the question is in the photo

The Question Is In The Photo

Answers

Answer 1
which question it’s 2 of them?

Related Questions

In a chemical analysis of a sample of animal tissue, which element would most likely be found in the smallest quantity?

Answers

Answer:

Iodine

Explanation:

Iodine is needed by animals because the body's metabolic rate is controlled by the action of an iodine hormone, called thyroxine, which is secreted by the thyroid gland in the neck.

If the animal fails to supply enough iodine through food to be able to make a normal amount of this compound, then the thyroid gland enlarges or expands trying to create enough, resulting in a common type of goiter.

the other liquid waste product in cellular respiration is

Answers

Answer: During the process of cellular respiration, carbon dioxide is given off as a waste product. This carbon dioxide can be used by photosynthesizing cells to form new carbohydrates. Also in the process of cellular respiration, oxygen gas is required to serve as an acceptor of electrons.

Explanation: Hope dis helps :)))))  

Answer:

the waste products are carbon dioxide and water

1.
2.
3.
4.
What is the Answer?

Answers

Answer:

the answer is 3

Explanation:

PLEASE HELP
the question is in the pic

Answers

the answer is genetic variation because crossing over leads to changing the traits inherited by the daughter cells

Helppp please
Which federal agency, formed in 1977, now combines regulation and other aspects of the energy industry that were
previously scattered under several other agencies?

O Occupational Safety and Health Administration

O Mine Safety and Health Administration

OU.S. Energy Information Office

o Department of Energy

Answers

D. Department of Energy (DOE)

Explanation: The DOE has been officially in charge of all aspects of energy since 1977; their activities prior to this were assigned to various different government agencies.

Answer:  The correct answer is Department of Energy (DOE)

Explanation:  This answer has been confirmed correct.

Chemicals and proteins in the cell read the DNA ___________ for building that make cells, tissue and organs.
(A.Instructions
(B.Genes
(C.Recipe
(D. Life manual

Answers

You answer will be B!! Good luckkk!

Genes of DNA can be read by chemicals and proteins for building that can make cells, tissue, and organs. Therefore, option "B" is correct.

What are genes?

Genes are composed of  DNA which is the genetic material. Gene is the functional unit of heredity. Chromosomes are comprised of multiple genes. Genes code for a particular trait. More than one gene can code for a particular trait.

The function of DNA and RNA is controlled by genes. There are more than 3000 genes present. Mutation can occur in genes. Deletion and insertion are some types of mutation genes. Transposomes are called jumping genes. Sickle cell anemia and cystic fibrosis are some examples of gene mutations.

Genes code for the traits such as the color of eyes, height quality of hair, and more.

Learn more about genes, here:

https://brainly.com/question/31121266

#SPJ2

Someone please help!!! Anyone!?!? I'll give A Brainliest

Answers

Answer:

These are Punnet squares. The answer for 1 is 50% The answer for 2 is 100%

The answer for 3 is 100%

Explanation:

I hope this helps!! Have a great day!!!

to which class of macromelules do anitbodies belong to

Pls answer now I am giving 40 points

Answers

Answer

:proteins

The four classes of macromolecules are carbohydrates, proteins, nucleic acids, and lipids. These biomolecules can also be referred to as polymers. In turn, we will discuss how these four classes of macromolecules are synthesized in the cell from their constituent building blocks or monomers.

Explanation:

Antibody Classes. Antibodies can be divided into five classes—IgM, IgG, IgA, IgD, IgE—based on their physiochemical, structural, and immunological properties. IgGs, which make up about 80 percent of all antibodies, have heavy chains that consist of one variable domain and three identical constant domains.

Answer:

Antibodies are proteins. An antibody (Ab), also known as an immunoglobulin (Ig), is a large Y-shape protein produced by plasma cells that is used by the immune system to identify and neutralize foreign objects such as bacteria and viruses

Explanation:

An earthquake occurred three hundred miles off the shoreline, and massive flooding occurred on land as a result.
Which best describes what occurred?
- Continental shifting resulted in a tsunami.
- Continental shifting resulted in a volcano erupting.
- Tidal activity in the subduction zone caused a tsunami.
- Tidal activity in the subduction zone caused a volcano to erupt.

Answers

Answer:

An earthquake occurred three hundred miles off the shoreline, and massive flooding occurred on land as a result. Which best describes what occurred? Continental shifting resulted in a tsunami.

