to two different traits. In guinea pigs the allele for black fur (B) is dominant over the allele for brown fur (b), and the allele for short fur (F) is dominant over the allele for long fur (f). What percentage of the offspring from a BbFf x bbff cross would be expected to be heterozygous for both traits

Answers

Answer:

25% of the progeny is expected to be dihybrid, BbFf, expressing Black and short fur

Explanation:

Available data:

the allele for black fur (B) is dominant over the allele for brown fur (b)the allele for short fur (F) is dominant over the allele for long fur (f)Cross: BbFf x bbff

Parentals)            BbFf      x         bbff

Phenotypes) Black/Short    Brown/Long

Gametes)       BF, Bf, bF, bf      bf, bf, bf, bf

Punnett square)      BF         Bf          bF          bf

                      bf    BbFf     Bbff       bbFf       bbff

                      bf    BbFf     Bbff       bbFf       bbff

                      bf    BbFf     Bbff       bbFf       bbff

                      bf    BbFf     Bbff       bbFf       bbff

F1) 4/16 = 1/4 = 25% of the progeny is expected to be dihybrid, BbFf, expressing Black and short fur

    4/16 = 1/4 = 25% of the progeny is expected to be bbFf, expressing Brown and short fur

    4/16 = 1/4 = 25% of the progeny is expected to be Bbff, expressing Black and long fur

    4/16 = 1/4 = 25% of the progeny is expected to be bbff, expressing Brown and Long fur

Answer:

25%

Explanation:

Because i took the test

distinguish between active and passive immunity​

Answers

Answer:While active immunity occurs when an individual produces antibodies to a disease through his or her own immune system, passive immunity is provided when a person is given antibodies.

Explanation:

DNA double helix. Hydrogen bonds break and helix opens. Each strand of DNA acts as a template for synthesis of a new, complementary strand. Replication produces two identical DNA double helices, each with one new and one old strand.

Answers

Answer:

The process described above is known as DNA replication.

Hope this helps you! Have an amazing day!

Other Questions
How many molecules are there in 24 grams of HSO? Which place was never settled by the Bantu?O A. The Equatorial forestB. The Sahara desertC. Western AfricaD. Southern Africa Please help me with the question please ASAP Activity2008 was a landmark year in presidential politics. Many aspects of the political climate energized voters, indicating a marked change from theoutgoing administration of George W. Bush.Part ARead this article about the 2008 and 2012 presidential elections. Use the information from the article, information from the lesson, and yourown knowledge to answer these questions: What was the historical significance of electing Barack Obama president in 2008? Was the election a signal of a changing electorate? How does Samuel try to befriend Richard Based on the article, which of the following isTRUE?Earth Day was founded in America in the1950s.BThe goal of Earth Day is to raise moneyfor the environment.CSenator Gaylord Nelson wanted peopleto know the planet was in danger.DToday, about 1 million people celebrateEarth Day around the world, Which word is repeated most often in "One Art"?A. MasterB. TravelC. ContinentD. Realms The "I Have a Dream" speech is described as a great moment in American history. What can be inferred from this? A) Dr. King practiced his speech for weeks before the March on Washington B) Dr. King's speech had a powerful and lasting impact on civil rights in the U.S. C) Dr. King and many more members of the audience were the descendants of slaves . D) Dr. King's organizational skills helped make The March on Washington possible. how do you come up with questions when finishing a story for kids(first I came up with) it is only 4 of them I have to come up with 1. what do you think of the book 2.3.4. Find the surface area of the following figure below. Use 3.14 for pi PLZ HELP :(Why does Ruby Allen-Short think young children often try to cut their own hair?It stifles the development of individuality, which can impede their child's ability to become a unique and happy adult.One of the first ways that children exert control over themselves is by choosing what they wear and how they look.Many people react to this milestone with instinctual embarrassment.Up until middle school, most decisions are made by parents, teachers, and other adults. Slove the system of linear equations by graphing y=-x+7 y=x-1 Which group gives support to families that need help?A. AlateenB. Alcoholics AnonymousC. Recovery InterventionD. Al-Anon Is the vertex of the graph a maximum or a minimum? A. maximum B. minimum C. neither D. both Read the sharecropping contract, then answer thequestionAccording to the contract, how does H.L. Whipplecontrol the lives of his sharecroppers?He or sheevery morservice unwill be alland gettinin summework willsundownCheck all of the boxes that apply.He tells them what clothing to wear whilethey workHe tells them when to start and stop working.He tells them how to spend their time. In desperate need of help. If anyone could help it would be greatly appreciate. Will rate brainliest! Read this short passage then awnser the questions.1. What does saboteur mean?A. allyB. RebelC. Inmate2. What infrence can be made about todays passage?A. the germans would have likely punished anyone caught helping baalsrud.B. Many people were unwilling to help baalsrud.C. The germans didnt try to catch baalsrud. are diseases that you can get through intimate skin-to-skin contactHeart diseasesDermatological diseasesChronic diseasesSexually transmitted diseases Which sentence is a fragment?1. The next door neighbors of my grandparents.2. The Hubers make homemade apple cider with their cider press. Coach Riley asked 35 students to count the number of push-ups they completed during class. The results are displayed in the box plot.He then asked them to complete 4 more by the end of class. Which of the following statements is TRUE about a new plot with the altered data?A - The range will Increase by 4 unitsB - The median will be greater than 46.C - The plot will be translated 3 units to the right. D - The interquartile range will be 4 times larger.