Explanation:

The best thing that describes the scenario that occurred is tidal activity in the subduction zone caused a tsunami. The correct option is C.

What is tsunami?

The violent breaking of rock during an earthquake releases energy that travels through the earth in the form of resonance known as seismic waves.

These seismic waves radiate from the hypocenter in all directions, becoming weaker as they travel further away from the hypocenter.

Tsunamis are a series of large waves with extremely long wavelengths and periods that are usually caused by a violent, impulsive undersea disturbance or activity near the coast or in the ocean.

When a large earthquake ruptures, the faulting can cause vertical slip large enough to disturb the overlying ocean, causing a tsunami to travel in all directions.

Thus, the correct option is C.

For more details regarding tsunami, visit:

https://brainly.com/question/14782736

#SPJ6

The process of photosynthesis converts carbon atoms from carbon dioxide into

Answers

Sugar
It for plant to eat

- Lee el siguiente párrafo y a continuación responde lo que se te pide.Los seres humanos primitivos comenzaron a clasificar las plantas y los animales tanto por su utilidad como por el daño que les causaban, luego fueron profundizando aún más en sus conocimientos sobre la flora y la fauna de su entorno, identificando los ciclos biológicos y hábitat, entre otros aspectos que facilitaron su producción y pronta disponibilidad. Con base en el párrafo anterior se puede afirmar que: * 1 punto A) Empezaron a entablar una relación más estrecha con el medio ambiente. B) Abandonaron su vida primitiva y nómada C) Incrementaron sus conocimientos únicamente sobre el ciclo del agua. D) Empezaron la agricultura y la piscicultura.

Answers

Answer:

A) Empezaron a entablar una relación más estrecha con el medio ambiente.

Explanation:

Desde el pasaje, podemos ver que la gente comenzó a prestar más atención a su entorno y cómo la fauna y la flora afectan la vida humana.

Incluso intentaron desarrollar un sistema burdo de clasificación biológica. Henec, se puede inferir que las personas desarrollaron una relación más cercana con su entorno.

The air in the thermosphere is composed of atoms of _____ that are very far apart from each other.

Answers

Answer:

Explanation:

In the upper thermosphere, atomic oxygen (O), atomic nitrogen (N), and helium (He) are the main components of air.

Energetic ultraviolet and X-ray photons from the Sun also break apart molecules in the thermosphere. In the upper thermosphere, atomic oxygen (O), atomic nitrogen (N), and helium (He) are the main components of air there ya go son

17. Match the major types of cancer with the types of cells they occur in
Adenocarcinomas
a. The lowest layer of the epidermis (skin)
Basal cell carcinoma
b. upper layers of skin, the lining of stomach, lungs,
kidneys
Squamous cell carcinoma
c. melanin-producing cells of the skin
Sarcoma
d. immune cells in the blood (T cells, B cells, and
bone marrow)
Leukemia and lymphoma
e. bones, fat, blood vessels, tendons, ligaments
Multiple myeloma
1. cells that produce fluids (breast, colon)
Melanoma
g. plasma cells (a type of immune cells)​

Answers

LolsbdgsbcgcsnnsjzkmcjMCk

Describe some of the properties of water and explain how the structure of water is responsible for these properties.

Answers

Answer:

The main properties of water are its polarity, cohesion, adhesion, surface tension, high specific heat, and evaporative cooling. A water molecule is slightly charged on both ends. This is because oxygen is more electronegative than hydrogen. ... The stream of water bends due to the polarity of water molecules.

Explanation:

Its easy! If right will give brainlist! Don't overthink..:) Just answer

The virtual image changes with the position of the mirror to the eye when the mirror is..............?
Fill in the blanks

Answers

Answer:

When the mirror is inside the focal point..?

when benedicts solution is added to a sucrose solution and put into a boiling water-bath , no change in color is observed

state why no color change is observed

Answers

Answer:

b

Explanation:

what is the complementary dna strand of C-C-T-A-G-C-T

Answers

Answer:

G-G-A-T-C-G-A

Explanation:

The A-T pairs are connected by two hydrogen bonds, while the G-C pairs are connected by three hydrogen bonds.

Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide
chain, identifying the codons, anticodons, and amino acid sequence.
DNA: CGATACAATGGACCCGGTATGCGATATCC

Answers

I don’t feel like answering all that but....
C=G G=C T=A A=U
C=G A=T dont know the rest have a gcodocododd dday

Baby Brain Power
How does the bar graph on page 5 expand on
information presented in the passage?
It shows exactly how many synapses a person's
brain has at birth
Speech, emotional regulation, movement, and
vision-all of these extraordinary abilities and
many more are possible thanks to the organ
that serves as the body's control center. When
one thinks of "brain power, it is the faces of
adult inventors, professors, and novelists that
Ekely come to mind. Remarkably the most
critical time period with respect to brain
development occurs relatively soon after an
individual is bom.
A newborn enters the world as a fairly helpless
creature, but her brain hos billions upon
bitions of specialized cells coiled neurons.
It gives more information than the passage by
showing that the number of synapses returns to
what it was at birth.
It provides specific information about how many
synaptic connections are formed in each year of a
person's life.
It gives information about synaptic connections
beyond the time period described in the passage.
2
3
4
5

Answers

Answer:

C

Explanation:

Took it

Which statement best describes homeostasis in a cell?

A. Molecules are in equilibrium (balance) inside and outside the cell

B. Active transport causes molecules to move from low to high concentration the molecules are un-equal

C. Pathogens enter cells and infect those cells, causing them to malfunction

D. Cells do not maintain homeostasis with their external environments.

Answers

Answer:

I believe the answer is A. The cell is in an equilibrium inside and out when it goes through homeostasis.

Explanation:

Which refers to the sum of all the forces that act upon an object?

A. net force

B. absolute force

C. balanced force

D. positive force

Answers

Answer:

Net force

Explanation:

Net force is the vector sum of forces acting on a particle or body. The net force is a single force that replaces the effect of the original forces on the particle's motion. It gives the particle the same acceleration as all those actual forces together as described by the Newton's second law of motion.

Answer:

net force

Explanation:

HELP!!!!15 POINTS!!!!!!

i think it's f but idk..

Answers

Answer:

F is good

Explanation:

F is a very good choice

Which of the following statements regarding prokaryotic and eukaryotic cells is true

Answers

Answer:

I would need the statements to answer that. however prokaryotic cells are plant cells and eukaryotic cells are animal cells

Answer:

They are typically smaller than eukaryotic cells. The DNA of a prokaryotic cell is contained in the nucleoid. There are several ways in which prokaryotic cells are different from eukaryotic cells. Firstly, they are generally smaller in size, their organelles are not membrane bound, and they have no nucleus. They, however, share commonalities with eukaryotic cells including the presence of a bilipid plasma membrane, presence of ribosomes and DNA.

Hope this helps, have a great day/night, and stay safe!

Explain how diffusion and osmosis are related to the symptoms of cystic fibrosis

Answers

Answer:

Answer D

Explanation:

just took the test.

In the United States, most racial discrimination comes in the form of ________ discrimination.

A. Direct
B. overt
C. indirect
D. extra​

Answers

Answer:

C, indirect because most people do not admit that they are racist and claim that they didn't do things because they're racist.

Explanation:

In the United States, most racial discrimination comes in the form of indirect discrimination. Therefore, option C is the correct option.

What is indirect discrimination?

Indirect discrimination involves the policies or practices that appear neutral on the surface, but deep down have adverse effects on the people belonging to a particular race.

Indirect discrimination can be seen in various areas, such as employment. During a job vacancy, the job applicant requires to speak a high level of proficient English which appears to be a reasonable requirement for the job, but it can lead to a significant impact on non-native English speakers.

Indirect discrimination can be seen in the education field where schools give admissions to only those students who will qualify for a specific education test which may seem unfair to students belonging to a specific race, and having different educational backgrounds.

Therefore, indirect discrimination is the most common form of discrimination observed in the United States.

Learn more about indirect discrimination here:

https://brainly.com/question/14710203

#SPJ7

BRAINLIEST:
in which month is a hurricane most likely to occur: October or December? explain

Answers

Answer:

October

Explanation:

October is one of the hurricane season months

To achieve which of the following goals would rotational grazing be most appropriate? (3 points)
-To maximize livestock populations while minimizing costs
-To preserve vegetation and soil fertility of land
-To involve townspeople in the operations of a nearby farm
-To transform an abandoned city lot into a neighborhood garden

Answers

Answer:

To preserve vegetation and soil fertility of land

Explanation:

.

A person with a low number of white blood cells could have difficulty in fighting infections and A decrease in the number of lymphoid stem cells could result in a decrease in red blood cell.

What is nucleotide?

It is the sub units and buIlding blocks of DNA. It is made up of a five-sided sugar, phosphate group and then a nitrogen base.

These groups make the backbone of the DNA helix. If you look at a DNA helix, they make the side of the ladder or the side portion. They connect to a nitrogen base which make the steps of the ladder.  The type of sugar that is used in a DNA helix is called deoxyribose.

Nitrogen bases are the molecules that make up the steps of the ladders. There are four different nitrogen bases, namely; Guanine, Thymine,Adenine and Cytosine.

Pyrimidines are compounds that make a single 6-sided ring. Examples of pyrimidines are Cytosine and Thymine. Purines on the other hand make 5-sided and 6-sided rings.

Therefore, A person with a low number of white blood cells could have difficulty in fighting infections and A decrease in the number of lymphoid stem cells could result in a decrease in red blood cell.

Learn more about white blood cells on:

https://brainly.com/question/19202269

#SPJ5

PLZ HELP (30 POINTS)




Which of the following is a direct benefit of using agriscience to optimize land use for animal grazing?

Reducing soil degradation
Inventing new fertilizers
Updating irrigation
Increasing climate change

Answers

Answer: The answer is D Increasing climate change

Explanation: Which of the following is a direct benefit of using agriscience to optimize land use for animal grazing? hope this helps man

D

Explanation:

i think that's the answer

explain how darwin's journey to the galapagos islands contributed to his creation of the theory of evolutions.

Answers

Explanation:

During his visit to the islands, Darwin noted that the unique creatures were similar from island to island, but perfectly adapted to their environments which led him to ponder the origin of the islands' inhabitants.

Among those that struck Darwin so greatly were the finches that are now named in his honor. Darwin would later base some of his thought from the supposing that these finches were all descendents of the same lineage.

Which of the following processes begins when a star enters the main sequence?
a


Nuclear fission
b


Nuclear fusion
c


Condensation of a nebula
d


Appearance of a supernova

Answers

Answer:

i believe it is B: Nuclear Fusion

Explanation:

Answer:

C. Nuclear Fusion

Explanation:

I am 1000000000% sure this is correctamundo, stay cool, and have a great day!

Other Questions
What conflict does the setting of this story create for Margot?Question 3 options:She misses her old friends from Earth.She cannot live with her parents while she is on Venus.She is depressed without the sun.There is never enough light for her to see.PLEASE ANSWER ASAP WILL GIVE BRAINLIEST what is greater 9/3, 2 3/4 BRAINLIEST Which of the following is true? a) Slow-twitch muscle fibers rapidly produce ethyl alcohol.b) Fast-twitch muscle fibers rapidly produce lactic acid.c) Fast-twitch muscle fibers rapidly produce acetyl-CoA.d) Slow-twitch muscle fibers rapidly produce lactic acid. Sorry, wrong number vocabulary activity Sarah works 6 hours a day, Monday through Friday. What is her pay for a week? Completa la frase con el tiempo futuro de un verbo regular.Nuestra campaa ________________________ (fomentar) la proteccin del medio ambiente.Question 8 options:fomentanfomentarfomentafomentarn A wire is needed to support a vertical pole 4 feet tall. The cable will be anchored to a stake 3 feet from the base of the pole. Howmuch cable is needed?4 ft3 ftA cable of lengthfeet is needed.Enter your answer in the answer box. what happens if the temperature of a system at equilibrium is increased? Plz sb complete this for me Help me please Hurry!!! How many ounces are equal to 7 pounds?1) 112 ounces70 ounces84 ounces56 ouncesMy Progress > How would Americans will feel about Louisiana becoming a state what causes night blindness What is the mass and volume of the nucleus relative to the size of the atom? ASAP!!! PLEASE ONLY THE FIRST TWO AND THE LAST TO IGNORE THE MIDDLE Completa las siguientes oraciones de manera lgica.Each word will be used only once.Cunto cuesta una computadora queun escner grande?Tiene computadoras queimprimir?Hay agendas electrnicas queestudiantes?Hay alguna tienda queabierta?Sabe si hay alguna computadora que noescner? Which particle has the least mass? Proton, a helium atom, electron, hydrogen atom Select the correct answer.Which of the following is an armed martial art?A. JudoB. AikidoC. FencingD. All of the above What does the author list in the stage directions in the actor's nightmare? Difference between monopoly and monopolistic competition